Creation method and application of wheat-elytrigia elongata stem rust resistant short-fragment translocation line
By creating and transferring the stem rust resistance gene of long-spike wheatgrass to the wheat variety Shannong 40, the problem of insufficient resistance of wheat varieties to the Ug99 race was solved, and a stable and highly resistant breeding effect for wheat varieties was achieved.
Patent Information
- Application Number
- CN202511897553.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-16
- Publication Date
- 2026-02-06
AI Technical Summary
Existing wheat varieties lack sufficient resistance to stem rust of the Ug99 race and its variants, leading to severe yield reductions and threatening food security in wheat-producing regions worldwide.
By introducing the stem rust resistance gene from the 7el1L chromosome terminal of *Thinopyrum longicornis*, inducing cell division and recombination using the CS ph1b mutant, and combining molecular marker screening and stem rust resistance identification, a short-segment translocation line resistant to stem rust from wheat and *Thinopyrum longicornis* was created and transferred to the main wheat variety Shannong 40.
It significantly improves wheat resistance to Ug99 race and its variants. The resistance gene is stably inherited and can be used for wheat stem rust resistance breeding to enhance the disease resistance of wheat varieties.
Smart Images
Figure CN121472460A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of wheat genetics and breeding, specifically to the creation method and application of short-fragment translocation lines of wheat-long-spike leptomeria resistant to stem rust. Background Technology
[0002] Wheat stem rust is a disease caused by the specialized fungus *Puccinia graminis* f.sp. tritici (Pgt), which seriously harms the quality and yield of wheat in China. Several major outbreaks of stem rust have occurred in my country, with wheat yield losses reaching as high as 80% in the most severe cases.
[0003] For a long time, wheat breeders have successfully controlled stem rust damage to a low level by utilizing disease-resistant genes in cultivated varieties, such as Sr31 and Sr24. However, the emergence and global spread of Ug99 (originally discovered in Uganda and identified in 1999) has posed an unprecedented and serious threat to global wheat production. Ug99 was the first stem rust race discovered capable of overcoming the important disease-resistant gene Sr31. Its offspring variants (such as TTKSK and TTTSK) have further expanded its virulence spectrum, successively overcoming several major resistance genes such as Sr24 and Sr36. According to the International Maize and Wheat Improvement Center, Ug99 and its variants have spread from East Africa to the Middle East and South Asia, possessing infection potential in more than 90% of wheat varieties worldwide, seriously threatening global food security, especially in wheat-producing regions of Asia. Summary of the Invention
[0004] To address the aforementioned problems in existing research, it is necessary to introduce new stem rust resistance genes. The stem rust resistance gene provided in this invention is located at the end of chromosome 7el1L of *Leymus chinensis*. This gene exhibits excellent resistance to the highly toxic Ug99 race and its variants. Currently, the sequence information of this resistance gene has not been disclosed.
[0005] This invention uses the wheat-Thymus chinensis Robertson translocation line K11695, carrying a stem rust resistance gene, as the donor parent. Meiotic recombination between the 7D and 7E partial homologous regions was induced through the CS ph1b mutant. Using molecular markers and combined with stem rust resistance identification for verification, a short-fragment translocation line K3-64 resistant to stem rust from wheat-Thymus chinensis was created. Using K3-64 as the donor parent for the stem rust resistance gene, the gene was transferred to the main wheat variety Shannong 40 in my country, creating an improved line carrying the stem rust resistance gene. Stem rust resistance identification results showed that the improved line exhibited significantly increased stem rust resistance. This indicates that the stem rust resistance gene derived from the decaploid Wheatmus chinensis possesses strong resistance and can be stably inherited, making it suitable for wheat stem rust resistance breeding applications.
[0006] This invention discloses a method for creating a short-fragment translocation line of wheat-long-spiked wheatgrass resistant to stem rust, characterized by the following steps:
[0007] (1) Using the wheat-long spike wheatgrass Robertson translocation line K11695 carrying the stem rust resistance gene as the male parent and the Chinese spring ph1b mutant (CS ph1b) as the female parent, the F1 generation was obtained by hybridization;
[0008] (2) F1 was backcrossed with Chinese spring ph1b to obtain BC1F1. Genomic DNA was extracted from BC1F1 plants and detected using specific molecular markers of the ph1b gene, Xwgc2049 and Xwgc2107, as well as a specific molecular marker K66 closely linked to the stem rust resistance gene. Single plants homozygous for the ph1b gene and heterozygous for the stem rust resistance gene were screened out. The screened single plants were self-crossed, and BC1F2 generation plants were harvested as single plants and all genomic DNA was extracted.
[0009] (3) Genotyping of BC1F2 generation plants was performed using the specific molecular marker K66, which is closely linked to the stem rust resistance gene. Short-fragment translocation lines of wheat-long-spike wheat carrying the stem rust resistance gene were screened out. After self-pollination, homozygous BC1F3 generation plants were obtained. The seeds of the obtained BC1F3 generation plants were planted individually and DNA was extracted. Molecular marker 5704 was used to perform molecular marker-assisted detection on the seeds of each individual plant. If all the offspring seeds of a certain individual plant carried the stem rust resistance gene, it proved that the individual plant was homozygous.
[0010] (4) The PCR amplification reaction products were analyzed by polyacrylamide gel electrophoresis and agarose gel electrophoresis to determine the genotype of homozygotes.
[0011] The molecular markers mentioned in step (2) above are as follows:
[0012] Xwgc2049, forward primer P1, sequence SEQ ID NO. 1: CCTGGAATCCAAGAGGATGA; reverse primer P2, sequence SEQ ID NO. 2: CCTTTCAGCTTTGGTTTTGG.
[0013] Xwgc2107, forward primer P3, sequence SEQ ID NO. 3: GACCTGTTAGATGAGAAGTGTGA; reverse primer P4, sequence SEQ ID NO. 4: GGTGTGTGAGCTAGATATCGAAG.
[0014] K66, forward primer P5, sequence SEQ ID NO .5: ATTTGGCTGCGATCGATAAG; reverse primer P6, sequence SEQ ID NO .6: CCATCTTGTTGTTGCCCTCT.
[0015] The molecular markers mentioned in step (3) above are as follows:
[0016] 5704, forward primer P7, sequence SEQ ID NO. 7: AGCTTCTACATCGGGGATGC; reverse primer P8, sequence SEQ ID NO. 8: TTCTTGCTGGAGAGCTTTAGGT.
[0017] The wheat-long spikelet leptostrea short fragment translocation line containing the wheat stem rust resistance gene created by the method provided in this invention can be applied in wheat stem rust resistance breeding.
[0018] The molecular marker 5704, which is closely linked to the wheat stem rust resistance gene in the short translocation line of wheat-long-spike wheatgrass, can be used in wheat stem rust resistance breeding.
[0019] Molecular marker 5704 can also detect whether the target strain carries the stem rust resistance gene.
[0020] This invention provides a method for creating a genetically improved line carrying a wheat stem rust resistance gene. The method is characterized by using the newly created wheat-long-spike wheatgrass short-fragment translocation line K3-64 as the donor parent of the stem rust resistance gene, and using the main wheat variety in my country, Shannong 40, as the recurrent parent. After two consecutive backcrosses and three self-crosses, the method utilizes the molecular marker 5704, which is closely linked to the stem rust resistance gene, for assisted selection and identification, retaining individual plants carrying the stem rust resistance gene; thus, a genetically improved line is obtained.
[0021] The genetically improved line provided by this invention can be applied in wheat stem rust resistance breeding.
[0022] The method provided by this invention creates a short translocation line K3-64 of wheat-long spike wheatgrass carrying a stem rust resistance gene, and provides its application in wheat stem rust resistance breeding;
[0023] This invention also provides a modified strain, Shannong S401, carrying a stem rust resistance gene, based on the main wheat variety Shannong 40 in my country, and its application in wheat stem rust resistance breeding.
[0024] The main advantages of this invention are as follows: Utilizing in situ hybridization identification technology, combined with marker-assisted selection and stem rust resistance identification, a short-fragment translocation line K3-64 carrying a stem rust resistance gene was created, which maintains stable stem rust resistance and can be better promoted and applied in wheat breeding and production. By hybridizing, backcrossing, and self-pollinating K3-64 with the main wheat variety Shannong 40 in my country, and combining marker-assisted selection, artificial climate chamber generation, and stem rust resistance identification techniques, a batch of stem rust-resistant improved materials carrying the stem rust resistance gene were created. The results showed that compared with the parent Shannong 40, the improved lines carrying the stem rust resistance gene exhibited significantly improved stem rust resistance. This indicates that the stem rust resistance gene derived from the decaploid long-spike leek grass has strong resistance and can be stably inherited, making it suitable for wheat stem rust resistance breeding applications. Attached Figure Description
[0025] Figure 1 The figure shows the electrophoretic detection results of molecular marker K66 in samples from the BC1F2 generation of the wheat-wheatgrass short fragment translocation line. M represents the 2000 DNA Marker. The amplification of the target band by primer K66 indicates that individual plants 1, 2, 4, 5, 6, 9, 11, and 12 of the BC2F2 generation of the wheat-wheatgrass short fragment translocation line carry this stem rust resistance gene. The failure to amplify the target band or the band size being inconsistent in individual plants 3, 7, 8, and 10 of the BC2F2 generation of the wheat-wheatgrass short fragment translocation line indicates that individual plants 3, 7, 8, and 10 of the BC2F2 generation of the wheat-wheatgrass short fragment translocation line do not contain this stem rust resistance gene.
[0026] Figure 2 The figure shows the sequence amplified by molecular marker 5704-F / R on the chromosome of the wheat-long spike lynx 7el1(7D) heterotransformation line, with the primer sequence in yellow.
[0027] Figure 3 The figure shows the electrophoretic detection results of molecular marker 5704F / R in F3 population samples of the wheat-wheatgrass short fragment translocation line. M represents the 2000 DNA Marker, and 1-12 are individual plants of the wheat-wheatgrass short fragment translocation line BC2F3. All 12 individual plants can amplify a 1643bp band, indicating that all individual plants of the wheat-wheatgrass short fragment translocation line BC2F3 carry this stem rust resistance gene, proving that the previous generation parent BC2F2 individual plant that produced this individual plant is homozygous.
[0028] Figure 4 The illustration shows the identification of stem rust resistance in a short-segment translocation line of wheat-long-spiked wheatgrass. Detailed Implementation
[0029] Example 1: Creation of short-segment translocation lines of wheat-long-spike wheatgrass
[0030] (1) The F1 generation was obtained by hybridization of the wheat-long spike lynx Robertson translocation line K11695, which carries the stem rust resistance gene, and the Chinese spring ph1b mutant (CS ph1b) as the female parent.
[0031] (2) F1 was backcrossed with CS ph1b to obtain BC1F1. Genomic DNA was extracted from 427 BC1F1 plants. Specific molecular markers of the ph1b gene and specific molecular markers K66 (forward primer P7: (SEQ ID NO. 7) and reverse primer P8: (SEQ ID NO. 8)) closely linked to the stem rust resistance gene were used for detection. 32 plants homozygous for the ph1b gene and heterozygous for the stem rust resistance gene were screened. These plants were self-crossed to obtain 3000 BC1F2 plants, and genomic DNA was extracted from all of them. Genotyping of BC1F2 plants was performed using the specific molecular marker K66 (forward primer P9: (SEQ ID NO. 9) and reverse primer P10: (SEQ ID NO. 10)) which is closely linked to the stem rust resistance gene. The aim was to obtain the decaploid *Wheatgrass long-spike* genotype carrying molecular marker K66. Ultimately, a potential wheat-*Wheatgrass long-spike* short-fragment translocation line carrying the *Wheatgrass long-spike* stem rust resistance gene was obtained, and after self-crossing homozygosity, it was named K3-64. Figure 1 ).
[0032] (4) Design specific primers 5704F / R using primer 5. Figure 2 After self-pollination of BC1F2 plants, seeds of the BC1F3 generation were harvested as individual plants. Genotyping of the BC1F3 plants was performed using the specific molecular marker 5704, which is closely linked to the stem rust resistance gene. If all offspring seeds of a particular plant carry the stem rust resistance gene, then that plant is homozygous. Figure 3 ).
[0033] (5) In the PCR amplification reaction system of molecular marker K66, the PCR reagent composition is as follows: 1 μl DNA template, 5 μl 2×Taq Master Mix, 0.4 μl each of the front and rear primers, and sterile water to a final volume of 10 μl.
[0034] The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min; then 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 30 s, for 35 cycles; final extension at 72℃ for 5 min; and storage at 4℃. After the PCR amplification reaction, the amplification products were loaded onto an 8% polyacrylamide gel for electrophoresis and detected by silver staining. After electrophoresis, photographs were taken using an AlphaInnotech V.1.2 gel imaging system to record the genotype of each sample.
[0035] Example 2: Phenotypic identification of wheat-long-spike wheatgrass short-segment translocation lines
[0036] (1) To clarify whether the short-fragment translocation line carrying resistance to stem rust created in this study still possesses resistance, we used the dominant physiological race of stem rust to identify the resistance of the short-fragment translocation line K3-64, the wheat-long-spike wheatgrass substitution line 7el1 (7D), and the CS ph1b mutant to stem rust. Wheat seeds were planted in 8cm×8cm black plastic pots filled with nutrient soil and placed in a light incubator (light intensity 15000 Lux, light for 16 h, darkness for 8 h). Inoculation was performed when the wheat was in the "one leaf, one heart" stage. Stem rust spores were mixed with an appropriate amount of talc powder and sprayed onto the leaf surface using a sprayer. After completion, the leaves were treated in darkness for 12-20 h.
[0037] (2) Phenotypic results after inoculation are as follows Figure 4 The short-segment translocation line K3-64 exhibited the same resistance as 7el1 (7D), displaying a highly resistant phenotype. Figure 4 CS ph1b, on the other hand, showed complete susceptibility, exhibiting abundant spore masses. Resistance identification results indicate that the short translocation line carrying the stem rust resistance gene obtained in this study possesses excellent resistance to the stem rust physiological race, and will have promising applications in wheat stem rust resistance breeding in my country.
[0038] Example 3: Transfer and utilization of stem rust resistance genes in wheat-long-spike wheatgrass short-fragment translocation lines
[0039] (1) Using the newly created wheat-long-spike wheatgrass short-fragment translocation line K3-64 as the donor parent of the stem rust resistance gene, and the main wheat variety in my country, Shannong 40, as the recurrent parent, the line was backcrossed twice and then self-crossed three times. Assisted selection was performed using the newly developed molecular marker 5704 (forward primer P7: (SEQ ID NO. 7) and reverse primer P8: (SEQ ID NO. 8)) closely linked to the stem rust resistance gene, retaining individual plants carrying the stem rust resistance gene. Two genetically improved lines were obtained from the Shannong 40 background and named Shannong S401 and Shannong S402, respectively.
[0040] (2) In the PCR amplification reaction system of molecular marker 5704, the PCR reagent composition was: 1 μl DNA template, 7.5 μl 2×Taq Master Mix, 0.6 μl each of the front and rear primers, and sterile water to a final volume of 15 μl.
[0041] The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min; then 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 30 s, for 35 cycles; finally, 72℃ extension for 5 min; and stored at 4℃. After the PCR amplification reaction was completed, the amplification products were loaded onto a 1% agarose gel for electrophoresis. After electrophoresis, the gel was photographed using an AlphaInnotech V.1.2 gel imaging system to record the genotype of each sample.
[0042] (3) The stem rust resistance of two genetically improved lines under the Shannong 40 background was identified. The identification method has been described in detail in Example 2 and will not be repeated here. Compared with the recurrent parent Shannong 40, the stem rust resistance levels of Shannong S401 and Shannong S402 were significantly improved. This indicates that the stem rust resistance gene derived from the decapolic long-spike leptomeria has strong resistance and can be stably inherited, and can be used for wheat stem rust resistance breeding applications.
[0043] The above description is only a preferred embodiment of this patent. It should be noted that for those skilled in the art, several improvements and substitutions can be made without departing from the technical principles of this patent, and these improvements and substitutions should also be considered within the scope of protection of this patent.
Claims
1. A method for creating a short-fragment translocation line of wheat-long-spiked wheatgrass resistant to stem rust, characterized in that... Includes the following steps: (1) Using the wheat-long spike wheatgrass Robertson translocation line K11695 carrying the stem rust resistance gene as the male parent and the Chinese spring ph1b mutant as the female parent, the F1 generation was obtained by hybridization; (2) F1 was backcrossed with Chinese spring ph1b to obtain BC1F1. Genomic DNA was extracted from BC1F1 plants and detected using specific molecular markers of the ph1b gene, Xwgc2049 and Xwgc2107, as well as the specific molecular marker K66 of 7el1, which is closely linked to the stem rust resistance gene. Single plants homozygous for the ph1b gene and heterozygous for the stem rust resistance gene were screened. After self-pollination of these single plants, several BC1F2 generation plants were obtained and genomic DNA was extracted from all of them. The stem rust resistance of single plants at the seedling stage was identified by the spore smear method. Single plants with excellent agronomic traits and stem rust resistance were retained and harvested as single plants to obtain BC1F3 generation seeds. (3) Genotyping of BC1F2 generation plants was performed using the specific molecular marker 5704-F / R that is closely linked to the stem rust resistance gene. If all the offspring of a single plant carry the stem rust resistance gene, it proves that the single plant is homozygous. (4) The PCR amplification reaction products were analyzed by polyacrylamide gel electrophoresis and agarose gel electrophoresis to determine the genotype of homozygotes.
2. The method for creating a translocation system according to claim 1, characterized in that, The molecular markers mentioned in step (2) are as follows: Xwgc2049-F: CCTGGAATCCAAGAGGATGA Xwgc2049-R: CCTTTCAGCTTTGGTTTTGG Xwgc2107-F: GACCTGTTAGATGAGAAGTGTGA Xwgc2107-R: GGTGTGTGAGCTAGATATCGAAG K66-F: ATTTGGCTGCGATCGATAAG K66-R: CCATCTTGTTGTTGCCCTCT The molecular markers mentioned in step (3) are as follows: 5704-F: AGCTTCTACATCGGGGATGC 5704-R: TTCTTGCTGGAGAGCTTTAGGT.
3. The method for creating a translocation system according to claim 2, characterized in that, Using the method described above, a wheat-wheat-wheat-wheat-wheat-wheat-wheat-wheat-short fragment translocation line K3-64, which exhibits high resistance to the physiological race of stem rust, was created by utilizing germplasm resources carrying the stem rust resistance gene and derived from wheat-related plant *Thinopyrum elongatum*.
4. The application of the method for creating translocation lines as described in claim 3 in wheat stem rust resistance breeding.
5. The application of molecular markers 5704-F and 5704-R in the creation method of claim 2 in screening wheat germplasm resources carrying stem rust resistance genes.
6. The application of molecular markers 5704-F and 5704-R in the creation method of claim 2 in detecting whether the target line carries the stem rust resistance gene.
7. A method for creating a genetically improved wheat line carrying a gene for resistance to stem rust, characterized in that: Using the short-fragment translocation line K3-64 of wheat-long-spike wheatgrass created in claim 3 as the donor parent of the stem rust resistance gene, and using the main wheat variety Shannong 40 in my country as the recurrent parent, the line was backcrossed twice and then self-crossed three times. Molecular markers 5704-F and 5704-R were used for auxiliary selection and identification to retain individual plants carrying the stem rust resistance gene. Through stem rust resistance identification, a genetically improved line was obtained.
8. The application of the method for creating genetically improved lines according to claim 7 in wheat stem rust resistance breeding.
9. A molecular marker composition, characterized in that... Include: (1) Primer set used to detect ph1b gene: Xwgc2049, Xwgc2107; (2) Primer set K66, 5704-F / R used to detect stem rust resistance gene; Used to detect the ph1b gene and the stem rust resistance gene.
10. The use of the molecular marker composition of claim 9 in screening short-fragment translocation lines of wheat-long spike wheatgrass.