Lap3a, Lap3b and Lap3c genes of bactrocera cucurbitae and application of Lap3a, Lap3b and Lap3c genes

Abstract

The invention discloses Lap3a, Lap3b and Lap3c genes of bactrocera cucurbitae and an application of the Lap3a, Lap3b and Lap3c genes. The space-time and tissue expression profiles of the Lap3a, Lap3b and Lap3c genes of the bactrocera cucurbitae show that the three genes are specifically and highly expressed in testis of male bactrocera cucurbitae, especially in transformation regions in testis tissues of adult bactrocera cucurbitae. The Lap3a, Lap3b and Lap3c genes play important functions in the process of participating in maintaining the male reproduction of the bactrocera cucurbitae, when the Lap3a, Lap3b or Lap3c genes of male bactrocera cucurbitae are inhibited, the number of male sperms of the bactrocera cucurbitae is reduced, the reproductive power of the male bactrocera cucurbitae is reduced, the treated male bactrocera cucurbitae is mated with normal female bactrocera cucurbitae, and the egg laying amount and egg hatching rate of the female bactrocera cucurbitae are reduced. The three genes are expected to become SIT potential targets to be applied to pest control, and a new thought is provided for green control of bactrocera cucurbitae.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to the Lap3a, Lap3b and Lap3c genes of the melon fly and their applications. Background Technology

[0002] melon fly Zeugodacus cucurbitae Coquillett is a significant agricultural pest with a global distribution, widely occurring in tropical, subtropical, and some temperate regions. This pest has a wide host range, damaging nearly 130 species of fruit and vegetable crops, including those in the Cucurbitaceae, Solanaceae, and Leguminosae families, posing a particularly serious threat to the yield and quality of cash crops such as watermelon, cucumber, and pumpkin. Due to its high reproductive capacity, short generation cycle, and rapid migration and dispersal, coupled with the fact that the larvae feed inside the fruit, conventional chemical control methods are difficult to effectively reach, resulting in poor control outcomes. Long-term reliance on chemical pesticides not only easily induces pesticide resistance in the melon fly but also negatively impacts the ecological environment and non-target organisms, hindering sustainable agricultural development. Therefore, exploring environmentally friendly and highly specific green control technologies has become an urgent need for the integrated management of the melon fly. In recent years, pest control strategies based on molecular biology methods, such as insect sterilization technology (SIT) and RNA interference (RNAi) technology, have shown promising application prospects, providing new research directions for the sustainable management of the melon fly. Summary of the Invention

[0003] In view of the above-mentioned shortcomings of the prior art, the purpose of this invention is to provide the Lap3a, Lap3b and Lap3c genes of the melon fly and their applications, so as to provide a new option for the green control of the melon fly.

[0004] This invention provides the application of the Lap3a, Lap3b, and Lap3c genes of *F. melongrassus* in regulating sperm development and reducing the fertility of male *F. melongrassus*. The nucleotide sequence of the Lap3a gene is shown in SEQ ID No. 1, the nucleotide sequence of the Lap3b gene is shown in SEQ ID No. 2, and the nucleotide sequence of the Lap3c gene is shown in SEQ ID No. 3.

[0005] Preferably, the application of reducing the expression levels of the Lap3a, Lap3b, and Lap3c genes of the melon fly in reducing the sperm count of male melon fly, increasing sperm mortality, and reducing the number of eggs laid by females mating with males and lowering the egg hatching rate.

[0006] The present invention also provides the application of proteins encoded by the Lap3a, Lap3b, and Lap3c genes of *F. melongrass* in regulating sperm development and reducing male fertility in *F. melongrass*; the nucleotide sequence of the *F. melongrass* Lap3a gene is shown in SEQ ID No. 1, the nucleotide sequence of the *F. melongrass* Lap3b gene is shown in SEQ ID No. 2, and the nucleotide sequence of the *F. melongrass* Lap3c gene is shown in SEQ ID No. 3.

[0007] The present invention also provides the application of the Lap3a gene, Lap3b gene, and Lap3c gene of *F. melongrassus* in the control of *F. melongrassus*; the nucleotide sequence of the Lap3a gene is shown in SEQ ID No. 1, the nucleotide sequence of the Lap3b gene is shown in SEQ ID No. 2, and the nucleotide sequence of the Lap3c gene is shown in SEQ ID No. 3.

[0008] The present invention also provides a method for controlling the melon fly, comprising the following steps: delivering dsRNA of at least one of the melon fly Lap3a gene, melon fly Lap3b gene and melon fly Lap3c gene into the melon fly; the nucleotide sequence of the melon fly Lap3a gene is shown in SEQ ID No. 1, the nucleotide sequence of the melon fly Lap3b gene is shown in SEQ ID No. 2, and the nucleotide sequence of the melon fly Lap3c gene is shown in SEQ ID No. 3.

[0009] Preferably, the primers for amplifying the dsRNA of the Lap3a gene in *F. melongrassus* are shown in SEQ ID No. 16 and SEQ ID No. 17, the primers for amplifying the dsRNA of the Lap3b gene in *F. melongrassus* are shown in SEQ ID No. 18 and SEQ ID No. 19, and the primers for amplifying the dsRNA of the Lap3c gene in *F. melongrassus* are shown in SEQ ID No. 20 and SEQ ID No. 21.

[0010] Preferably, the dsRNA of at least one of the Lap3a, Lap3b, and Lap3c genes of the melon fly is delivered into the male melon fly.

[0011] The beneficial effects of this invention are: The spatiotemporal and tissue expression profiles of the Lap3a, Lap3b, and Lap3c genes in the melon fly (Fly) of this invention show that these three genes are specifically highly expressed in the testes of male melon flies, particularly in the transformation zone of the testes of adult melon flies. The signals are enriched in mature sperm cells, where sperm cells undergo morphological differentiation, transforming into tailed sperm, thus participating in the regulation of sperm cell morphological differentiation. The Lap3a, Lap3b, and Lap3c genes play important roles in maintaining male reproduction in the melon fly. Inhibition of the Lap3a, Lap3b, or Lap3c genes in male melon flies reduces the number of sperm cells, decreasing male fertility. Furthermore, mating treated males with normal females reduces the number of eggs laid and the hatching rate. These three genes hold promise as potential targets for SIT (Sperm Injection Technology) applications in pest control, providing new ideas for the green control of melon flies. Attached Figure Description

[0012] Figure 1 The relative expression levels of Lap3a (A), Lap3b (B), and Lap3c (C) in the melon fly at different developmental stages of males and females; Egg: egg; L1-7: 1-7 day old larvae; P1-9: 1-9 day old pupae; F1-9: 1-9 day old female adults; M1-9: 1-9 day old male adults; The bar chart represents the mean ± standard error (SE) of gene expression levels, and different letters on the bars indicate significant differences (P<0.05, one-way ANOVA, LSD).

[0013] Figure 2 The relative expression levels of Lap3a (A), Lap3b (B), and Lap3c (C) in different tissues of male and female melon flies are shown. F-MT, F-MG, F-FB, and OV represent the Malpighian tubule, midgut, fat body, and ovary of female melon flies, respectively. M-MT, M-MG, M-FB, and TE represent the Malpighian tubule, midgut, fat body, and testis of male melon flies, respectively. The bar chart represents the mean ± standard error (SE) of gene expression levels. The error bar is the standard error of the mean of three biological replicates. Different letters on the bars in the chart indicate significant differences (P < 0.05, one-way ANOVA, LSD).

[0014] Figure 3The study involved dsRNA delivery via injection, followed by Lap3a, Lap3b, and Lap3c gene efficiency assays at 24 and 48 h. The bar chart represents the mean ± standard error (SE) of gene expression levels. ns indicates no significant difference, and asterisks indicate significant differences (*P<0.05; **P<0.01; ***P<0.001; ****P<0.0001).

[0015] Figure 4 The relative expression levels of Lap3a, Lap3b, and Lap3c subfamily genes were measured 24 h after dsRNA delivery via individual injection. The bar chart represents the mean ± standard error (SE) of gene expression levels. ns indicates no significant difference, and asterisks indicate significant differences (*P<0.05; **P<0.01; ***P<0.001; ****P<0.0001).

[0016] Figure 5 The study involved dsRNA delivery via injection. Starting on day 3, dsRNA was continuously injected every two days, followed by Lap3a, Lap3b, and Lap3c gene efficiency assays. Interference efficiency was assessed every 48 hours. The bar chart represents the mean ± standard error (SE) of gene expression levels. ns indicates no significant difference, and asterisks indicate significant differences (*P<0.05; **P<0.01; ***P<0.001; ****P<0.0001).

[0017] Figure 6 The results show the determination of testis morphology and area in melon flies after RNAi. The bar chart represents the mean ± standard error (SE) of testis area, and ns indicates no significant difference.

[0018] Figure 7 This is a statistical analysis of sperm motility and number in the testes of *Fagopyrum esculentum* after RNAi. In A, green represents normally motile sperm, and red represents dead sperm. In B, the bar chart represents the mean ± standard error (SE) of sperm count in the testes. ns indicates no significant difference, and an asterisk indicates a significant difference (***P<0.001). In C, the bar chart represents the mean ± standard error (SE) of sperm mortality in the testes. Different letters on the bars in the chart indicate significant differences (P<0.05, one-way ANOVA, LSD).

[0019] Figure 8The effects of interfering with the Lap3a, Lap3b, and Lap3c genes on egg production and hatching rate in the melon fly are shown in bar graph A. Bar graph A represents the average ± standard error (SE) of total egg production over three days, with different letters on the bars indicating significant differences (P<0.05, one-way ANOVA, LSD). Bar graph B represents the average ± standard error (SE) of egg hatching rate over three days, with different letters on the bars indicating significant differences (P<0.05, one-way ANOVA, LSD). Detailed Implementation

[0020] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0021] Example 1: Obtaining the open reading frame of the Lap gene in the melon fly Full-length cloning PCR-specific primers were designed using the NCBI Primer BLAST online website (http: / / www.ncbi.nlm.nih.gov / tools / primer-blast). The upstream and downstream primer sequences are shown in Table 1.

[0022] Table 1 Primer pairs used for cloning, qRT-PCR, and dsRNA synthesis The PCR amplification conditions were as follows: pre-denaturation: 95℃ for 3 min; followed by denaturation at 95℃ for 15 s, annealing at 57℃ for 15 s, extension at 72℃ for 2 min, for 35 cycles; and a final extension at 72℃ for 5 min. The 25 μL reaction mixture contained 8.5 μL nuclease-free water, 12.5 μL 2×Phanta Max buffer (Vazyme, China), 0.5 μL dNTP Mix, 0.5 μL Phanta Max Super-Fidelity DNA Polymerase, 1 μL each of forward and reverse primers (10 μM), and 1 μL of adult melon fly testis cDNA as template.

[0023] PCR amplification products were detected by 1% agarose gel electrophoresis, and the target band was recovered. Then, the product was ligated into pESI-Blunt vector (specific procedures are described in Yeasen's TOPO-Blunt blunt-end cloning kit). 5 μL of the ligation product was added to 50 μL of DH5α competent cells, mixed, and incubated on ice for 30 min. The mixture was then heat-shocked at 42°C for 90 s, followed by 1 min on ice. 500 μL of LB liquid medium was added to the reaction system, and the mixture was incubated at 37°C with shaking at 200 rpm for 1 h. 50 μL of the activated bacterial culture was evenly spread onto LB agar plates containing ampicillin, and incubated overnight at 37°C. White, circular colonies were picked and incubated at 37°C with shaking for 4 h. 2 μL of the colony was used as a template for PCR verification. Positive monoclonal colonies were sent to Shangya Biotechnology for sequencing. The sequencing results were verified by alignment with the original sequence using SnapGene software. The open reading frame sequence of *F. melongrassus* Lap3a was obtained, with its nucleotide sequence shown in SEQ ID No. 1 and the amino acid sequence of the encoded protein shown in SEQ ID No. 24; the open reading frame sequence of *F. melongrassus* Lap3b was obtained, with its nucleotide sequence shown in SEQ ID No. 2 and the amino acid sequence of the encoded protein shown in SEQ ID No. 25; the open reading frame sequence of *F. melongrassus* Lap3c was obtained, with its nucleotide sequence shown in SEQ ID No. 3 and the amino acid sequence of the encoded protein shown in SEQ ID No. 26.

[0024] Example 2: Expression profiles of different developmental stages and tissues of Lap in the melon fly The relative expression levels of Lap3a, Lap3b, and Lap3c genes in different developmental stages of *F. melonfield*, including eggs, larvae (1, 3, and 7 days), pupae (1, 5, and 9 days old), and male and female insects (1, 5, and 9 days old), as well as in the tissues of adult male and female insects, including the fat body, midgut, Malpighian tubules, ovary, and testis. The qRT-PCR specific primer sequences are shown in Table 1, with Rpl13 used as an internal reference gene to assess the expression of Lap3a, Lap3b, and Lap3c genes at different developmental stages and in different tissues.

[0025] exist Figure 1 It can be seen that the expression peaks of the Lap3a, Lap3b, and Lap3c genes in the melon fly occur during the pupal stage and the male adult stage, but are not expressed in the female adult. Figure 2 It can be seen that the Lap3a, Lap3b and Lap3c genes of the melon fly are highly expressed in the testes of adult flies, but are not expressed in other tissues.

[0026] Example 3 1. Preparation of dsRNA from Lap3a, Lap3b, and Lap3c genes in *Fluidobacterium melonii* Based on the open reading frame sequences of the Lap3a, Lap3b and Lap3c genes mentioned above, dsRNA primers were designed using the SnapDragon-dsRNA Design online website (https: / / www.flyrnai.org / cgi-bin / RNAi_find_primers.pl), and a T7 promoter sequence (TAATACGACTCACTATAGGG) was added to the 5' end of the primer sequence. The sequence information is shown in Table 1.

[0027] Using cDNA from the testes of 5-day-old *F. melonlea* as a template, partial sequences of the Lap3a, Lap3b, and Lap3c genes were amplified by conventional PCR using gene dsRNA-specific primers. Positive clones were sent to Shangya Biotechnology for sequencing. After successful sequencing, PCR amplification was performed using their respective bacterial cultures as templates with dsRNA primers, following the same reaction system and conditions as for full-length clones. The PCR products were recovered and purified. Using a higher concentration of the PCR product as a template, dsRNA was synthesized and purified according to the instructions of the T7 RiboMAX™ Express RNAi System (Promega, USA). The purity and integrity of the dsRNA were then detected by 1.2% agarose gel electrophoresis, and its concentration was measured at 260 nm using a UV spectrophotometer (Thermo, USA). The final concentration was set at 2000 ng / μL and then stored at -80℃ for later use.

[0028] 2. Experiments to inhibit male reproductive capacity in the melon fly by injecting dsLap3a, dsLap3b, and dsLap3c synthesized from Lap3a, Lap3b, and Lap3c gene fragments, respectively. (1) Injection of Lap gene fragments to synthesize dsLap3a, dsLap3b and dsLap3c Collect adult melon flies that emerged on the same day and raise them normally until the second day. Then, separate the male and female adults for single-sex rearing. Starting from the fifth day, inject each male with 2 μg of dsRNA every other day until the eleventh day.

[0029] (2) Detection of Lap gene silencing efficiency Five male adult melon flies were collected on day 9 after a single injection. Total RNA was extracted using the SteadyPure RNA extraction kit, and cDNA was obtained by reverse transcription using the Evo M-mLV reverse transcription kit. cDNA was then used as a template for qRT-PCR to detect the relative expression levels of Lap3a, Lap3b, and Lap3c genes. Rpl13 was used as the internal reference gene. qRT-PCR was performed using the primers and methods described in Table 1 above, and the silencing efficiency of the target genes was calculated.

[0030] Figure 3 The results showed that 24 h after a single dsRNA injection, compared with the control group, the expression levels of Lap3a, Lap3b, and Lap3c were significantly downregulated by 75%, 63%, and 48%, respectively. 48 h after a single dsRNA injection, compared with the control group, the expression levels of Lap3a, Lap3b, and Lap3c were significantly downregulated by 49%, 60%, and 90%, respectively, indicating that injection can effectively silence the expression of target genes. Although these three gene families share some homology, individual injection of any one of them did not affect the expression of the other two genes. Figure 4 To ensure the interference continued to affect the melon fly mating and egg-laying process, each male was injected every other day starting from day 5, continuing until day 11. The relative expression level of the target gene was then detected using the same method described above. Figure 5 The results showed that after continuous injection of dsRNA up to day 11, the expression levels of Lap3a, Lap3b and Lap3c decreased significantly (P=0.0003, P=0.0207, P=0.0009) and remained at low levels.

[0031] (3) Changes in male reproductive capacity of the melon fly were observed by measuring changes in sperm count, egg production, and egg hatching rate. To evaluate the effect of continuous dsRNA injection on the male reproductive capacity of *Flycoperdon perlatum*, testes of 9-day-old adults were isolated and sperm motility was assessed. The specific experimental procedures were as follows: First, adults were dissected in pre-cooled HEPES buffer (pH 7.4) at 4°C to maintain tissue integrity. Under a microscope, bilateral testes were removed using dissecting forceps. The removed testes were transferred to a 10 μL droplet of HEPES buffer pre-placed in the center of an adhesive slide, and the testicular membrane was gently torn open with forceps to fully release the cells and sperm populations into the buffer. After complete sperm diffusion, a coverslip was gently placed over the slide, and the edges were sealed with clear nail polish to prevent sample movement or buffer evaporation during staining and observation. Subsequently, the slide was placed in a 37°C incubator, staining solution was added, and incubation was performed for 10 minutes to distinguish between live and dead sperm. After incubation, images of live (fluorescent green) and dead (fluorescent red) signals were acquired using a laser confocal microscope under 488 nm and 561 nm laser channels, respectively. Live and dead sperm were counted in the field of view. The entire experiment was repeated three times to ensure data reproducibility and reliability.

[0032] To evaluate the effects of consecutive injections of dsLap3a, dsLap3b, and dsLap3c on male reproductive capacity and offspring development in the melon fly, males in the treatment group were continuously injected with dsEGFP (1 μL / head, intraperitoneal injection every other day, for 9 days) starting on the 3rd day after adult emergence. The control group was injected with the same amount of dsEGFP simultaneously. After the injection, 5 treated males and 10 untreated 9-day-old females (1:2) were placed in a 10 cm³ rearing cage as one group, with a total of 24 replicates. Pairing behavior was observed nightly to confirm mating between males and females, with successful mating defined as contact lasting ≥30 seconds. Cucumber slices, approximately 2 mm thick, were stacked in pairs as an oviposition substrate. The cucumber slices were placed in the rearing cage at 8 PM each night and removed at 10 AM the following day. The cucumber slices were then placed in 50 mL of sterile distilled water and gently shaken for 2 minutes to detach the eggs. The detached eggs were collected and counted in a petri dish. After counting, the eggs were transferred to an artificial climate chamber (27 ± 1°C, RH 70 ± 5%, photoperiod L14:D10) for incubation. The number of first-instar larvae was recorded after 24 hours, and the hatching rate was calculated. The total number of eggs laid and the hatching rate over three consecutive days were statistically analyzed.

[0033] Figure 6 The results showed no significant difference in testis size among male insects treated with dsLap3a, dsLap3b, and dsLap3c. Figure 7The results showed that the number of sperm in male insects treated with dsLap3a, dsLap3b and dsLap3c was reduced by 95%, 70% and 74% respectively compared with the control group; the sperm mortality rates were 23%, 37% and 80% respectively (P=0.1268, P=0.0173, P=0.0005). Figure 8 The study showed that after male insects were injected with dsRNA for 9 consecutive days, they mated with normally fed female insects for 3 consecutive days, and the results showed that the number of eggs laid and the hatching rate of eggs in the target gene dsRNA (dsLap3a, dsLap3b, dsLap3c) feeding group were significantly lower than those in the control group (dsEGFP).

Claims

1. The application of the Lap3a, Lap3b, and Lap3c genes of *F. melongrassus* in regulating sperm development and reducing male fertility in *F. melongrassus*; the nucleotide sequence of the Lap3a gene is shown in SEQ ID No. 1, the nucleotide sequence of the Lap3b gene is shown in SEQ ID No. 2, and the nucleotide sequence of the Lap3c gene is shown in SEQ ID No.

3.

2. The application according to claim 1, characterized in that, To investigate the application of reducing the expression levels of the Lap3a, Lap3b, and Lap3c genes in *F. melongrassus* in reducing sperm count in male *F. melongrassus*, increasing sperm mortality, and reducing egg production and hatching rate in females mating with males.

3. The application of proteins encoded by the Lap3a, Lap3b, and Lap3c genes of *F. melongrassus* in regulating sperm development and reducing male fertility in *F. melongrassus*; the nucleotide sequence of the Lap3a gene is shown in SEQ ID No. 1, the nucleotide sequence of the Lap3b gene is shown in SEQ ID No. 2, and the nucleotide sequence of the Lap3c gene is shown in SEQ ID No.

3.

4. Application of the Lap3a, Lap3b, and Lap3c genes of *F. melongrassus* in the control of *F. melongrassus*; the nucleotide sequence of the Lap3a gene is shown in SEQ ID No. 1, the nucleotide sequence of the Lap3b gene is shown in SEQ ID No. 2, and the nucleotide sequence of the Lap3c gene is shown in SEQ ID No.

3.

5. A method for controlling melon fruit flies, characterized in that, The method includes the following steps: delivering dsRNA of at least one of the Lap3a, Lap3b, and Lap3c genes of *F. melongrass* into *F. melongrass*; the nucleotide sequence of the Lap3a gene is shown in SEQ ID No. 1, the nucleotide sequence of the Lap3b gene is shown in SEQ ID No. 2, and the nucleotide sequence of the Lap3c gene is shown in SEQ ID No.

3.

6. The method according to claim 5, characterized in that, The primers for amplifying the dsRNA of the Lap3a gene in *Flycoperdon edulis* are shown in SEQ ID No. 16 and SEQ ID No. 17, the primers for amplifying the dsRNA of the Lap3b gene in *Flycoperdon edulis* are shown in SEQ ID No. 18 and SEQ ID No. 19, and the primers for amplifying the dsRNA of the Lap3c gene in *Flycoperdon edulis* are shown in SEQ ID No. 20 and SEQ ID No.

21.

7. The method according to claim 5, characterized in that, The dsRNA of at least one of the Lap3a, Lap3b and Lap3c genes of the melon fly was delivered into a male melon fly.

Images