Rapid detection primer group, rapid detection method and kit for pomacea canaliculata and application of rapid detection primer group and rapid detection method for pomacea canaliculata

Abstract

The invention discloses a spot ampullaria gigas rapid detection primer group, a rapid detection method, a kit and application, and belongs to the technical field of spot ampullaria gigas quarantine and identification. The invention solves the problems that the PCR amplification technology in the prior art for identifying spot ampullaria gigas has the defects of long time consumption, expensive equipment and the like, and cannot meet the requirement of quick and convenient detection in scenes such as ports and the like. The invention relates to a primer composition for quickly detecting MIRA. The primer composition comprises an upstream primer, a downstream primer, an upstream primer, a downstream primer and a downstream primer, wherein the upstream primer is 5 '-ATAGATCTACAGTCTATCGCTTAAACACAGC-3'; the downstream primer is 5 '-TGATTCCTAAGGAAGACTATTCTTCTAG-3', and the downstream primer is 5 '-TGATTCCTAAGGAAGACTATTCTTCTAG-3'. The primer provided by the invention can realize rapid MIRA detection of the spot ampullaria gigas, the shortest detection time can be shortened to 4 minutes, the amplification temperature is 37-42 DEG C, the primer has excellent specificity and low minimum detection limit, detection of the spot ampullaria gigas can be realized through a water sample of biological life, and the quarantine and identification efficiency and effect of the spot ampullaria gigas are greatly improved.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of quarantine identification of apple snails, and particularly relates to a rapid detection primer set for apple snails, a rapid detection method, a kit and application. BACKGROUND

[0002] Pomacea canaliculata is an alien invasive species originally from South America, which was listed in the first batch of alien invasive species list after being introduced into China in 1981. It has strong reproductive capacity (20-40 times of egg production per year for a single female snail, and an egg hatching rate of over 90%) and survival adaptability (tolerance to water temperature of 0-45℃), mainly destroys the ecological chain by eating aquatic plants (such as rice, water caltrop, etc.), and can cause crop failure in severe cases. The parasites carried by the apple snail can also cause human meningitis and other diseases, threatening public health safety. Quarantine identification of apple snails is crucial, not only a legal requirement of the Biological Safety Law and the Management Measures for Alien Invasive Species, but also a key link to block its spread. The Quarantine Identification Method for Apple Snails (GB / T 44619-2024) implemented in April 2025 clearly specifies the technical specifications for adult snail morphological detection and molecular biology identification (such as COI gene sequence), providing a unified standard for port quarantine and field monitoring.

[0003] The existing technology generally uses PCR amplification technology for quarantine identification of apple snails, such as: CN108588243A - specific primer for rapid identification of alien organism apple snail, multiplex PCR detection kit and its detection method, CN120442820A - probe primer combination for TaqMan real-time fluorescent quantitative PCR for identifying apple snails, kit and application…… Although PCR amplification technology realizes the quarantine identification of apple snails, it has the disadvantages of long time consumption and expensive equipment, which cannot meet the needs of rapid and convenient detection in port and other scenes. SUMMARY

[0004] In view of the problems in the prior art that the PCR amplification technology for identifying apple snails has the disadvantages of long time consumption and expensive equipment, and cannot meet the needs of rapid and convenient detection in port and other scenes, the application provides a rapid detection primer set for apple snails, a rapid detection method, a kit and application.

[0005] The technical scheme adopted by the application is as follows:

[0006] A rapid detection primer set for apple snails is a MIRA rapid detection primer combination composition, which comprises:

[0007] The upstream primer is 5'-ATAGATCTACAGTCTATCGCTTAAAACTCAGC-3';

[0008] Downstream primer: 5'-TGATTCCTTAAGGAAGACTATTTCTTCTAG-3'.

[0009] As preferred, the fluorescent probe is also included:

[0010] 5'-ATATGACAATACCCCTTAAAGATTTCTTA[FAMdT]C[THF][BHQ1dT]AGAATTTGCAATTCTA-[3' C3 spacer].

[0011] A quick detection method of apple snails, comprising the following steps:

[0012] S1: adding a DNA sample to be detected into a MIRA amplification system, wherein the MIRA amplification system comprises the quick detection primer set of apple snails;

[0013] S2: amplifying for at least 4 minutes at 37-42 DEG C to obtain an amplification product, and judging whether the amplification product is an apple snail according to the amplification product.

[0014] As preferred, the DNA sample to be detected is from a biological tissue or a water sample in which organisms live.

[0015] As preferred, the amplification temperature is 40 DEG C or 42 DEG C.

[0016] As preferred, the amplification product obtained in S2 is judged whether it is an apple snail by a gel electrophoresis method, a fluorescence method or a colloidal gold method.

[0017] A kit based on the quick detection primer set of apple snails or the quick detection method of apple snails to realize detection.

[0018] The application of the quick detection primer set of apple snails in identifying apple snails.

[0019] As described above, since the above technical solutions are adopted, the beneficial effects of the application are:

[0020] The application provides a primer set, a quick detection method, a kit and an application for realizing quick detection of apple snails. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 Gel electrophoresis result of the primary screening of the primer for the basic method;

[0022] Figure 2 Gel electrophoresis result of the secondary screening of the primer for the basic method;

[0023] Figure 3 Gel electrophoresis result of the secondary screening of the primer for the basic method and the result of the alignment with sequencing;

[0024] Figure 4 Gel electrophoresis result of the temperature screening for the basic method;

[0025] Figure 5 Gel electrophoresis result of the specificity detection for the basic method;

[0026] Figure 6 Gel electrophoresis result of the minimum limit detection in terms of DNA concentration for the basic method;

[0027] Figure 7 Gel electrophoresis result of the minimum limit detection in terms of plasmid concentration for the basic method;

[0028] Figure 8 Fluorescence graph for the primer screening for the fluorescence method;

[0029] Figure 9 Orthogonal amplification graph of 1F2R, 1F1R, and 1F3R in the primer screening for the fluorescence method;

[0030] Figure 10 Reverse cross amplification graph of 2F2R, 2F1R, and 3F2R in the primer screening for the fluorescence method;

[0031] Figure 11 Amplification graph for the temperature gradient screening for the fluorescence method, in which N: Negative, and P: Pomacea maculata, experimental sample;

[0032] Figure 12 Fluorescence graph for the temperature gradient screening for the fluorescence method, in which N: Negative, and P: Pomacea maculata, experimental sample;

[0033] Figure 13 Fluorescence graph for the cycle time screening for the fluorescence method, in which N: Negative;

[0034] Figure 14For the specific detection of amplification map by fluorescence method, the positive sample PC-yang (DNA concentration 68.28 ng / μL), the spot apple snail tissue sample PC-60 (DNA concentration 68.28 ng / μL), the capsule snail tissue sample PC-nang (DNA concentration 70.47 ng / µL), the small tube apple snail tissue sample PC-xiao (DNA concentration 86.33 ng / µL), the river snail tissue sample PC-tian (DNA concentration 76.14 ng / µL), the stone snail tissue sample PC-shi (DNA concentration 68.41 ng / µL), the hidden apple snail tissue sample PC-ying (DNA concentration 70.13 ng / µL), the first water sample sample PC-shui-1 (PC-shui1) (all DNA concentration in water sample 29.3 ng / µL), the second water sample sample PC-shui-2 (PC-shui2) (all DNA concentration in water sample 16.1 ng / µL), the third water sample sample PC-shui-3 (PC-shui3) (all DNA concentration in water sample 8.5 ng / µL), the fourth water sample sample PC-shui-4 (PC-shui4) (all DNA concentration in water sample 4.7 ng / µL), the negative sample Negative (ddH2O);

[0035] Figure 15 For the specific detection of fluorescence map by fluorescence method, the positive sample PC-yang (DNA concentration 68.28 ng / μL), the spot apple snail tissue sample PC-60 (DNA concentration 68.28 ng / μL), the capsule snail tissue sample PC-nang (DNA concentration 70.47 ng / µL), the small tube apple snail tissue sample PC-xiao (DNA concentration 86.33 ng / µL), the river snail tissue sample PC-tian (DNA concentration 76.14 ng / µL), the stone snail tissue sample PC-shi (DNA concentration 68.41 ng / µL), the hidden apple snail tissue sample PC-ying (DNA concentration 70.13 ng / µL), the first water sample sample PC-shui-1 (PC-shui1) (all DNA concentration in water sample 29.3 ng / µL), the second water sample sample PC-shui-2 (PC-shui2) (all DNA concentration in water sample 16.1 ng / µL), the third water sample sample PC-shui-3 (PC-shui3) (all DNA concentration in water sample 8.5 ng / µL), the fourth water sample sample PC-shui-4 (PC-shui4) (all DNA concentration in water sample 4.7 ng / µL), the negative sample Negative (ddH2O);

[0036] Figure 16Figure 2 shows the results of the fluorescent method for detecting the minimum limit of plasmid concentration. DETAILED DESCRIPTION

[0037] In order to make the purposes, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments of the present application.

[0038] It should be noted that the samples in this embodiment are derived from Pomacea maculata provided by Sichuan Agricultural University. DNA samples are extracted by the kit: Universal genomic DNA Kit (Universal Whole Blood / Tissue / Cell / Bacterial DNA Fast Extraction Kit; Aideley Biological) to extract DNA. Note: DNA samples are stored in a -20°C refrigerator.

[0039] I. Basic method

[0040] (I) Screening of primer composition of basic method

[0041] Reference GenBank: MF401379.1, Pomacea maculata mitochondrion, complete genome. After checking the complete sequence, cds and the sequence of the presumed conserved region in Snap gene, the following sequence is selected to design primers and probes:

[0042] TACATTATATTCAGACGAACATCCACATAATTAGGTAATTTTTTATTTATTAGTATTTTATATTATAAGAGAGAAATCTCATTTTTAGGGTATGAACCTAACAGCTTGCTTTTAGCTTATCTTATATAATATATAGAAGAATTTTAATAATAAATATACAGAGAAGAATTAACTTCGTTAATAGATCTACAGTCTATCGCTTAAAACTCAGCCATCAAGTATAATTATATGACAATACCCCTTAAAGATTTCTTATCTTAGAATTTGCAATTCTACATTTTTTATTATTAAACTATAAGGAAATATACAAGATTTGAAATATGGTTTCTCTTTAGGCTTTGAAGGCCCATGGTCTCATTAACCTAAAATCTTATGATAATAAGTTTACTAGAAGAAATAGTCTTCCTTAAGGAATCAAAACCCTTTG;

[0043] In this embodiment, all primer compositions on which the final basic method (gel electrophoresis method) is based are shown in Table 1:

[0044] Table 1

[0045]

[0046] The screening process for all primer groups of the basic method is as follows:

[0047] 1. Sample: spot apple snail DNA with a concentration of 563.1 ng / μL;

[0048] 2. Kit: DNA constant-temperature rapid amplification kit (basic type) - II, Amp Future; it should be noted that the MIRA detection system in this embodiment is configured according to the instructions of the DNA constant-temperature rapid amplification kit (basic type) - II, with a 25 μL reaction system (the system on the instruction sheet is 50 μL, and the sample amount is half of that on the instruction sheet after splitting);

[0049] 3. Sample amount: 2.5 μL of spot apple snail DNA template with a concentration of 563.1 ng / μL, 1 μL of upstream primer, and 1 μL of downstream primer;

[0050] 4. Amplification conditions: incubation at a constant temperature of 40℃ for 20 min;

[0051] 5. Gel electrophoresis detection:

[0052] (1) Deproteinization: extraction method: Solaibao finished extraction solution was used, and the operation was performed according to the instructions of the RNA constant-temperature rapid amplification kit (basic type) - II of Amp Future;

[0053] (2) Running gel: voltage 50 v, time 70 min; voltage 80 v, time 50 min;

[0054] 6. Test results: as shown in Figure 1 , according to Figure 1 , bands 1F1R, 1F3R, 2F1R, and 2F2R are brighter than others (it should be noted that although 2F3R appears brighter than 2F1R from Figure 1 , in fact, when screening primer groups with contrast software, the background color of 2F3R is brighter than that of 2F1R, and 2F3R has more mixed bands and more serious tailing, so 2F1R is selected but 2F3R is not), therefore, 1F1R, 1F3R, 2F1R, and 2F2R are selected for further screening, and the screening process is consistent with the above process, and the detection results are shown in Figure 2 , the obtained gel bands are sequenced, and the sequencing results are shown in Figure 3 , it can be seen from Figure 2 that the band obtained by 2F2R is the brightest, and fromFigure 3 It can be seen that: sample A, primer combination 1F1R (tissue DNA), low concentration, no band after recovery. Sample B, primer combination 1F3R (tissue DNA), low concentration, no band after recovery. Sample C, primer combination 2F1R (tissue DNA), low concentration, no band after recovery. Sample D, primer combination 2F2R (tissue DNA), DNA MAN5 is the sequencing sequence, and DNA MAN4 is the target sequence; therefore, according to the banding condition, the optimal primer combination is determined to be 2F2R.

[0055] (II) Temperature gradient screening

[0056] 1. Sample: 563.1 ng / μL of spot apple snail DNA;

[0057] 2. Kit: DNA constant temperature rapid amplification kit (basic type) - II, Amp Future; It should be noted that the MIRA detection system in this example is configured according to the instructions of the DNA constant temperature rapid amplification kit (basic type) - II 25 μL reaction system (the instruction is 50 μL system, and the sample amount is half of the instruction after splitting) ;

[0058] 3. Sample amount: 2.5 μL of 563.1 ng / μL of spot apple snail DNA template, 1 μL of upstream primer, and 1 μL of downstream primer;

[0059] 4. Amplification conditions: incubate at 40℃ for 30 min; after incubation, add 25 μL of Solap DNA phenol extraction kit (saturated phenol: chloroform: isopentanol = 25:24:1), and centrifuge at 12000 rpm / min for 5 min;

[0060] 5. Gel electrophoresis detection:

[0061] (1) Deproteinization: extraction method: use Solap finished extraction solution, and operate according to the instructions of Amp Future RNA constant temperature rapid amplification kit (basic type) - II;

[0062] (2) Run the gel: voltage 50v, time 70min; voltage 80v, time 50min;

[0063] 6. Test results: the temperature gradient screening results are as shown in Figure 4 It can be seen from Figure 4 that there is no band when the amplification temperature is 39℃ and 40℃, and the band is brighter when the amplification temperature is 40℃, so 40℃ is selected as the amplification temperature.

[0064] (III) Specificity

[0065] 1. Samples: positive sample (DNA concentration 563.1 ng / µL), spot snail tissue sample (DNA concentration 563.1 ng / µL), bubble snail tissue sample (DNA concentration 704.7 ng / µL), Bellamya aeruginosa tissue sample (DNA concentration 863.3 ng / µL), river snail tissue sample (DNA concentration 761.4 ng / µL), field water sample in which the spot snail lives (all DNA concentration in the water sample 29.3 ng / µL) 12 µL, 10 µL, 8 µL, negative sample (ddH2O);

[0066] 2. Kit: DNA constant-temperature rapid amplification kit (basic type)-II, Amp Future; it should be noted that the MIRA detection system in the embodiment is configured according to the instructions of the DNA constant-temperature rapid amplification kit (basic type)-II to form a 25 µL reaction system (the system in the instructions is 50 µL, and the sample amount is halved after splitting);

[0067] 3. Sample amount: 2.5 µL of each sample, 1 µL of upstream primer, and 1 µL of downstream primer are added according to the above sample concentration;

[0068] 4. Amplification temperature: 40°C; amplification time: 20 minutes;

[0069] 5. Gel electrophoresis detection:

[0070] (1) Deproteinization: extraction method: Solaibao finished extraction solution is used, and the operation is performed according to the instructions of the RNA constant-temperature rapid amplification kit (basic type)-II of Amp Future;

[0071] (2) Gel running: voltage 50 v, time 70 min; voltage 80 v, time 50 min;

[0072] 6. Test results: the detection results are shown in Figure 5 From Figure 5 it can be seen that the primer composition provided by the application has good specificity, and the quarantine identification of the spot snail can also be directly realized through environmental DNA. It should be noted that the difficulty of realizing the quarantine of the spot snail through the water sample lies in that the spot snail is small in size, small in quantity in the environment, and has little DNA remaining in the environment, so that 95% of the 29.3 ng / µL DNA collected in the water sample is impurities, which seriously interferes with the detection of the spot snail. Therefore, it can be seen that the primer provided by the application realizes the quarantine of the spot snail through the water sample, which is a major breakthrough.

[0073] (Four), minimum detection line

[0074] (1) Detection limit in terms of spot snail DNA concentration

[0075] 1. Samples: Positive sample (DNA, concentration 563.1 ng / μL), negative sample (template ddH2O), and the concentrations of DNA in the remaining samples are 5.6 x 10⁻⁶. 2 ng / μL, 5.6x10 1 ng / μL, 5.6x10 -1 ng / μL, 5.6x10 -2 ng / μL, 5.6x10 -3 ng / μL, 5.6x10 -4 ng / μL, 5.6x10 -5 ng / μL, 5.6x10 -6 ng / μL, 5.6x10 -7 ng / μL;

[0076] 2. Reagent kit: DNA isothermal rapid amplification kit (basic type)-II, AMP Future; It should be noted that the MIRA detection system in this example is prepared according to the instructions of the DNA isothermal rapid amplification kit (basic type)-II, with a reaction volume of 25 μL (the instructions state a 50 μL system, and the sample volume after splitting is half of that in the instructions).

[0077] 3. Sample loading volume: Add 2.5 μL of each sample, 1 μL of upstream primer, and 1 μL of downstream primer according to the sample concentrations mentioned above;

[0078] 4. Amplification temperature: 40℃; Amplification time: 20 minutes;

[0079] 5. Gel electrophoresis detection:

[0080] (1) Protein removal: Extraction method: Solarbio's finished extraction solution was used, and the operation was carried out according to the instructions of the Amp Future RNA Isothermal Rapid Amplification Kit (Basic Type)-II;

[0081] (2) Running the glue: 50V for 70min; 80V for 50min;

[0082] 6. Experimental Results: The results are as follows Figure 6 As shown, from Figure 6 It can be seen that when the DNA concentration is 5.6 x 10⁻⁶ -5 Bands were still observed at ng / μL, therefore the limit of detection was 5.6 x 10⁻⁶. -5 ng / μL.

[0083] (2) Limit of detection as measured by plasmid concentration

[0084] 1. Detection limit based on plasmid concentration

[0085] 1. Sample: Plasmid concentration is 10 2Sample concentration of ng / µL, plasmid concentration of 10 1 Sample concentration of ng / µL, plasmid concentration of 10 0 Sample concentration of ng / µL, plasmid concentration of 10 -1 Sample concentration of ng / µL, plasmid concentration of 10 -1 Sample concentration of ng / µL, plasmid concentration of 10 -2 Sample concentration of ng / µL, plasmid concentration of 10 -3 Sample concentration of ng / µL, plasmid concentration of 10 -4 Sample concentration of ng / µL, plasmid concentration of 10 -5 Sample concentration of ng / µL, plasmid concentration of 10 -6 Sample concentration of ng / µL, plasmid concentration of 10 -7 Sample concentration of ng / µL, plasmid concentration of 10 -8 Sample concentration of ng / µL, plasmid concentration of 10 -9 Sample concentration of ng / µL, plasmid concentration of 10 -10 Samples in ng / µL;

[0086] 2. Reagent kit: DNA isothermal rapid amplification kit (basic type)-II, AMP Future; It should be noted that the MIRA detection system in this example is prepared according to the instructions of the DNA isothermal rapid amplification kit (basic type)-II, with a reaction volume of 25 μL (the instructions state a 50 μL system, and the sample volume after splitting is half of that in the instructions).

[0087] 3. Sample loading volume: Add 2.5 μL of each sample, 1 μL of upstream primer, and 1 μL of downstream primer according to the sample concentrations mentioned above;

[0088] 4. Amplification temperature: 40℃; Amplification time: 20 minutes;

[0089] 5. Gel electrophoresis detection:

[0090] (1) Protein removal: Extraction method: Solarbio's finished extraction solution was used, and the operation was carried out according to the instructions of the Amp Future RNA Isothermal Rapid Amplification Kit (Basic Type)-II;

[0091] (2) Running the glue: 50V for 70min; 80V for 50min;

[0092] 6. Test Results: The results are as follows Figure 7 As shown, from Figure 7 It can be seen that when the plasmid concentration is 1x10 -5 A band was still present at ng / μL, therefore the limit of detection was 1x10⁻⁶. -5 ng / μL.

[0093] II. Fluorescence Method

[0094] (I) Fluorescence method primer composition screening

[0095] Reference GenBank: MF401379.1, Pomacea maculata mitochondrion, complete genome. After viewing the complete sequence, cds and the sequence of the presumed conserved region in Snap gene, the following sequence was selected to design primers and probes:

[0096] TACATTATATTCAGACGAACATCCACATAATTAGGTAATTTTTTATTTATTAGTATTTTATATTATAAGAGAGAAATCTCATTTTTAGGGTATGAACCTAACAGCTTGCTTTTAGCTTATCTTATATAATATATAGAAGAATTTTAATAATAAATATACAGAGAAGAATTAACTTCGTTAATAGATCTACAGTCTATCGCTTAAAACTCAGCCATCAAGTATAATTATATGACAATACCCCTTAAAGATTTCTTATCTTAGAATTTGCAATTCTACATTTTTTATTATTAAACTATAAGGAAATATACAAGATTTGAAATATGGTTTCTCTTTAGGCTTTGAAGGCCCATGGTCTCATTAACCTAAAATCTTATGATAATAAGTTTACTAGAAGAAATAGTCTTCCTTAAGGAATCAAAACCCTTTG;

[0097] In this embodiment, all primer compositions based on fluorescence method are shown in Table 2:

[0098] Table 2

[0099]

[0100] The process of screening all primer compositions of the fluorescence method is as follows:

[0101] 1. Sample: The DNA concentration of the apple snail tissue sample was 68.28 ng / μL;

[0102] 2. Kit: DNA constant temperature rapid amplification kit (basic type) - II, Amp Future; It should be noted that the MIRA detection system in this embodiment is configured according to the instructions of the DNA constant temperature rapid amplification kit (basic type) - II 25 μL reaction system (the instruction is 50 μL system, and the sample amount is half of the instruction after splitting).

[0103] 3. Sample amount: 2.5 μL of spot snail DNA template with a concentration of 68.28 ng / μL, 1 μL of upstream primer, 1 μL of downstream primer, and 0.3 μL of fluorescent probe;

[0104] 4. Amplification conditions: incubation at 40℃ for 20 min;

[0105] 5. Collect the fluorescence effect picture of the product and obtain the amplification graph;

[0106] 6. Experimental results: the results are shown in Figures 8-10 , it can be seen from Figure 8 that the fluorescence of 2F2R+p is the brightest; from Figure 9 and Figure 10 , the orthogonal reverse cross amplification curve shows that 2F2R+p has the best amplification effect, so the combination of 2F2R+p is the best.

[0107] (II) Temperature gradient screening

[0108] 1. Sample: spot snail tissue sample with a DNA concentration of 68.28 ng / μL, and ddH2O (negative control);

[0109] 2. Kit: DNA constant temperature rapid amplification kit (basic type)-II, Amp Future; it should be noted that the MIRA detection system in this embodiment is configured according to the instructions of the DNA constant temperature rapid amplification kit (basic type)-II, and the reaction system is 25 μL (the system on the instruction is 50 μL, and the sample amount is halved after splitting);

[0110] 3. Sample amount: 2.5 μL of spot snail DNA template with a concentration of 68.28 ng / μL, 1 μL of upstream primer, 1 μL of downstream primer, and 0.3 μL of fluorescent probe (2F2R+p);

[0111] 4. Amplification conditions: 38℃, 39℃, 40℃, 41℃, 42℃, 43℃; the amplification time is 20 min;

[0112] 5. Collect the fluorescence effect picture of the product and obtain the amplification graph;

[0113] 6. Experimental results: the amplification graph is shown in Figure 11 , the fluorescence graph is shown in Figure 12 , from Figures 11-12 , it can be seen that when the amplification temperature is 39℃, 41℃, and 42℃, the negative control curve is smooth, and the positive sample has an exponential growth period. Considering comprehensively, 42℃ is determined as the best amplification temperature.

[0114] (III) Cycle time screening

[0115] 1. Sample: DNA concentration 68.28 ng / μL of spot snail tissue sample; ddH2O (negative control);

[0116] 2. Kit: DNA constant temperature rapid amplification kit (basic type)-II, Amp Future; It should be noted that the MIRA detection system in this example is configured according to the instructions of the DNA constant temperature rapid amplification kit (basic type)-II, with a 25 μL reaction system (the instruction is 50 μL system, and the sample amount is half of the instruction after splitting);

[0117] 3. Sample amount: 2.5 μL of spot snail DNA template with a concentration of 68.28 ng / μL, 1 μL of upstream primer, 1 μL of downstream primer, and 0.3 μL of fluorescent probe (2F2R+p);

[0118] 4. Amplification conditions: Set the reaction time gradient to 4 min, 8 min, 12 min, 16 min, and 20 min; temperature: 42℃;

[0119] 5. Collect fluorescence signal every 30 s;

[0120] 6. Experimental results: The results are shown in Figure 13 From Figure 13 it can be seen that when the amplification time is 4 min, the obvious fluorescence signal can be detected, so the result can be obtained by amplifying for 4 minutes in an emergency, but if the sample concentration is low, such as environmental DNA sample, it is still necessary to ensure that the amplification time is 20 minutes.

[0121] (Four) Specificity

[0122] 1. Samples: positive sample PC-yang (DNA concentration 68.28 ng / µL), spot apple snail tissue sample PC-60 (DNA concentration 68.28 ng / µL), bubble snail tissue sample PC-nang (DNA concentration 70.47 ng / µL), small tube apple snail tissue sample PC-xiao (DNA concentration 86.33 ng / µL), river snail tissue sample PC-tian (DNA concentration 76.14 ng / µL), stone snail tissue sample PC-shi (DNA concentration 68.41 ng / µL), hidden apple snail tissue sample PC-ying (DNA concentration 70.13 ng / µL), first water sample PC-shui-1 (PC-shui1) (total DNA concentration in water sample 29.3 ng / µL), second water sample PC-shui-2 (PC-shui2) (total DNA concentration in water sample 16.1 ng / µL), third water sample PC-shui-3 (PC-shui3) (total DNA concentration in water sample 8.5 ng / µL), fourth water sample PC-shui-4 (PC-shui4) (total DNA concentration in water sample 4.7 ng / µL), negative sample Negative (ddH2O);

[0123] 2. Kit: DNA constant temperature rapid amplification kit (basic type)-II, Amp Future; it should be noted that the MIRA detection system in this embodiment is configured according to the instructions of the DNA constant temperature rapid amplification kit (basic type)-II, and the reaction system is 25 µL (the system on the instruction is 50 µL, and the sample amount is halved after splitting);

[0124] 3. Sample amount: 2.5 µL of the above sample, 1 µL of the upstream primer, 1 µL of the downstream primer, and 0.3 µL of the fluorescent probe (2F2R+p);

[0125] 4. Amplification conditions: amplification temperature setting 42℃; cycle number: 40; collect fluorescence signal every 30 s;

[0126] 5. Collect the fluorescence effect picture of the product and obtain the amplification chart;

[0127] 6. Experimental results: the amplification chart is as shown in Figure 14 , and the fluorescence chart is as shown in Figure 15As shown, when the amplification temperature is 42℃ and the time is 20 min, the positive sample and the spot snail tissue sample amplification curve appears obvious exponential growth period, and fluorescence will appear, but the water sample cannot be detected, that is, in the present application, the basic method can realize the detection of spot snail through water sample, while the fluorescence method cannot, the reason may be that the eDNA extracted from the water sample under the field condition may contain other impurities such as salt, which interferes with the binding of the probe and causes no fluorescence, while for the basic method, the gel electrophoresis is not disturbed by other impurities, so that under suitable conditions, even lower concentration can also show a band. Therefore, when it is necessary to quarantine spot snails through water samples, the basic method can be used, and when rapid detection is pursued, the spot snail tissue can be preferentially considered for quarantine by using the fluorescence method, and the quarantine result can be obtained in 4 minutes at the fastest.

[0128] (Five) Minimum detection limit screening

[0129] The detection limit of plasmid concentration

[0130] 1. Sample: the sample with plasmid concentration of 10 2 ng / µL, the sample with plasmid concentration of 10 1 ng / µL, the sample with plasmid concentration of 10 0 ng / µL, the sample with plasmid concentration of 10 -1 ng / µL, the sample with plasmid concentration of 10 -1 ng / µL, the sample with plasmid concentration of 10 -2 ng / µL, the sample with plasmid concentration of 10 -3 ng / µL, the sample with plasmid concentration of 10 -4 ng / µL, the sample with plasmid concentration of 10 -5 ng / µL, the sample with plasmid concentration of 10 -6 ng / µL, the sample with plasmid concentration of 10 -7 ng / µL, the sample with plasmid concentration of 10 -8 ng / µL, the sample with plasmid concentration of 10 -9 ng / µL, the sample with plasmid concentration of 10 -10 ng / µL, and the negative (ddH2O);

[0131] 2. Kit: DNA constant temperature rapid amplification kit (basic type) - II, Amp Future; It should be noted that the MIRA detection system in this embodiment is configured according to the instructions of the DNA constant temperature rapid amplification kit (basic type) - II, and the reaction system is 25 μL (the system on the instruction is 50 μL, and the sample amount is halved after splitting);

[0132] 3. Sample volume: 2.5 μL of the above sample, 1 μL of upstream primer, 1 μL of downstream primer, 0.3 μL of fluorescent probe (2F2R+p)

[0133] 4. Amplification condition: set the amplification temperature at 42℃; collect the fluorescence signal every 30 s, and amplify for 20 min;

[0134] 5. Collect the fluorescence effect picture of the product;

[0135] 6. Experimental result: the result is shown in Table 1, and it can be seen from Table 1 that the lowest detection limit of the plasmid concentration for detecting the spotted snail by using the fluorescence method is 1x10 Figure 16 Figure 16 -8 .

[0136] The above-described embodiments only express the specific implementation of the present application, and the description is relatively specific and detailed, but it should not be understood as a limitation on the protection scope of the present application. It should be noted that, for ordinary skilled persons in the art, without departing from the technical concept of the present application, a number of modifications and improvements can be made, which are all within the protection scope of the present application.​​

Claims

1. A rapid detection primer set for Pomacea canaliculata, characterized in that: The MIRA rapid detection primer composition comprises: Upstream primer: 5'-ATAGATCTACAGTCTATCGCTTAAAACTCAGC-3'; Downstream primer: 5'-TGATTCCTTAAGGAAGACTATTTCTTCTAG-3'.

2. The rapid detection primer set for *Pomacea canaliculata* according to claim 1, characterized in that: It also includes fluorescent probes: 5'-ATATGACAATACCCTCTAAAGATTTCTTA[FAMdT]C[THF][BHQ1dT]AGAATTTGCAATTCTA-[3'C3spacer].

3. A rapid detection method for Pomacea canaliculata, characterized in that: Includes the following steps: S1: Add the DNA sample to be tested to the MIRA amplification system, wherein the MIRA amplification system includes the spot golden apple snail rapid detection primer set as described in any one of claims 1-2; S2: Amplify at 37-42℃ for at least 4 minutes to obtain amplification products, and determine whether it is Pomacea canaliculata based on the amplification products.

4. The rapid detection method for Pomacea canaliculata according to claim 3, characterized in that: The DNA sample to be tested comes from biological tissue or water samples from which organisms live.

5. The rapid detection method for Pomacea canaliculata according to claim 3, characterized in that: The amplification temperature is 40℃ or 42℃.

6. The rapid detection method for Pomacea canaliculata according to claim 3, characterized in that: The amplification products obtained in S2 were used to determine whether they were Pomacea canaliculata by gel electrophoresis, fluorescence method, and colloidal gold method.

7. A reagent kit, characterized in that: The detection is achieved using the rapid detection primer set for *Pomacea canaliculata* according to any one of claims 1-2 or the rapid detection method for *Pomacea canaliculata* according to any one of claims 3-6.

8. The application of a rapid detection primer set for *Pomacea canaliculata* as described in any one of claims 1-2 or a rapid detection method for *Pomacea canaliculata* as described in any one of claims 3-6 in the identification of *Pomacea canaliculata*.

Images