Application of CIPK9 gene in regulation and control of photosynthetic rate and starch content of rice leaves
By constructing CIPK9 gene overexpression and knockout materials, the expression of the CIPK9 gene in rice was promoted, solving the problem that it is difficult to synergistically improve photosynthetic rate and starch content in existing technologies. This resulted in a significant increase in photosynthetic rate and starch content in rice, providing important support for high photosynthetic efficiency breeding.
Patent Information
- Application Number
- CN202511571796.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-30
- Publication Date
- 2026-02-06
AI Technical Summary
Existing technologies are insufficient to synergistically improve the photosynthetic rate and starch content of rice, and often lead to mutual constraints between traits, lacking systematic regulatory genes.
By constructing CIPK9 gene overexpression and knockout materials, we studied its regulatory role in photosynthetic rate and starch content in rice leaves, promoted the expression of CIPK9 gene or enhanced its protein function, and introduced it into rice callus tissue using Agrobacterium-mediated transformation to cultivate rice germplasm with high photosynthetic rate and high starch content.
It significantly improves the photosynthetic rate and starch content of rice leaves, providing genetic resources and theoretical basis for high photosynthetic efficiency breeding, and enhancing the yield potential of rice.
Smart Images

Figure CN121472293A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving the application of the CIPK9 gene in regulating the photosynthetic rate and starch content of rice leaves. Background Technology
[0002] Crop yield essentially stems from photosynthetic efficiency and the accumulation of photosynthetic products. Rice yield is determined by the source (e.g., photosynthetic product production in leaves), the sink (e.g., starch storage in grains), and the translocation capacity between them. Among these, the "source" organs (primarily leaves) fix carbon sources through photosynthesis, and their efficiency directly constrains the accumulation of initial biomass. Studies have shown that the metabolic efficiency of transient starch in leaves significantly affects the export capacity of photosynthetic products. Furthermore, the capacity for starch synthesis and storage is a major determinant of grain yield.
[0003] Currently, improving rice yield through molecular breeding has become an important direction. Although some genes have been shown to regulate photosynthesis or starch metabolism, existing technologies have significant limitations: these genes mostly act on single metabolic processes, making it difficult to synergistically improve photosynthetic rate and starch content; and they often lead to mutual constraints between traits, such as carbon metabolism imbalance or quality decline. Therefore, discovering upstream regulatory genes that can systematically coordinate these two key processes is an urgent need in the current breeding field.
[0004] CIPK family genes are known to play roles in plant stress responses, but the specific function of the CIPK9 gene has previously been mainly related to potassium ion uptake. Its function in regulating photosynthetic rate and starch content in rice has not been reported to date. Summary of the Invention
[0005] This invention addresses a gap in existing technologies by providing the application of the CIPK9 gene in regulating photosynthetic rate and starch content in rice leaves. By constructing CIPK9 gene overexpression and knockout materials and further examining the photosynthetic rate and starch content of transgenic materials, this invention investigates how CIPK9 regulates rice photosynthetic rate and starch content. It discovers that this gene influences the photosynthetic rate of leaves, thereby causing starch accumulation in the flag leaf. This reveals the important role of this gene in positively regulating rice photosynthesis and starch accumulation, providing important genetic resources and a theoretical basis for high-efficiency photosynthesis breeding.
[0006] This invention provides the application of the CIPK9 gene in any of the following A1)-A4): A1) Regulate the photosynthetic rate and / or starch content of rice; A2) Prepare products that regulate the photosynthetic rate and / or starch content of rice; A3) Cultivate rice germplasm with high photosynthetic rate and / or high starch content; A4) Prepare and cultivate rice germplasm products with high photosynthetic rate and / or high starch content; The amino acid sequence encoded by the CIPK9 gene is shown in SEQ ID NO:3.
[0007] Furthermore, the nucleotide sequence of the CIPK9 gene is shown in SEQ ID NO:1, and the CDS sequence is shown in SEQ ID NO:2.
[0008] Furthermore, the regulation is a positive regulation.
[0009] Furthermore, by promoting the expression of the CIPK9 gene or enhancing the function or activity of its protein, the photosynthetic rate and / or starch content of rice can be increased.
[0010] Furthermore, the rice germplasm exhibits all or some of the following: B1) Increased photosynthetic rate; B2) Increased starch content in leaves.
[0011] This invention also provides the application of the overexpression vector containing the CIPK9 gene in any of the following A1)-A4): A1) Regulate the photosynthetic rate and / or starch content of rice; A2) Prepare products that regulate the photosynthetic rate and / or starch content of rice; A3) Cultivate rice germplasm with high photosynthetic rate and / or high starch content; A4) Prepare and cultivate rice germplasm products with high photosynthetic rate and / or high starch content; The amino acid sequence encoded by the CIPK9 gene is shown in SEQ ID NO:3.
[0012] Furthermore, the backbone vector of the overexpression vector is the plant expression vector pU1301.
[0013] The present invention also provides a method for enhancing the photosynthetic rate and / or starch content of rice by promoting the expression of the CIPK9 gene in rice or enhancing the function or activity of its protein, thereby increasing the photosynthetic rate and / or starch content of rice, wherein the amino acid sequence encoded by the CIPK9 gene is shown in SEQ ID NO:3.
[0014] Furthermore, methods to promote CIPK9 gene expression in rice include: S1. Construct a CIPK9 gene overexpression vector; S2. The recombinant vector from step S1 was introduced into rice callus tissue via Agrobacterium-mediated transformation, and transgenic rice plants were obtained after cultivation. S3. Positive transgenic rice plants were obtained through screening.
[0015] Further, in step S1, the CIPK9 gene fragment is amplified using primers as shown in SEQ ID NO:4-5, and then ligated to the backbone vector pU1301 to obtain a recombinant vector that overexpresses the CIPK9 gene.
[0016] The present invention also provides a method for cultivating rice with high photosynthetic rate and / or high starch content, wherein an expression cassette, expression vector, and recombinant microorganism overexpressing the CIPK9 gene are introduced into rice callus tissue to obtain transgenic rice, wherein the amino acid sequence encoded by the CIPK9 gene is shown in SEQ ID NO:3.
[0017] Furthermore, the genetically modified rice exhibits all or some of the following characteristics: B1) Increased photosynthetic rate; B2) Increased starch content in leaves.
[0018] Beneficial effects: This invention is the first to explore the important function of the rice CIPK9 gene in regulating the photosynthetic rate and starch content of rice leaves. Transgenic materials overexpressing the CIPK9 gene were constructed, and the effects of these materials on the synthesis of starch content in the 0-2000 μmol / mL range were investigated. -2 s -1 The study investigated the net photosynthetic rate and leaf starch content under varying light intensities. Overexpression of CIPK9 significantly increased the photosynthetic rate and starch accumulation in rice leaves. This indicates that the gene has significant breeding value in high-light-efficiency breeding and broad application prospects in agricultural production. Attached Figure Description
[0019] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 This invention provides a comparison of the net photosynthetic rates of different CIPK9 genotypes in Example 2, where WT is a rice variety from Nipponbare. Figure A shows a comparison of the net photosynthetic rates of WT at the tillering stage with those of CIPK9-OX-1-5; Figure B shows a comparison of the net photosynthetic rates of WT at the tillering stage with those of CIPK9-OX-3-4; Figure C shows a comparison of the net photosynthetic rates of WT at the tillering stage with those of cipk9-2-3. "*" indicates a p-value < 0.05 in the t-test, indicating a significant difference; "**" indicates a p-value < 0.01 in the t-test, indicating an extremely significant difference. Error bars represent SD, n=4.
[0021] Figure 2 This invention relates to the detection of starch content in CIPK9 transgenic material in Example 3 of the present invention. WT is a rice variety called Nipponbare. "*" indicates a p-value < 0.05 in the t-test, indicating a significant difference; "**" indicates a p-value < 0.01 in the t-test, indicating an extremely significant difference. Error bars represent SD, n=6.
[0022] Figure 3 The expression level of CIPK9 overexpression material in Example 1 of this invention compared to WT. "**" indicates a p-value < 0.01 in the t-test, indicating a highly significant difference. The error bar represents the standard deviation (SD), n=6. Detailed Implementation
[0023] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.
[0024] Example 1 Construction of transgenic material The CIPK9 gene sequence is shown in SEQ ID NO:1, its CDS sequence is shown in SEQ ID NO:2, and the encoded protein sequence is shown in SEQ ID NO:3. Overexpression and gene knockout transgenic materials were constructed based on the CIPK9 gene, as detailed below: (1) Construction of transgenic materials overexpressing CIPK9 CIPK9-OX is a transgenic material overexpressing CIPK9 cultivated in our laboratory. Based on the CIPK9 gene information, full-length cDNA was amplified using primers pU1301-CIPK9-F and pU1301-CIPK9-R as shown in SEQ ID NO:4-5. The fragment was then homologously recombined into the overexpression vector pU1301 containing the CaMV35S promoter using ABclonal's 2X seamless cloning premix (catalog number: RK21020). After sequencing confirmation, genetic transformation was performed using Agrobacterium-mediated transformation. pU1301-CIPK9-F (SEQ ID NO:4): TACGAACGATAGCCGGTACCATGGCGGAGGCGGAGGCGGA (The underlined part is the Kpn1 connector, and the bold part is the Kpn1 sequence). pU1301-CIPK9-R (SEQ ID NO:5): TTGCGGACTCTAGAGGATCCTCACCTCTTCTTTGCTGCTTTTGCGT (The underlined part is the BamH1 connector, and the bold part is the BamH1 sequence).
[0025] After successful construction, the expression level of CIPK9-OX material was determined. Specifically, 2 µL of diluted cDNA product was used as a template, and 2 µL of ddH2O, 0.4 µL of RT primers, 5 µL of 2 × TransStart® Tip Green qPCRSuperMix (TransGold: AQ141), and 0.2 µL of Dye II were added, with a total reaction volume of 10 µL. Rice ubiquitin gene was used as an internal control for each sample, and three technical replicates were set up. The PCR program was run on 384-well plates using a QuantStudio 6 Flex Real-time PCR System (Applied Biosystems) and 2... -△△CT The analytical methods are used to analyze the results. For example... Figure 3 As shown, using wild-type Nipponbare material as a reference, the expression level of the CIPK9 gene in the CIPK9-OX transgenic material constructed in this invention is significantly increased compared to WT. Among them, the expression level of the CIPK9-1-5 family is about 172 times higher than that of WT, and the expression level of the CIPK9-3-4 family is about 49 times higher than that of WT material.
[0026] (2) Construction of CIPK9 knockout transgenic material cipk9-cri is a CIPK9 knockout transgenic material cultivated in our laboratory. The knockout target sites (SEQ ID NO: 6-7) with the highest knockout efficiency were selected using the CRISPR-design website developed by the Bioinformatics Center of Huazhong Agricultural University (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR). Target A: CTTGATGGCGAGGGTGTCGCCGG Target G: TATGGTACACTCCTCTGCTGTGG Targeting primers were designed based on the vector system developed by Professor Liu Yaoguang's laboratory at South China Agricultural University (as shown in SEQ ID NO: 8-11). CIPK9-cri-U3F(ggcaCTTGATGGCGAGGGTGTCGC) CIPK9-cri-U3R (aaacGCGACACCCTCGCCATCAAG) CIPK9-cri-U6aF (gccgTATGGTACACTCCTCCTGCTG) CIPK9-cri-U6aR (aaacCAGCAGAGGAGTGTACCATA) The target was assembled into the expression vector pYLCRISPR / Cas9-MH in a single-gene, dual-target configuration. After sequencing confirmation, it was used for genetic transformation. The recipient rice was Nipponbare japonica. WT was a wild-type Nipponbare material.
[0027] Example 2: Demonstrating the regulatory effect of the CIPK9 gene on the photosynthetic rate of rice using transgenic materials. This embodiment measured the photosynthetic parameters of the CIPK9 transgenic rice line. The specific steps are as follows: After installing the instrument, follow these steps to perform routine instrument checks and measure sample photosynthetic parameters: (1) Check if the chemicals (desiccant and soda) on the right side of the instrument are available. Connect and install the hardware according to the instructions (pay special attention to the correct connection of the D-type connector, which is wider at the top and narrower at the bottom. The red mark on the round plug should be aligned with the red mark on the analyzer and pushed in horizontally without leaving any gaps). Install the LED light source, connect the buffer bottle, and place it at a distance of more than 5 m from people. If there is wind, place it upwind.
[0028] (2) After confirming that the instrument connection is correct and the power supply is sufficient, press the power switch on the right side of the instrument. After the system runs, select the 2*3 LED light source configuration in the configuration interface. After the system displays that everything is OK, press "Y" to confirm the connection status, and then enter the main menu interface. Warm up for about 20 minutes.
[0029] (3) During the preheating period, perform routine checks. First, press F4 (New Msmnts) to enter the measurement menu, and fully screw the two chemical tubes on the left side of the machine to the Bypass position. ① Temperature Check: Press the PGUP key to jump to the third page and bring up line H. Check the machine's air conditioning temperature, ambient temperature, and blade chamber temperature. The difference between these three temperature values should be within 1℃. If they exceed this range, the machine should be repaired before conducting the experiment. Also check the position of the blade temperature thermocouple in the analyzer blade chamber; its junction should be approximately 1 mm higher than the blade chamber gasket.
[0030] ② Check the light source, quantum sensor, and atmospheric pressure sensor: Press the number key 2 to bring up function line 2, then press the F5 (Lamp=) function key to set the light intensity. Check whether the ParIn value in line g is consistent with the set light intensity. Cover the external quantum sensor with your hand and check whether the ParOut value changes. Also check whether the Prss_kPa value is reasonable (generally 100 kPa).
[0031] ③ Leaf chamber mixing fan check: Press F5 (Lamp=), then press the letter O to turn off the light source. Then press F1 (Leaffan), then press the letter O to turn off the leaf chamber mixing fan. Place the analyzer next to your ear (you should not be able to hear the fan at this time). Then press F1 (Leaffan), then press the number 5 to turn on the leaf chamber mixing fan. You should hear the fan at this time, which means it is working normally (its working state is generally FAST).
[0032] ④ Gas path blockage check: Press the home key to jump to the first page, press the number key 2 to bring up the function bar, press F2 (Flow), set the flow rate Target to 1000, and check whether the flow value in line b can reach above 650 (under standard atmospheric pressure). Then, rotate the adjustment knob of the chemical tube containing Na2CO3 completely from the bypass side to the scrub side and observe that the flow value in line b should drop by less than 20. Similarly, rotate the adjustment knob of the chemical tube containing desiccant completely from the bypass side to the scrub side and observe that the flow value in line b should drop by less than 20 (note that the adjustment knobs must be adjusted one by one).
[0033] ⑤ Zero-point flow check: Turn off the air pump F2 (Flow), letter O and the blade chamber mixing fan F1 (Leaffan), and observe whether the change in Flow on line b is within ±2. If it is, it is normal; if it is not within this range, press F3 (Calib Menu) and select the "Flow meter zero" mode for calibration. After completion, adjust the flow rate back to 500 and set the blade chamber mixing fan to FAST mode.
[0034] ⑥ Leaf chamber leakage check: Keep the drug tube in the Scrub state, tighten the leaf chamber, blow air around the leaf chamber, and observe whether the change in the CO2 (sample chamber CO2 concentration) reading in row a is less than 2. If the change is large, it indicates that the leaf chamber is leaking.
[0035] ⑦ CO2 and H2O IRGAs Zero Point Check: Ensure the leaf chamber is leak-proof and the reagent tube is in Scrub mode. Observe whether the CO2 reading on line a is within ±5 mmol; and the H2O reading is within ±0.5 mmol. If the values fluctuate beyond this range, find the cause of the interference zero point, such as chemical failure or leakage. If the requirements are still not met after the data stabilizes, enter the calibration menu to perform IRGAs zero. After completion, fully screw the reagent tube into the Bypass position.
[0036] ⑧ Zero-point check of the leaf temperature thermocouple: Disconnect the purple plug (on the left side of the analyzer) from the IRGA analyzer, select line h, and check if the difference between the air conditioning temperature (Tblock) and the leaf chamber temperature (Tleaf) is within 0.19℃. If it is greater than 0.1℃, use a flathead screwdriver to calibrate the temperature of the potentiometer at the bottom of the analyzer so that the leaf chamber temperature and the air conditioning temperature are equal or differ by less than 0.19℃. Turning the screwdriver clockwise increases the leaf chamber temperature, and counterclockwise decreases it. After completion, reconnect the purple plug.
[0037] 9. Matching valve check: Press the number key 1 to bring up function line 1, then press F5 (Match) and observe whether the matching valve at the bottom of the analyzer is working properly.
[0038] (4) After ensuring the machine is working properly, prepare to start the measurement. At this time, the chemical tube is in the completely bypass position, and the leaf chamber is completely closed. Press the number key 2, press F4 (Temp=), move the cursor, click "Edit" to set the Block-Target temperature to within 69℃ of the ambient temperature, and press F5 (keep). Then press F5 (Lamp=), click "Edit" to set the PAR-Target to "1200 μmol m -2 s -1 Press F5 (keep).
[0039] (5) After setting the conditions, press the number key 1, then press F1 (Open LogFile) to create a data storage folder, set the folder name, select the storage path as Flash (CF card), "Enter", and then add a remark, "Enter".
[0040] (6) Open the leaf chamber, clamp the plant leaf to be measured, and be careful not to break the leaf.
[0041] (7) Press the number key 3, then press F1 (area) to input the actual leaf area of the measured leaf in the leaf chamber. After completion, press the number key 1 to return to the recording interface and press F5 (Match) to perform matching.
[0042] (8) Wait for the parameters of each row to stabilize. This process usually takes 2-3 minutes in outdoor field experiments, mainly waiting for the CO2 fluctuation in row b to reach 0.2 μmol*mol. -1 Within this range, the Photo value in row c is consistently one decimal place (within 0.5 increments); other parameters in row c are also within the normal range (0...). <Cond<1、Ci> 0, Tr>0).
[0043] (9) After stabilization, press F1 (Log) or press the shortcut button on the analyzer to record the data. Repeat the recording 3-5 times.
[0044] (10) After completion, replace with another blade, press F4 (Add remark), add a number, and repeat steps 7-10 to perform the measurement. Perform a Match matching once for each blade.
[0045] (11) After all data measurements are completed, press F3 (Close file) to save the data file. Put the machine into sleep mode, then pack up the instrument and move it back to the laboratory.
[0046] (12) Connect the machine to the computer via a data cable and open the LI-6400XTerm software that has been installed on the computer. Press any key to wake up the machine, then press F5 (Utility Menu), select "fileexchange mode" under communication, and click connect on the computer to import the data from the machine into the computer software. After completion, disconnect the connection (if you have a card reader, directly remove the data card and store it on the computer).
[0047] (13) Turn off the power and remove the power supply to charge the device for the next experiment. At the same time, turn the knobs of the two chemical tubes to the middle loose position; rotate the leaf chamber fixing screw to keep the leaf chamber in the open position.
[0048] The results are as follows Figure 1 As shown, the results indicate that with increasing light intensity, the net photosynthetic rate of CIPK9-OX is significantly or extremely significantly higher than that of WT, while the net photosynthetic rate of cipk9-cri is extremely significantly lower than that of WT, especially in the range of 1200–2000 μmol / m³. -2 s -1 Under high light intensity, the net photosynthetic rate of CIPK9-OX-1-5 material is significantly higher than that of WT material, in the range of 1200~2000 μmol / m². -2 s -1 Under certain light intensities, the net photosynthetic rate of CIPK9-OX-3-4 material was significantly or extremely significantly higher than that of WT material. In the range of 200–2000 μmol / m² light intensity... -2 s -1 Under the specified light intensity, the net photosynthetic rate of the cipk9-cri-2-3 material was significantly lower than that of the WT material. This result indicates that this gene plays an important role in positively regulating the photosynthetic rate of rice leaves, and that overexpression of this gene can significantly enhance the photosynthetic rate of rice.
[0049] Example 3: Starch content of sword leaves in CIPK9 transgenic material This embodiment measured the starch content of the flag leaf of CIPK9 transgenic rice. The specific steps are as follows: (1) Weigh 0.02 g of sample, add 1 ml of 80% ethanol to a 2 ml centrifuge tube, and mix well. Incubate in an 80 ℃ water bath for 30 min, centrifuge at 10000 rpm for 10 min, pour the supernatant into a 5 ml volumetric flask, add 1 ml of 80% ethanol, mix well, centrifuge at 10000 rpm for 10 min, pour the supernatant, and repeat the extraction three times. Dilute to the mark with 80% ethanol.
[0050] (2) Add 400 μl of distilled water to the precipitate, stir well, place in an 80℃ water bath for 30 min to evaporate the residual ethanol, then place in a boiling water bath to gelatinize for 15 min, cool, place the centrifuge tube in an ice water bath, add 400 μl of cold 9.2 mol / L perchloric acid, stir occasionally, extract for 15 min, add 800 μl of distilled water, mix well, centrifuge at 10000 rpm for 10 min, pour the supernatant into a 5 ml volumetric flask, add 400 μl of 4.6 mol / L perchloric acid to the precipitate, stir to extract for 15 min, add 1.2 ml of distilled water, mix well, centrifuge at 10000 rpm for 10 min, collect the supernatant into a volumetric flask, then wash the precipitate 1-2 times with water, centrifuge at 12000 rpm for 1 min, combine the centrifuged liquids into a 5 ml volumetric flask and dilute to volume with distilled water.
[0051] (3) Pipette 0.2 ml of the sample extract into a 10 ml test tube and add 0.8 ml of distilled water. Add 0.25 ml of anthrone ethyl acetate reagent and 2.5 ml of concentrated sulfuric acid to the test tube in sequence, shake thoroughly, and immediately place the test tube in a boiling water bath. Keep each tube at a constant temperature for 1 min. After removing the tube, allow it to cool naturally to room temperature. Using a blank as a reference, measure the absorbance at a wavelength of 620 nm. Determine the sugar content (mt) in the extract based on the standard curve.
[0052] (4) Calculate the starch content Q according to the formula. starch = m t *0.9 / 0.2*5 / 106 / 0.02*100% =0.001125 m t *100% Test results as follows Figure 2As shown, the starch content of the flag leaves of WT plants was 79.25±3.82 g / mg, the starch content of CIPK9-OX-1-5 material was 96.4±15.94 g / mg, the starch content of CIPK9-OX-3-4 material was 85.17±3.23 g / mg, while the starch content of cipk9-cri-2 material was 71.71±3.80 g / mg, and the starch content of cipk9-cri-6 material was 75.63±4.19 g / mg. This comparison shows that the starch content of the flag leaves of CIPK9-OX-1-5 material increased by 21.64% compared to WT plants, the starch content of the flag leaves of CIPK9-OX-3-4 material increased by 7.47% compared to WT plants, the starch content of the flag leaves of cipk9-cri-2 material decreased by 9.51% compared to WT plants, and the starch content of the flag leaves of cipk9-cri-6 material decreased by 4.57% compared to WT plants. The above results indicate that CIPK9 has a positive regulatory effect on starch accumulation in rice.
[0053] In summary, this invention has revealed that the rice CIPK9 gene plays an important role in regulating the photosynthetic rate and starch accumulation in rice. Overexpression of this gene can significantly enhance the photosynthesis and starch content of rice. This study reveals the key regulatory mechanism of rice photosynthesis and starch accumulation at the molecular level, providing new targets and important theoretical basis for breeding high-efficiency rice.
[0054] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
Claims
1. The application of the CIPK9 gene in any of the following A1)-A4): A1) Regulate the photosynthetic rate and / or starch content of rice; A2) Prepare products that regulate the photosynthetic rate and / or starch content of rice; A3) Cultivate rice germplasm with high photosynthetic rate and / or high starch content; A4) Prepare and cultivate rice germplasm products with high photosynthetic rate and / or high starch content; The amino acid sequence encoded by the CIPK9 gene is shown in SEQ ID NO:
3.
2. The application according to claim 1, characterized in that, The nucleotide sequence of the CIPK9 gene is shown in SEQ ID NO:1, and the CDS sequence is shown in SEQ ID NO:
2.
3. The application according to claim 1, characterized in that, The regulation mentioned is a positive regulation.
4. The application according to claim 1, characterized in that, By promoting the expression of the CIPK9 gene or enhancing the function or activity of its protein, the photosynthetic rate and / or starch content of rice can be increased.
5. The application according to claim 1, characterized in that, The rice germplasm exhibits all or some of the following: B1) Increased photosynthetic rate; B2) Increased starch content in leaves.
6. Application of overexpression vectors containing the CIPK9 gene in any of the following A1)-A4): A1) Regulate the photosynthetic rate and / or starch content of rice; A2) Prepare products that regulate the photosynthetic rate and / or starch content of rice; A3) Cultivate rice germplasm with high photosynthetic rate and / or high starch content; A4) Prepare and cultivate rice germplasm products with high photosynthetic rate and / or high starch content; The amino acid sequence encoded by the CIPK9 gene is shown in SEQ ID NO:
3.
7. A method for enhancing the photosynthetic rate and / or starch content of rice, characterized in that, By promoting the expression of the CIPK9 gene in rice or enhancing the function or activity of its protein, the photosynthetic rate and / or starch content of rice can be increased, wherein the amino acid sequence encoded by the CIPK9 gene is shown in SEQ ID NO:
3.
8. The method according to claim 7, characterized in that, Methods to promote CIPK9 gene expression in rice include: S1. Construct a CIPK9 gene overexpression vector; S2. The recombinant vector from step S1 was introduced into rice callus tissue via Agrobacterium-mediated transformation, and transgenic rice plants were obtained after cultivation. S3. Positive transgenic rice plants were obtained through screening.
9. A method for cultivating rice with high photosynthetic rate and / or high starch content, characterized in that, Transgenic rice was obtained by introducing an expression cassette, expression vector, and recombinant microorganism overexpressing the CIPK9 gene into rice callus tissue, wherein the amino acid sequence encoded by the CIPK9 gene is shown in SEQ ID NO:
3.
10. The method according to claim 9, characterized in that, The genetically modified rice exhibits all or some of the following characteristics: B1) Increased photosynthetic rate; B2) Increased starch content in leaves.