KASP molecular marker related to wet gluten content of wheat grains and application of KASP molecular marker

Abstract

The invention belongs to the technical field of biology, and discloses application of a KASP molecular marker related to the wet gluten content of wheat grains. One technical scheme of the invention protects the application of the composition for detecting the polymorphism or genotype of the SNP1 site in the wheat genome in any one of A1-A3: A1, the application in identification or auxiliary identification of the wet gluten content of wheat grains; a2, application in preparation of products for identification or auxiliary identification of the wet gluten content of the wheat grains; a3, application in wheat breeding or application in preparation of wheat breeding products; the SNP1 site is an SNP site in a wheat genome, the nucleotide variety of the SNP1 site is T or C, and the SNP1 site is the 251th nucleotide of SEQ ID No.1. The composition for detecting SNP1 site polymorphism and genotype can be used for preparing products for high-throughput identification of the wet gluten content of wheat grains.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a KASP molecular marker related to the wet gluten content of wheat kernels and application thereof. BACKGROUND

[0002] With the global food consumption trend towards functionalization and health, targeted improvement of wheat quality for different processing needs has become the key to breaking through the limitations of traditional agriculture. Deepening the research on wheat processing quality is an important way to cope with the challenges of food security and lead the transformation and upgrading of agricultural industry. The wet gluten content of wheat kernels is of great significance for improving wheat processing quality, optimizing food production technology and ensuring food security.

[0003] Wet gluten is mainly composed of glutenin and gliadin, and its content and characteristics directly affect the texture, taste and processing performance of flour products. The wet gluten content (WGC) of wheat kernels is one of the important indicators for evaluating the quality of wheat flour. High WGC flour has a strong gluten network structure, which is suitable for making foods with high elasticity and extensibility, such as bread, noodles and dumpling wrappers. On the contrary, low WGC flour is more suitable for making crisp cookies or cakes. Screening special wheat varieties suitable for different processing needs and further breeding through marker assisted selection (MAS) and other technologies to cultivate high-quality wheat that meets specific processing needs can effectively improve the economic value of wheat and meet consumers' demand for diversified and high-quality foods.

[0004] However, the determination of wheat kernel WGC is time-consuming and laborious, and breeders cannot directly select it by phenotype in the field. Marker assisted selection (MAS) is an effective way to improve the WGC of wheat kernels. The development of molecular markers associated with it is of great significance for wheat quality breeding. Currently, KASP (Kompetitive allele specific PCR) marker technology has been widely used in wheat SNP site detection and molecular breeding application research, achieving high-throughput genotyping. Using genotype data generated by wheat SNP chip or resequencing, combined with QTL mapping and association analysis, SNPs can be converted into KASP markers and directly used for molecular marker assisted breeding to improve breeding efficiency. SUMMARY

[0005] One of the technical problems solved by the present application is how to high-throughput identify or assist in identifying the wet gluten content of wheat kernels.

[0006] To solve the above technical problems, the present application provides any one of the following A1-A3 applications: A1, use of a composition for detecting polymorphism or genotype (i.e. allele) of SNP1 site in a wheat genome in identifying or assisting in identifying the wet gluten content of wheat kernels; the SNP1 site is a SNP site in the wheat genome, the nucleotide species of which is T or C, and is the 251st nucleotide in SEQ ID No. 1; the composition comprises the PCR primer, and the PCR primer is P1 or P2: P1, the PCR primer is a primer set consisting of a single-stranded DNA with a nucleotide sequence of SEQ ID No. 2 from 22 to 45, a single-stranded DNA with a nucleotide sequence of SEQ ID No. 3 from 22 to 45, and a single-stranded DNA with a nucleotide sequence of SEQ ID No. 4. P2, the PCR primer is a primer set consisting of a single-stranded DNA with a nucleotide sequence of SEQ ID No. 2, a single-stranded DNA with a nucleotide sequence of SEQ ID No. 3, and a single-stranded DNA with a nucleotide sequence of SEQ ID No. 4.

[0007] A2, use of a composition for detecting polymorphism or genotype (i.e. allele) of SNP1 site in a wheat genome in the preparation of a product for identifying or assisting in identifying the wet gluten content of wheat kernels; the SNP1 site is a SNP site in the wheat genome, the nucleotide species of which is T or C, and is the 251st nucleotide in SEQ ID No. 1; the composition comprises the PCR primer, and the PCR primer is P1 or P2.

[0008] A3, use of a composition for detecting polymorphism or genotype (i.e. allele) of SNP1 site in a wheat genome in wheat breeding or in the preparation of a product for wheat breeding; the SNP1 site is a SNP site in the wheat genome, the nucleotide species of which is T or C, and is the 251st nucleotide in SEQ ID No. 1; the composition comprises the PCR primer, and the PCR primer is P1 or P2.

[0009] The purpose of the breeding includes selecting wheat with high wet gluten content or wheat with low wet gluten content.

[0010] The application also provides a method for identifying or assisting in identifying the wet gluten content of wheat kernels, comprising detecting the genotype of the wheat to be tested, and identifying or assisting in identifying the wet gluten content of the wheat according to the genotype of the wheat to be tested; the genotype is the genotype of the SNP1 site in the wheat genome; the SNP1 site is a SNP site in the wheat genome, the nucleotide species of which is T or C, and is the 251st nucleotide in SEQ ID No. 1; the detection is performed by using a PCR primer, and the PCR primer is P1 or P2.

[0011] Another technical problem to be solved by the present application is how to breed wheat.

[0012] To solve the above technical problems, the present application provides the following technical solutions: B1. The method described above is applied in wheat breeding.

[0013] The purpose of the breeding includes breeding wheat with high gluten content or wheat with low gluten content.

[0014] B2. A method for breeding wheat, comprising: detecting the polymorphism of SNP1 in the wheat genome A1, selecting wheat with homozygous T at the SNP1 site in the wheat genome as the parent for breeding, and the purpose of the breeding includes breeding wheat with low gluten content (i.e. low gluten wheat).

[0015] B3. A method for breeding wheat, comprising: detecting the polymorphism of SNP1 in the wheat genome A1, selecting wheat with homozygous C at the SNP1 site in the wheat genome as the parent for breeding, and the purpose of the breeding includes breeding wheat with high gluten content (i.e. high gluten wheat).

[0016] Any one of the following products containing a composition for detecting the polymorphism or genotype (i.e. allele) of SNP1 in the wheat genome also falls within the scope of protection of the present application: 1) a product for detecting single nucleotide polymorphism or genotype related to the gluten content of wheat kernels; 2) a product for identifying or assisting in identifying the gluten content of wheat kernels; 3) a product for wheat breeding.

[0017] In the above applications, methods and products, the SNP1 site is a SNP site in the wheat genome, with nucleotide species T or C, which is the 251st nucleotide of SEQ ID No. 1. The detection of the polymorphism or genotype (i.e. allele) of SNP1 site in the wheat genome can specifically be the detection of the nucleotide species of SNP1 site. The genotype of SNP1 site in the wheat genome can be TT, CC or TC. The TT is homozygous for T at the SNP1 site in the wheat genome, the CC is homozygous for C at the SNP1 site in the wheat genome, and the TC is heterozygous for T and C at the SNP1 site in the wheat genome.

[0018] In the above method, the identification or assistance in identifying the gluten content of wheat kernels according to the genotype of the wheat to be tested can be that the gluten content of the wheat to be tested with genotype TT is lower than or lower than the gluten content of the wheat to be tested with genotype CC.

[0019] In the above application, method and product, the wheat breeding is breeding wheat with high gluten content or wheat with low gluten content.

[0020] In the above application, method and product, the composition for detecting the polymorphism or genotype (i.e. allele) of SNP1 in the genome of wheat can be reagents and / or instruments required for determining the polymorphism or genotype of SNP1 by at least one of the following methods: DNA sequencing, restriction enzyme digestion fragment gluten content polymorphism, single strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes chip based on nucleic acid hybridization reaction, chip based on single base extension reaction, chip based on allele specific primer extension reaction, chip based on "one step" reaction, chip based on primer ligation reaction, chip based on restriction enzyme reaction, chip based on protein DNA binding reaction, and chip based on fluorescence molecule DNA binding reaction.

[0021] In the above application, method and product, the composition for detecting the polymorphism or genotype (i.e. allele) of SNP1 in the genome of wheat is as follows 1), 2) or 3): D1) the composition for detecting the polymorphism or genotype of SNP1 in the genome of wheat contains PCR primers for amplifying the fragment of wheat genome DNA including the SNP1 site; D2) the composition for detecting the polymorphism or genotype of SNP1 in the genome of wheat is PCR reagent containing the PCR primers; D3) a kit containing the PCR primers of D1) or the PCR reagent of D2).

[0022] In the above application, method and product, the PCR primers can be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be connected to nucleic acid. The marker includes but is not limited to dye; radioactive label, such as 32P; a binding moiety, such as biotin; a hapten, such as digoxin (DIG); a luminescent, phosphorescent or fluorescent moiety; and a fluorescent dye alone or in combination with a moiety that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, etc. The label can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The label can include or be composed of a nucleic acid or protein sequence, provided that the sequence comprising the label is detectable. In some embodiments, the nucleic acid is directly detected without a label (e.g., the sequence is directly read). As described, the PCR primers can be a primer set consisting of a single-stranded DNA with a nucleotide sequence of SEQ ID No. 2, a single-stranded DNA with a nucleotide sequence of SEQ ID No. 3, and a single-stranded DNA with a nucleotide sequence of SEQ ID No. 4, wherein SEQ ID No. 2 in the sequence listing consists of 45 nucleotides, the first to 21st nucleotides being a FAM linker sequence (as a label), and the 22nd to 45th nucleotides being a specific sequence; and wherein SEQ ID No. 3 in the sequence listing consists of 45 nucleotides, the first to 21st nucleotides being a HEX linker sequence (as a label), and the 22nd to 45th nucleotides being a specific sequence.

[0023] In the above applications, methods and products, the product can be a reagent or a kit or a system, which can include a combination of reagents or kits, instruments and analysis software, such as a product consisting of PCR primers, PARMS master mix reagents, a microplate reader and online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ), or a combination product consisting of PCR primers, PARMS master mix reagents, online software SNP decoder and a real-time PCR instrument. The product can include a composition for detecting the polymorphism or genotype of SNP1 site in the wheat genome as described above.

[0024] The application discloses a new KASP marker for detecting the wet gluten content of wheat kernels. The specific primer group provided by the application is composed of single-stranded DNA shown in SEQ ID No. 2, single-stranded DNA shown in SEQ ID No. 3 and single-stranded DNA shown in SEQ ID No. 4, wherein the single-stranded DNA shown in SEQ ID No. 2 and the single-stranded DNA shown in SEQ ID No. 3 are provided with a fluorescently labeled linker. In an embodiment of the application, the primer group provided with the fluorescently labeled linker is used to amplify the wheat genome DNA of a plurality of samples including a SNP1 site, fluorescence signal processing is performed, the nucleotide type of the SNP1 site is determined, and the kernel wet gluten content of each sample to be detected is measured. Experiments prove that in a population composed of 123 wheat varieties, the kernel wet gluten content of the wheat variety homozygous for the SNP1 site T is significantly lower than that of the wheat variety homozygous for the SNP1 site C, indicating that the kernel wet gluten content of the wheat variety homozygous for the SNP1 site T is significantly lower than that of the wheat variety homozygous for the SNP1 site C. It is proved that SNP1 is an SNP molecular marker related to the kernel wet gluten content of wheat, the specific primer group provided by the application can be used for identifying or assisting in identifying the kernel wet gluten content of wheat, can be used for screening the kernel wet gluten content variety of wheat, can be used for molecular marker assisted breeding of wheat, and can be used for breeding and cultivating high-gluten wheat or low-gluten wheat. The polymorphism of SNP1 is directly manifested in the form of DNA, and can be detected in various tissues and various development stages of wheat, which is beneficial to conveniently and quickly predicting the kernel wet gluten content of wheat. In actual application, in order to improve the accuracy, the composition for detecting the polymorphism and genotype of the SNP1 site can be combined with other substances (such as substances for detecting other single nucleotide polymorphisms or genotypes related to the kernel wet gluten content of wheat) to prepare a product for identifying the kernel wet gluten content of wheat. The specific primer group in the application is used for molecular marker assisted selection of the kernel wet gluten content of wheat, and can quickly screen wheat varieties (germplasm) with higher or lower kernel wet gluten content, thereby accelerating the breeding process of new wheat varieties. The application has important theoretical significance and economic value for molecular marker assisted selection of high-gluten wheat varieties or low-gluten wheat varieties. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 The genotyping results of 123 wheat varieties in the embodiment 2 of the application by using the Kasp marker. Among them, the blue color is the non-excellent genotype TT, the red color is the excellent genotype CC, and the green color is the hybrid TC. DETAILED DESCRIPTION

[0026] The application will be further described in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0027] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified.

[0028] The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified. In the quantitative tests in the following examples, three repeated experiments were set up, and the results were averaged.

[0029] The wheat varieties Zhong 892 and Linmai 2 used in the following examples are both described in the non-patent literature “Liu Jindong. Genetic analysis of common wheat black kernel disease resistance [D]. China Agricultural University, 2018.” The biological materials can be obtained from the applicant to repeat the experiments of the application.

[0030] The wheat varieties in Table 3 in the following examples are described in the non-patent literature “Liu Jindong. Genetic analysis of common wheat black kernel disease resistance [D]. China Agricultural University, 2018 and Zhu Zhanwang. Positioning of wheat scab resistance genes and development of molecular markers using whole genome linkage analysis and association analysis [D]. Chinese Academy of Agricultural Sciences, 2020. DOI: 10.27630 / d.cnki.gznky.2020.000236.” The biological materials can be obtained from the applicant to repeat the experiments of the application.

[0031] In the following examples, the data were processed using Excel 2019 statistical software, and the experimental results were expressed as mean ± standard deviation, and One-way ANOVA test was used, P <0.05 (*) indicates a significant difference, P <0.01 (**) indicates a highly significant difference, P <0.001 (*** ) indicates a highly significant difference.

[0032] Example 1, discovery of QTL of grain wet gluten content in Zhong 892 x Linmai 2 RIL population and obtaining of KASP marker I. Acquisition of phenotypic data The maternal parent of Linmai 2 is Lumaiz 23, and the paternal parent is Lin 90-15, which is a medium gluten wheat variety.

[0033] The maternal parent of Zhong 892 is the F6 generation line 786-11 (Eurou / Beijing 8), and the paternal parent is the F3 generation line LK338 / 730-04. It was bred by the Institute of Crop Science and the Cotton Research Institute of the Chinese Academy of Agricultural Sciences and is a medium-strong gluten wheat variety.

[0034] Using Linmai 2 as the female parent and Zhong 892 as the male parent, a RIL population containing 262 F6 lines was constructed using the single-seed transfer method.

[0035] The RIL population was planted in Xinxiang, Henan Province in 2022-2023 and in Baoding, Hebei Province in 2023-2024, using a completely randomized block design with three replicates, single-row plots, row length 2 m, row width 0.25 m, and 60 grains / row. Field management throughout the wheat growth cycle followed local conventional cultivation techniques.

[0036] After timely harvesting, the grains were naturally sun-dried and stored. Impurities and damaged grains were removed, and the wet gluten content of the grains was determined using a Swiss-made near-infrared spectroscopy quality analyzer (DA7200). Each sample was measured three times for each replicate, and the average value was taken.

[0037] Genomic DNA was extracted from young leaves of 262 families using the CTAB method. DNA concentration was determined using a NanoDrop 2000c spectrophotometer, and the DNA samples were adjusted to a standard concentration of 50 ng / μL. DNA quality was then assessed using 0.8% agarose gel electrophoresis. DNA samples meeting quality standards were used for SNP genotyping. SNP analysis was performed using a wheat 90K SNP chip.

[0038] II. Linkage Graph Construction Genotyping of RILs and two parents was performed using the wheat 90K SNP chip from CapitalBio Corporation (http: / / www.capitalbio.com), which contained a total of 80,547 SNPs. Genotyping data were filtered to remove non-polymorphic markers, families with marker loss rates greater than 20%, and markers with a minimum allele frequency of less than 30%. The remaining high-quality polymorphic markers were used for subsequent analysis.

[0039] The filtered polymorphic markers were processed using the BIN function in IciMapping v4.2 (http: / / www.isbreeding.net / ; Meng et al. 2015), leaving 9354 markers. Genetic linkage maps were then constructed using JoinMap v4.0 and MapChart v2.32 software (https: / / www.wur.nl / en / show / Mapchart.htm; Voorrips, 2002).

[0040] III. QTL analysis QTL analysis was performed by IciMapping 4.1 ICIM-ADD method, and the LOD threshold was selected as 2.5. One stable QTL was located on the 4B chromosome of wheat, which was named as QWGC.lfnu-4BL , and located at about 621.3 Mb on the 4B chromosome. QWGC.lfnu-4BL The SNP site closely linked to the marker BS00022830_51 is called SNP1, which is located at 621.3 Mb (reference genome website https: / / urgi.versailles.inra.fr / blast_iwgsc / ) of the wheat reference genome (4B chromosome) Chinese Spring RefSeq v1.0 (621327033 bp), and can explain 5.65-9.21% of the phenotypic variation (see Table 1). The SNP1 site marked as BS00022830_51 is converted into KASP marker QWGC.LFNU-4BL , and the grain wet gluten content can be assisted by molecular marker screening. The present application has important significance for cultivating wheat varieties with high or low grain wet gluten content.

[0041] Table 1, the detection of 892x Linmai No. 2 RIL population by composite interval mapping method QWGC.lfnu-4BL

[0042] The SNP1 site is specifically the 251st nucleotide of SEQ ID No. 1, and the nucleotide type is T or C, represented by the letter Y. One of its allelic genotypes is TT (i.e. the 251st nucleotide of SEQ ID No. 1 is T homozygous type), and the wheat of this type is a low grain wet gluten content genotype, also known as T base type; the other allelic genotype is CC (i.e. the 251st nucleotide of SEQ ID No. 1 is C homozygous type), and the wheat of this type is a high grain wet gluten content genotype, also known as C base type.

[0043] SEQ ID No. 1: TACAGCAACATACCCGTGTATTCTTCACAGGAAGTGTCGTGAAGTAAAAAAAGAAACTTGGATGTGAGTGGCAACACAAGAAGCAATGAATTTTGGGACATCTCTACATCTTGGAGCACGTGCGACGACGCACGAGTGGTGCTTCCCCCTGCCCAGCAACCCTCTTGTGAGACTATGCAGTTGGGCCTGCCAAGGGTCTCCGGAAGCTCCCCAGATGTATTTATCATGTGCCCTTAAACTGATGCAATAAYGTGAAGATGTTTTCTGTAAAAACTGGAAGGGATGGTACAGATATAATTTGTAGAGATCTCCAGCGGCAAGCTGTAGATACCTCAGATCAGTGCGTGTGACCACAACTATGTGAGCCGGCTACACTTTTCTGGATGAGCATCAAAAGAAAGTAGTTATGCGTGGCCTGGTTGTCCCTGCATTTAAATTTCTATTTTGCGATATGTTGGCGTACTTAAATCAGATCCCCAGGTAAACAGGCCGAGTCAAGCC KASP primers were designed for the SNP1 site, and the primer sequences are shown in Table 2: Table 2 KASP marker primer sequences

[0044] The single-stranded DNA molecule shown in SEQ ID No. 2 and SEQ ID No. 4 amplifies the fragment of the 251st nucleotide of SEQ ID No. 1 as T, and the fluorescence signal of the fluorescent group combined with FAM sequence can be read by a microplate reader or a fluorescence quantitative PCR instrument; The single-stranded DNA molecule shown in SEQ ID No. 3 and SEQ ID No. 4 amplifies the fragment of the 251st nucleotide of SEQ ID No. 1 as C, and the fluorescence signal of the fluorescent group combined with HEX sequence can be read by a microplate reader or a fluorescence quantitative PCR instrument.

[0045] Principle of KASP: two forward competitive primers (the 5' end of the primers has a base sequence complementary to the fluorescent group HEX and FAM, and the other sequence only differs at the 3' end SNP) and one reverse common primer; the PCR reaction system contains a universal sequence modified by a fluorescent group and a quencher group (Master Mix is provided by LGC company), two forward primers can emit two different colors of light, if the site is homozygous, it emits a single fluorescence, if it is heterozygous, it can emit two kinds of fluorescence at the same time.

[0046] The KASP marker PCR amplification system is as follows: 2.0 μL KASP 2x Master Mix (LGC, item number: 13448166), 0.048 μL KASP primer (3 primers mixed, total concentration is 50 μM, and the molar ratio of two upstream primers and one downstream primer is 2:2:5), 1.952 μL template DNA (50 ng / μL). Amplification uses a 384-well PCR instrument (BIO-RAD, S1000TMThermal Cycler), and the program is as follows: 94℃ 15 min; 94℃ 20s, 63-55℃ 1 min (decrease 1℃ for each cycle), 10 cycles; 94℃ 20s, 55℃ 60s, 32 cycles.

[0047] The PCR amplification product is placed in an automatic focusing fluorescence multifunctional enzyme label instrument (PHERAstarplus SNP, BMGLABTECH) to read the final fluorescence data, and then the data is imported into Klustercaller v3.4 (LGC, Hoddesdon, UK) for genotyping.

[0048] The detection standard of the SNP1 site of the application is as follows: if the fluorescence signal data of the amplification product is analyzed by the genotyping software KlusterCaller close to the Y axis (FAM fluorescence signal), it represents that the genotype of the SNP1 site is TT homozygous; if the fluorescence signal data of the amplification product is analyzed by the genotyping software KlusterCaller close to the X axis (HEX fluorescence signal), it represents that the genotype of the SNP1 site is CC homozygous; if the fluorescence signal data of the amplification product is analyzed by the genotyping software KlusterCaller in the middle of the X axis and the Y axis (with FAM and HEX signals at the same time), it represents that the genotype of the SNP1 site is TC heterozygous.

[0049] Example 2 Application of KASP marker in identification of wheat grain wet gluten content The experimental material is 123 wheat varieties in the Huanghuai wheat region, and the specific information is shown in Table 3.

[0050] 123 elite varieties and advanced lines in the south part of Huanghuai wheat region were planted in Xinxiang, Henan and Dezhou, Shandong in 2020-2021 and 2021-2022. Three repetitions, two rows per plot, row length 2 m, row spacing 0.25 m, 60 seeds per row, artificial single-seed sowing, field management measures according to local high-yield cultivation measures. Grains were harvested in time, naturally dried, stored, impurities and damaged grains were removed, and the WGC of grains was determined by a Swiss near-infrared quality analyzer (DA7200). Each repetition of each material was determined three times, and the average value was taken. The improved CTAB method was used to extract the genomic DNA of 123 families of young leaves.

[0051] The genomic DNA of all experimental materials was extracted, and KASP primers designed in Example 1 were used for detection with the template, and the specific operation was referred to Example 1.

[0052] The results are shown in Table 3 and Figure 1 Among the 123 wheat varieties, 62 varieties showed low grain wet gluten content genotype TT (blue), and the WGC was 31.6%; 60 varieties showed high grain wet gluten content genotype CC (red), and the WGC was 33.0%; statistical test showed QWGC.lfnu-4BL the gene effect reached significant difference ( P <0.05, Table 4).

[0053] Table 3 KASP marker SNP1 locus genotyping and grain wet gluten content detection results of 123 wheat varieties

[0054] Note: CC in Table 3 is high grain wet gluten content genotype; TT is low grain wet gluten content genotype; TC is heterozygous genotype.

[0055] Table 4 KASP marker effect on grain wet gluten content of 123 natural populations

[0056] In summary, the grain wet gluten content of the wheat variety with the genotype TT (also known as T base type) at the SNP1 locus is significantly lower than that of the wheat variety with the genotype CC (also known as C base type) at the SNP1 locus.

[0057] The application has been described in detail. Those skilled in the art will understand that they can make modifications and alterations to this application without departing from the spirit and scope of the application. Although this application presents specific examples, it is to be understood that further modifications can be made. In general, the application is intended to cover any adaptations or variations of the present application including modifications based on the generic principles of this application as well as the present disclosure. Certain features of the application are presented in terms of examples. It is contemplated that these features can be combined with other features in the application to produce additional desirable characteristics.

Claims

1. The application of a composition for detecting polymorphisms or genotypes at SNP1 sites in the wheat genome, characterized in that: The application can be any one of A1-A3: A1. Application in identifying or assisting in the identification of wet gluten content in wheat grains; A2. Application in the preparation of products for identifying or assisting in the identification of wet gluten content in wheat grains; A3. Applications in wheat breeding or in the preparation of wheat breeding products; The SNP1 site is a SNP site in the wheat genome, and its nucleotide type is T or C, which is nucleotide 251 of SEQ ID No. 1; the composition contains the PCR primers, and the PCR primers are P1 or P2: P1. The PCR primers are a primer set consisting of single-stranded DNA with nucleotide sequence of SEQ ID No. 2 from position 22 to 45, single-stranded DNA with nucleotide sequence of SEQ ID No. 3 from position 22 to 45, and single-stranded DNA with nucleotide sequence of SEQ ID No.

4. P2. The PCR primers are a primer set consisting of single-stranded DNA with nucleotide sequence SEQ ID No. 2, single-stranded DNA with nucleotide sequence SEQ ID No. 3, and single-stranded DNA with nucleotide sequence SEQ ID No.

4.

2. A method for identifying or assisting in the identification of wet gluten content in wheat grains, characterized in that: The method includes detecting the genotype of the wheat to be tested, and identifying or assisting in the identification of the wet gluten content of the wheat grains based on the genotype of the wheat to be tested; the genotype is the genotype of the SNP1 site in the wheat genome; the SNP1 site is an SNP site in the wheat genome, whose nucleotide type is T or C, and is the 251st nucleotide of SEQ ID No. 1; the detection is performed using PCR primers, and the PCR primers are P1 or P2 as described in claim 1.

3. The application of the method according to claim 2 in wheat breeding, characterized in that: The purpose of the breeding program includes selecting wheat varieties with low wet gluten content in the grains.

4. The application of the method according to claim 2 in wheat breeding, characterized in that: The purpose of the breeding program is to select wheat varieties with high wet gluten content in their grains.

5. A method for wheat breeding, characterized by: The method includes detecting the polymorphism of the SNP1 site described in claim 1 in the wheat genome, selecting homozygous wheat with the SNP1 site being T in the wheat genome as a parent for breeding, and the purpose of the breeding includes selecting wheat with low wet gluten content in the grains.

6. A method for wheat breeding, characterized by: The method includes detecting the polymorphism of the SNP1 site described in claim 1 in the wheat genome, selecting homozygous wheat with the SNP1 site C in the wheat genome as a parent for breeding, and the purpose of the breeding includes selecting wheat with high wet gluten content in the grains.

7. Products containing a composition for detecting polymorphisms or genotypes at SNP1 sites in the wheat genome, including any one of products 1)-3), are also within the scope of protection of this invention: 1) Products that detect single nucleotide polymorphisms or genotypes related to the wet gluten content of wheat grains; 2) Products used for identifying or assisting in the identification of wet gluten content in wheat grains; 3) Products used in wheat breeding.

8. The application according to claim 1 or the product according to claim 7, characterized in that: The wheat breeding refers to the cultivation of wheat with high wet gluten content or wheat with low wet gluten content.

9. The application according to any one of claims 1, 3, 4 and 8, the method according to any one of claims 2, 5 and 6, or the product according to claim 7 or 8, characterized in that: The composition for detecting polymorphism or genotype of SNP1 site in wheat genome is as follows: D1), D2), or D3). D1) The composition for detecting polymorphism or genotype of SNP1 site in wheat genome contains PCR primers for amplifying wheat genomic DNA fragments including the SNP1 site; D2) The composition for detecting the polymorphism or genotype of SNP1 site in wheat genome is a PCR reagent containing the PCR primers; D3) A kit containing the PCR primers described in D1) or the PCR reagents described in D2).

10. The application, method, or product according to claim 9, characterized in that: The PCR primers consist of a primer set composed of the single-stranded DNA shown in SEQ ID No. 1, the single-stranded DNA shown in SEQ ID No. 2, and the single-stranded DNA shown in SEQ ID No. 3.

Images