Primer probe group and kit for multiplex fluorescent PCR (Polymerase Chain Reaction) and / or multiplex quantitative digital PCR detection of five candida

Abstract

The invention belongs to the technical field of in-vitro molecular detection of pathogenic microorganisms, and particularly provides a primer probe group and a reagent for multiple fluorescent PCR (Polymerase Chain Reaction) and / or multiple quantitative digital PCR detection of five candida. The primer probe group comprises specific primer pairs and corresponding probes aiming at candida albicans, candida tropicalis, candida glabrata, candida parapsilosis and candida krusei. Based on the unified combination, two compatible detection paths are established: five-target synchronous qualitative detection can be realized by adopting a multiple fluorescent PCR (Polymerase Chain Reaction) method, and five-target absolute quantitative analysis can also be realized by adopting a multiple quantitative digital PCR method; the two methods can be applied independently or jointly. Through verification, the primer probe group has high specificity; the sensitivity is excellent, and DNA extracted from a clinical sample can be directly detected. The method is simple in detection process and short in time consumption, and an efficient and reliable molecular detection solution is provided for early differential diagnosis and precise medication of clinical invasive candidiasis.

Description

Technical Field

[0001] This invention belongs to the field of in vitro molecular detection technology for pathogenic microorganisms, specifically involving primer and probe sets and kits for multiplex fluorescent PCR and / or multiplex quantitative digital PCR detection of five Candida species. Background Technology

[0002] Invasive candidiasis is a common cause of clinical fungal infections, with high morbidity and mortality. In recent years, with the use of broad-spectrum antibiotics, immunosuppressants, and glucocorticoids, as well as radiotherapy and chemotherapy for tumors and some invasive procedures, the incidence of candidemia has been increasing worldwide. Invasive candidiasis can also occur in multiple systems, organs, and sites, including candidal endocarditis, peritoneal candidiasis, candidal endophthalmitis, bronchopulmonary candidiasis, central nervous system candidiasis, and candidal osteomyelitis / arthritis. *Candida albicans* remains the most common species causing candidiasis, but the proportion of non-*Candida albicans* species such as *Candida glabrata*, *Candida tropicalis*, *Candida parapsilosis*, and *Candida krusei* is increasing. Non-*Candida albicans* exhibit higher resistance to azole drugs, and some antifungal drugs are less effective, potentially leading to higher mortality rates in cases of invasive candidiasis. In addition, Candida infections can also occur in superficial candidiasis, affecting the skin, urinary tract, oral cavity, and vagina. Although the mortality rate of superficial candidiasis is not high, its incidence is high, affecting a wide range of people and seriously impacting the quality of life of patients. It is also a common health problem that troubles many patients.

[0003] Methods for detecting Candida include traditional methods, serological testing, next-generation sequencing, and nucleic acid amplification. Traditional methods include microscopic examination, histopathological examination, and culture. Among these, microscopic examination and histopathological examination have low positive rates and cannot rule out false negatives; culture methods have long testing cycles, low sensitivity, and require high levels of technical expertise and operator skill; serological testing, including the Gram-positive test, can broadly screen for invasive fungal infections but cannot identify specific fungal species; next-generation sequencing is costly and difficult to quantify, limiting its widespread clinical use; nucleic acid amplification testing, including PCR, isothermal amplification, quantitative real-time PCR, and quantitative digital PCR, offers rapid, accurate, and comprehensive results and is gradually becoming an important diagnostic tool for invasive fungal diseases and superficial fungal infections, especially suitable for patients with severe, immunosuppressed, or complicated infections, such as those with recurrent candidal vaginitis (RVVC).

[0004] Early PCR-based kits for Candida detection were mostly for detecting Candida albicans or general Candida species, resulting in limited species coverage and an inability to detect specific Candida species. Furthermore, different Candida species exhibit varying sensitivities to drugs, necessitating genotyping kits. With rising testing requirements and technological advancements, genotyping kits for Candida have begun to appear on the market.

[0005] CN120005992A discloses a primer and probe set, kit, and application for detecting Candida bloodstream infections. It cleverly combines RAA and qPCR technologies, enriching the template extensively in the RAA stage to improve sensitivity, and then using qPCR to detect Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, and Candida krusei. However, contamination or non-specific products introduced by the RAA step may directly affect the reliability of the final qPCR results.

[0006] CN116855622B discloses a primer-probe combination, reagents, and kits for detecting Candida. Combining RAA and melting curve techniques, it can rapidly detect Candida albicans, Candida glabrata, Candida tropicalis, Candida subglabrata, Candida krusei, and Candida auris. However, this method relies on primer specificity and is susceptible to interference from non-specific amplification. If the sample contains multiple mixed fungi, only the dominant fungus may be detected. Furthermore, if the target gene exhibits polymorphism among strains, the Tm value fluctuates greatly, leading to unreliable species identification.

[0007] CN117867157A discloses a primer and probe set and kit for rapid and visual detection of five Candida species. Combining RPA and test strip technology, it has the advantages of speed and visualization, but it cannot perform quantitative detection.

[0008] CN118006828A discloses a primer-probe combination, kit, and detection method for simultaneous detection of four Candida species using digital PCR, which can provide more accurate qualitative and quantitative data results, but the detection range is insufficient.

[0009] Therefore, a simple, rapid, sensitive, highly specific method and kit for the detection of Candida albicans, which can be used for qualitative typing or quantitative determination or a combination of both, is of great significance for clinical medication and guiding timely and accurate treatment. Summary of the Invention

[0010] The purpose of this invention is to provide primer and probe sets and kits for the detection of five Candida species using multiplex fluorescent PCR and / or multiplex quantitative digital PCR. The primer and probe sets described in this invention can specifically detect Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, and Candida krusei using fluorescent PCR and quantitative digital PCR methods. They exhibit high specificity and sensitivity, allow direct DNA extraction from samples for detection, and are simple and time-efficient. Furthermore, they enable absolute and direct quantification of nucleic acid concentration in samples.

[0011] This invention provides primer and probe sets for the detection of five Candida species using multiplex fluorescent PCR and / or multiplex quantitative digital PCR, including primers ca-alb-F and ca-alb-R and probe ca-alb-P for detecting Candida albicans, primers ca-tro-F and ca-tro-R and probe ca-tro-P for detecting Candida tropicalis, primers ca-gla-F and ca-gla-R and probe ca-gla-P for detecting Candida glaciformis, primers ca-par-F and ca-par-R and probe ca-par-P for detecting Candida parapneumoniae, and primers ca-kru-F and ca-kru-R and probe ca-kru-P for detecting Candida krusei. The nucleotide sequence of ca-alb-F is shown in SEQ ID NO. 1; the nucleotide sequence of ca-alb-R is shown in SEQ ID NO. 2; the nucleotide sequence of ca-alb-P is shown in SEQ ID NO. 3; and the nucleotide sequence of ca-tro-F is shown in SEQ ID NO. 1. The nucleotide sequence of ca-tro-R is shown in SEQ ID NO.4; the nucleotide sequence of ca-tro-P is shown in SEQ ID NO.6; the nucleotide sequence of ca-gla-F is shown in SEQ ID NO.7; the nucleotide sequence of ca-gla-R is shown in SEQ ID NO.8; the nucleotide sequence of ca-gla-P is shown in SEQ ID NO.9; the nucleotide sequence of ca-par-F is shown in SEQ ID NO.10; the nucleotide sequence of ca-par-R is shown in SEQ ID NO.11; the nucleotide sequence of ca-par-P is shown in SEQ ID NO.12; the nucleotide sequence of ca-kru-F is shown in SEQ ID NO.13; the nucleotide sequence of ca-kru-R is shown in SEQ ID NO.14; the nucleotide sequence of ca-kru-P is shown in SEQ ID NO.15. As shown in NO.15, the 5' ends of ca-alb-P, ca-tro-P, ca-gla-P, ca-par-P and ca-kru-P are respectively labeled with fluorescent groups, and the 3' ends are respectively labeled with quenching groups.

[0012] Preferably, the primer-probe set further includes internal reference primers GF and GR and probe GP; the nucleotide sequence of GF is shown in SEQ ID NO.16; the nucleotide sequence of GR is shown in SEQ ID NO.17; the nucleotide sequence of GP is shown in SEQ ID NO.18; the 5' end of GP is labeled with a fluorescent group and the 3' end is labeled with a quencher group.

[0013] Preferably, the fluorescent group is selected from any one of FAM, ROX, Texas-Red, HEX, VIC, JOE, TET, CY5, Quasar705, CY5.5, ATTO425, and AF405; and the quenching group is selected from any one of BHQ1, BHQ2, BHQ3, and MGB.

[0014] The present invention also provides the application of the primer and probe set described above in the preparation of kits for detecting Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis and Candida krusei, or kits for detecting infectious diseases caused by Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis and Candida krusei.

[0015] This invention also provides a kit for detecting five Candida species using multiplex fluorescent PCR and / or multiplex quantitative digital PCR, including the primer and probe set and reaction solution described in the above technical solution.

[0016] Preferably, the reaction solution includes one or more of the following: hot-start Taq DNA polymerase, PCR buffer, MgCl2, dNTPs, and stabilizer.

[0017] Preferably, the kit further includes a positive control and a negative control; the positive control includes a cloning plasmid containing the nucleotide sequences of five Candida genes and an internal reference plasmid; the negative control includes an internal reference plasmid.

[0018] Preferably, the cloning plasmids containing the nucleotide sequences of the five Candida genes include a cloning plasmid containing the Candida albicans gene nucleotide sequence as shown in SEQ ID NO. 21, a cloning plasmid containing the Candida tropicalis gene nucleotide sequence as shown in SEQ ID NO. 24, a cloning plasmid containing the Candida glabrata gene nucleotide sequence as shown in SEQ ID NO. 27, a cloning plasmid containing the Candida subglabrata gene nucleotide sequence as shown in SEQ ID NO. 30, and a cloning plasmid containing the Candida krusei gene nucleotide sequence as shown in SEQ ID NO. 33; the internal reference plasmid contains the human housekeeper gene nucleotide sequence as shown in SEQ ID NO. 36.

[0019] Preferably, the sample to be tested includes sputum, vaginal secretions, or urine.

[0020] Preferably, when using multiplex fluorescent PCR to detect five Candida species, the concentrations of primers and probes are 0.25 μM; when using multiplex quantitative digital PCR to detect five Candida species, the concentrations of primers and probes are 0.2 μM.

[0021] This invention provides primer and probe sets for the detection of five Candida species using multiplex fluorescent PCR and / or multiplex quantitative digital PCR. The primer and probe sets contain specific primer pairs and corresponding probes targeting the five clinically common pathogenic Candida species. Based on this unified combination, this invention establishes two compatible detection pathways: simultaneous qualitative detection of the five targets can be achieved using multiplex fluorescent PCR, and absolute quantitative analysis of the five targets can be achieved using multiplex quantitative digital PCR; the two methods can be used in combination (achieving "qualitative typing + quantitative determination"), or implemented independently. Specifically, the primer and probe set described in this invention can specifically detect Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, and Candida krusei using fluorescent PCR and quantitative digital PCR. It exhibits high specificity: no cross-reactivity with common clinical fungi (such as Aspergillus fumigatus and Aspergillus flavus) and bacteria; high sensitivity: fluorescent PCR can detect even when the target gene concentration in the sample is 100 copies / mL, and digital PCR can detect nucleic acid templates as low as 0.3 copies / μL, making detection more accurate and sensitive; DNA can be directly extracted from clinical samples (sputum, vaginal secretions, or urine) for detection, with simple operation and short time consumption (approximately 2 hours); it can provide absolute and direct quantification of the nucleic acid concentration in the sample (quantitative digital PCR). This invention's detection process is simple and time-efficient, providing an efficient and reliable molecular detection solution for the early differential diagnosis and precise medication of invasive candidiasis in clinical practice, and offering a new technical method for further research on Candida. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 The images show the specific amplification results of the primers and probes provided by this invention; where Figure A shows the specific amplification results of Candida albicans, Candida tropicalis, and Candida glabrata, and Figure B shows the specific amplification results of Candida krusei and Candida glabrata. Figure 2 The following are the results of fluorescence PCR detection limits provided by the present invention: A is the result of fluorescence PCR detection limit of Candida albicans, B is the result of fluorescence PCR detection limit of Candida tropicalis, C is the result of fluorescence PCR detection limit of Candida glabrata, D is the result of fluorescence PCR detection limit of Candida krusei, and E is the result of fluorescence PCR detection limit of Candida spicata. Figure 3The images shown are of the fluorescent PCR detection results of sputum samples provided by the present invention; wherein, A is the fluorescent PCR detection result of Candida albicans sputum sample, B is the fluorescent PCR detection result of Candida tropicalis sputum sample, C is the fluorescent PCR detection result of Candida glabrata sputum sample, D is the fluorescent PCR detection result of Candida krusei sputum sample, and E is the fluorescent PCR detection result of Candida sphenopus sputum sample. Figure 4 The images shown are of the results of fluorescent PCR detection of vaginal secretion samples provided by this invention; wherein, A is the result of fluorescent PCR detection of Candida albicans vaginal secretion samples, B is the result of fluorescent PCR detection of Candida tropicalis vaginal secretion samples, C is the result of fluorescent PCR detection of Candida glabrata vaginal secretion samples, D is the result of fluorescent PCR detection of Candida krusei vaginal secretion samples, and E is the result of fluorescent PCR detection of Candida jubilee vaginal secretion samples. Figure 5 The images shown are of the results of fluorescent PCR detection of urine samples provided by the present invention; wherein, A is the result of fluorescent PCR detection of Candida albicans urine sample, B is the result of fluorescent PCR detection of Candida tropicalis urine sample, C is the result of fluorescent PCR detection of Candida glabrata urine sample, D is the result of fluorescent PCR detection of Candida krusei urine sample, and E is the result of fluorescent PCR detection of Candida sphenopanax. Figure 6 The following are the results of the quantitative digital PCR detection limit provided by the present invention: A is the quantitative digital PCR detection limit result for Candida albicans; B is the quantitative digital PCR detection limit result for Candida tropicalis; C is the quantitative digital PCR detection limit result for Candida glabrata; D is the quantitative digital PCR detection limit result for Candida subglabrata; and E is the quantitative digital PCR detection limit result for Candida krusei. Detailed Implementation

[0024] This invention provides primer and probe sets for the detection of five Candida species using multiplex fluorescent PCR and / or multiplex quantitative digital PCR, including primers ca-alb-F and ca-alb-R and probe ca-alb-P for detecting Candida albicans, primers ca-tro-F and ca-tro-R and probe ca-tro-P for detecting Candida tropicalis, primers ca-gla-F and ca-gla-R and probe ca-gla-P for detecting Candida glaciformis, primers ca-par-F and ca-par-R and probe ca-par-P for detecting Candida parapneumoniae, and primers ca-kru-F and ca-kru-R and probe ca-kru-P for detecting Candida krusei. The nucleotide sequence of ca-alb-F is shown in SEQ ID NO. 1; the nucleotide sequence of ca-alb-R is shown in SEQ ID NO. 2; the nucleotide sequence of ca-alb-P is shown in SEQ ID NO. 3; and the nucleotide sequence of ca-tro-F is shown in SEQ ID NO. 1. The nucleotide sequence of ca-tro-R is shown in SEQ ID NO.4; the nucleotide sequence of ca-tro-P is shown in SEQ ID NO.6; the nucleotide sequence of ca-gla-F is shown in SEQ ID NO.7; the nucleotide sequence of ca-gla-R is shown in SEQ ID NO.8; the nucleotide sequence of ca-gla-P is shown in SEQ ID NO.9; the nucleotide sequence of ca-par-F is shown in SEQ ID NO.10; the nucleotide sequence of ca-par-R is shown in SEQ ID NO.11; the nucleotide sequence of ca-par-P is shown in SEQ ID NO.12; the nucleotide sequence of ca-kru-F is shown in SEQ ID NO.13; the nucleotide sequence of ca-kru-R is shown in SEQ ID NO.14; the nucleotide sequence of ca-kru-P is shown in SEQ ID NO.15. As shown in NO. 15, the 5' ends of ca-alb-P, ca-tro-P, ca-gla-P, ca-par-P, and ca-kru-P are labeled with fluorescent groups, and the 3' ends are labeled with quenching groups. In a specific embodiment, the primer-probe set further includes internal reference primers GF and GR, and probe GP; the nucleotide sequence of GF is shown in SEQ ID NO. 16; the nucleotide sequence of GR is shown in SEQ ID NO. 17; the nucleotide sequence of GP is shown in SEQ ID NO. 18; the 5' end of GP is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.In specific embodiments, the fluorescent group includes any one selected from FAM, ROX, Texas-Red, HEX, VIC, JOE, TET, CY5, Quasar705, CY5.5, ATTO425, and AF405; the quenching group is selected from any one of BHQ1, BHQ2, BHQ3, and MGB. The primer-probe set of this invention can specifically detect Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, and Candida krusei, and shows no cross-reactivity with common clinical fungi (such as Aspergillus fumigatus and Aspergillus flavus) and bacteria, i.e., it has high specificity; fluorescent PCR can detect the target gene at a sample concentration of 100 copies / mL, and digital PCR can detect nucleic acid templates as low as 0.3 copies / μL, i.e., it has high sensitivity; DNA can be directly extracted from the sample for detection, and the operation is simple and time-saving (approximately 2 hours); it can provide absolute and direct quantification of the nucleic acid concentration of the sample (quantitative digital PCR).

[0025] The present invention also provides the application of the primer and probe set described above in the preparation of kits for detecting Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis and Candida krusei, or kits for detecting infectious diseases caused by Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis and Candida krusei.

[0026] This invention also provides a kit for detecting five Candida species using multiplex fluorescent PCR and / or multiplex quantitative digital PCR, comprising the primer and probe set and reaction solution described in the above-described technical solution. In a specific embodiment, the reaction solution comprises one or more of the following: hot-start Taq DNA polymerase, PCR buffer, MgCl2, dNTPs, and stabilizer. In a specific embodiment, when using multiplex fluorescent PCR to detect the five Candida species, the reaction solution is preferably the reaction solution purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., catalog number 16710ES80; when using multiplex quantitative digital PCR to detect the five Candida species, the reaction solution is preferably the reaction solution purchased from Hangzhou Dilan Biotechnology Co., Ltd., catalog number DL-D-001. The selected reaction solutions, namely Yisheng Biotechnology Reaction Solution (catalog number 16710ES80) and Dilan Biotechnology Reaction Solution (catalog number DL-D-001), effectively balance the competition between multiple primer and probe pairs in multiplex reactions, minimizing non-specific amplification and primer dimer formation, and maximizing the specificity and sensitivity of the system. Both preferred reaction solutions contain optimized stabilizers to protect the stability of primers, probes, and enzyme activity during storage and transportation. In a specific embodiment, the kit also includes a positive control and a negative control. In a specific embodiment, the positive control includes a cloning plasmid containing the nucleotide sequences of five Candida genes and an internal reference plasmid; the negative control includes an internal reference plasmid. In a specific embodiment, the cloning plasmids containing the nucleotide sequences of five Candida genes include a cloning plasmid containing the Candida albicans gene nucleotide sequence as shown in SEQ ID NO. 21, a cloning plasmid containing the Candida tropicalis gene nucleotide sequence as shown in SEQ ID NO. 24, a cloning plasmid containing the Candida glabrata gene nucleotide sequence as shown in SEQ ID NO. 27, a cloning plasmid containing the Candida subglabrata gene nucleotide sequence as shown in SEQ ID NO. 30, and a cloning plasmid containing the Candida krusei gene nucleotide sequence as shown in SEQ ID NO. 33; the internal reference plasmid contains the human housekeeper gene nucleotide sequence as shown in SEQ ID NO. 36. In a specific embodiment, the sample to be tested includes sputum, vaginal secretions, or urine. The kit is designed with specific primers and probes based on genomic DNA fragments of Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, and Candida krusei. The presence of specific PCR products is determined by detecting the intensity of the fluorescence signal and the shape of the amplification curve in fluorescent PCR. Alternatively, the formation and quantity of PCR products can be determined by the amplification signal in quantitative digital PCR. This kit allows for rapid identification of these five Candida species, thereby determining whether the sample contains the target DNA fragment and its quantity. This kit can be used for the rapid and efficient qualitative and quantitative detection of nucleic acid molecules from Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, and Candida krusei.In a specific embodiment, when using multiplex fluorescent PCR to detect five Candida species, the concentrations of primers and probes are 0.25 μM; when using multiplex quantitative digital PCR to detect five Candida species, the concentrations of primers and probes are 0.2 μM. Since the detection device used in this application has four fluorescent detection channels, and the five primer-probe sets do not interfere with each other, in this embodiment, the five primer-probe sets are divided into two parts and detected in two reaction tubes (fluorescent PCR) or two chips (quantitative digital PCR).

[0027] Based on the primer-probe set or kit of the present invention, the present invention performs multiplex fluorescent PCR and / or multiplex quantitative digital PCR detection on five Candida species. In a specific embodiment, the reaction system for the multiplex fluorescent PCR can be: 14 μL fluorescent PCR reaction solution, 5 μL primer-probe mixture, 6 μL sample or control, for a total volume of 25 μL; the reaction procedure can be as shown in Table 9. In a specific embodiment, the reaction system for the multiplex quantitative digital PCR detection can be: 0.5 μL digital PCR enzyme, 10 μL digital PCR buffer, 3 μL primer-probe mixture, 5 μL sample or control, and the remainder water, for a total volume of 30 μL; the reaction procedure can be as shown in Table 12. In a specific embodiment, the primer-probe mixture can be two or more types, specifically a mixture of 2 to 5 Candida primer-probe sets.

[0028] Terminology Explanation: 1. Nucleic acid detection: Detection methods and reagents that target deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) in a sample belong to nucleic acid detection. Nucleic acid detection methods are diverse, such as fluorescence polymerase chain reaction (PCR) using nucleic acid amplification technology, DNA microarrays using nucleic acid hybridization, and fluorescence in situ hybridization (FISH), etc.

[0029] 2. Fluorescent Polymerase Chain Reaction (Fluorescent PCR): Fluorescent PCR utilizes the restriction enzyme properties of Taq polymerase to cut fluorescently labeled probes during PCR primer amplification, causing the fluorescent labeled group to separate from the quenched group. The change in the released fluorescence energy directly reflects the change in the amount of PCR amplification product. The fluorescence signal variable is directly proportional to the amplification product variable. By collecting and analyzing the fluorescence light intensity, the original template can be qualitatively or quantitatively analyzed.

[0030] 3. Quantitative Digital PCR (dPCR): Quantitative digital PCR separates individual DNA molecules into individual reaction chambers and calculates the number of target DNA sequences in the sample using a Poisson distribution mathematical algorithm. It enables absolute and direct quantification of nucleic acid molecules and has extremely high detection sensitivity.

[0031] 4. Threshold Cycle Number (Ct value): In fluorescent PCR amplification, the number of cycles required for the fluorescence signal in the reaction tube to reach exponential amplification. The main calculation method uses 10 times the standard deviation of the fluorescence value in the first 3 to 15 cycles as the threshold. The number of cycles when the fluorescence value exceeds this threshold is the threshold cycle number, i.e., the Ct value. The Ct value is linearly negatively correlated with the logarithm of the initial amount of the target DNA fragment.

[0032] To further illustrate the present invention, the primer and probe sets and kits for the detection of five Candida species by multiplex fluorescent PCR and / or multiplex quantitative digital PCR provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0033] Example 1 Primer and probe screening (can be used for fluorescent PCR and quantitative digital PCR) 1. Primer and probe design Specific primers and probes for fluorescence and / or digital PCR detection were designed for the target gene sequences of Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, and Candida krusei. The primer and probe sequences are shown in Table 1 and were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0034] The 5' end of the fluorescent probe is labeled with a reporter fluorescent group, such as FAM, ROX, Texas-Red, HEX, VIC, JOE, TET, CY5, Quasar705, CY5.5, ATTO425, and AF405. The 3' end of the fluorescent probe is labeled with a quencher fluorescent group, such as BHQ1, BHQ2, BHQ3, and MGB. Specific labeling details are shown in Table 1.

[0035] Table 1 Primer and probe sequences for five Candida species and an internal reference.

[0036] Example 2 Preparation of plasmids (Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, Candida krusei, internal control) 1. Construction of cloning plasmids Genomic DNA was obtained from five Candida species. Using the genomic DNA as a template, PCR amplification was performed using the respective amplification primers for each Candida species, yielding positive DNA fragments. The PCR products were recovered and purified, then ligated into the ECoR I restriction site of the multiple cloning site in the plasmid vector (PUC-T). The transformed samples were then transformed into E. coli DH5α. The recombinant transformants were validated by first-generation sequencing. After culturing the recombinant transformants, plasmid nucleic acids were extracted in large quantities to prepare five different cloning plasmids. The primers were designed by this invention, and the plasmid construction was completed by Shanghai Sangon Biotech Co., Ltd.

[0037] 2. Primers for Candida plasmid amplification and the nucleotide sequence of the inserted DNA fragment: 2.1 Primers for Candida albicans amplification DL-A: 5'-CAGCTTGCTGTGATTACG-3' (SEQ ID NO. 19); DL-B: 5'-CATCACTGTACTTGTTCG-3' (SEQ ID NO. 20).

[0038] 2.2 Inserted DNA sequence of Candida albicans plasmid (1013 bp)

[0039] 2.3 Primers for the amplification of Candida tropicalis DL-C: 5'-TGGGAAATCTTGTGAAAC-3' (SEQ ID NO. 22); DL-D: 5'-TCTCATCGCACGGGATTC-3' (SEQ ID NO. 23).

[0040] 2.4 Inserted DNA sequence of Candida tropicalis plasmid (964 bp) (SEQ ID NO.24)。

[0041] 2.5 Primers for Candida glabrata amplification DL-E: 5'-CGCTCGGTCCCACATA-3' (SEQ ID NO. 25); DL-F: 5'-CGGAGCCAGCGAGTCTAA-3' (SEQ ID NO. 26).

[0042] 2.6 Inserted DNA sequence of Candida glabrata plasmid (978 bp) CGCTCGTGTCCCACATACTGATATGGCCTACAATTTCAAGTTAACTCAAAAACGAGTATCACTCACTACCAAACACAATGTGTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCATTGTTGAAAGTTTTGAAGTTGTTTTCTACTAAAAGAAATCTTGTGTTGACTGAATTAGTTTAAAAAAATATTTGTTTGTGTTTGCATCCACTGGGAGAACTCCCCCCCGAAAGAGAGCGTTCCCCCAACGAACAAAAGAATAGTAGTAAAGTAAACTCCACTGTGTGTAGTAATTAGAAAGTGTCGAGTCGTGTGATAAAACACCTCCTTTGGAATAGAGAGATCCACGCACACTCCCAGGTCTTTGTCGGCTCCCTCCCCCCACTGCAGAACACCCACCAACCGCGCACTTAAGCGCAGGCAGGAGAAATAGCATTCACAGCAGAGAAAATATTTTAGGAGCCTCCTGAGTGTCTACACTGGTCCTCCCCAGAGATGTCTCTCTCCGAGCTCAGACAAATCAATTAAATTTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTAGTTCCTCTAAATGACCAAGTTTGACCAGATTCTCCGCTCTGAAGTGGAGTCGCCCCCTCTTCTAAGCAGATCCTGAGGCCTCACTAAGCCATTCAATCGGTACTAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTAATCAACGCAAGCTGATGACTTGCGCTTACTAGGAATTCCTCGTTGAAGAGCAATAATTACAATGCTCTATCCCCAGCACGACGGAGTTTCACAAGATTACCAAGACCTCTCGGCCAAGGTTAGACTCGCTGGCTCCG(SEQID NO.27)。

[0043] 2.7 Primers for Candida glabrata amplification DL-G: 5'-AGGGGTAAATGCACCCT-3' (SEQ ID NO. 28); DL-H: 5'-GCGGATGTCGCATCCTCAT-3' (SEQ ID NO. 29).

[0044] 2.8 Inserted DNA sequence of Candida glabrata plasmid (264 bp) AGGGGTAAATGCACCCTTCAAACAGAAATTATTAATCAGACAGAACAATTTATGTCCTGTATGTCAAAGCACACTGACGGAATCCTCGGTAGGTTGAACGAATGTACTTCACATTCATCATATTAATCCTATTG CCAAAGGTGGTGCACGGAACAAATTGCACGAGAGTTTGTCGTCCCTGACAATGGGGGCTTATGAAGGATTCGATGCTCAAGGGGTGCAAAATTTGGCTAGAACGTATACCTATGAGGATGCGACATCCGC (SEQ ID NO.30).

[0045] 2.9g Candida amplification primers DL-I: 5'-CTTCGATCCCCTAACTTTCGTT-3' (SEQ ID NO. 31); DL-J: 5'-TCTTATGGCTGGAAGAGCGT-3' (SEQ ID NO. 32).

[0046] 2.10 g Candida albicans plasmid inserted DNA sequence (1289 bp)

[0047] 3. Construction process of internal reference plasmid Human genomic DNA was obtained, and using it as a template, PCR amplification was performed with primers NA and NB to obtain a human DNA fragment (GAPDH). This human DNA fragment was then ligated into the ECoR I restriction site of the multiple cloning site in the PUC-T vector to construct an internal reference positive plasmid. The primers were designed by this invention, and the plasmid construction was completed by Shanghai Sangon Biotech Co., Ltd.

[0048] Primer NA: 5'-GAATGGGCAGCCGTTAGGA-3' (SEQ ID NO.34); Primer NB: 5'-CTCAAAGGGCAGGAGTAAAGGTC-3' (SEQ ID NO.35).

[0049] Internal reference plasmid inserted DNA fragment sequence: (778 bp) GAATGGGCAGCCGTTAGGAAAGCCTGCCGGTGACTAACCCTGCGCTCCTGCCTCGATGGGTGGAGTCGCGTGTGGCGGGGAAGTCAGGTGGAGCGAGGCTAGCTGGCCCGATTTCTCCTCCGGGTGATGCTTTTCCTAGATTATTCTCTGGTAAATCAAAGAAGTGGGTTTATGGAGGTCCTCTTGTGTCCCCTCCCCGCAGAGGTGTGGTGGCTGTGGCATGGTGCCAAGCCGGGAGAAGCTGAGTCATGGGTAGTTGGAAAAGGACATTTCCACCGCAAAATGGCCCCTCTGGTGGTGGCCCCTTCCTGCAGCGCCGGCTCACCTCACGGCCCCGCCCTTCCCCTGCCAGCCTAGCGTTGACCCGACCCCAAAGGCCAGGCTGTAAATGTCACCGGGAGGATTGGGTGTCTGGGCGCCTCGGGGAACCTGCCCTTCTCCCCATTCCGTCTTCCGGAAACCAGATCTCCCACCGCACCCTGGTCTGAGGTTAAATATAGCTGCTGACCTTTCTGTAGCTGGGGGCCTGGGCTGGGGCTCTCTCCCATCCCTTCTCCCCACACACATGCACTTACCTGTGCTCCCACTCCTGATTTCTGGAAAAGAGCTAGGAAGGACAGGCAACTTGGCAAATCAAAGCCCTGGGACTAGGGGGTTAAAATACAGCTTCCCCTCTTCCCACCCGCCCCAGTCTCTGTCCCTTTTGTAGGAGGGACTTAGAGAAGGGGTGGGCTTGCCCTGTCCAGTTAATTTCTGACCTTTACTCCTGCCCTTTGAG (SEQ ID NO.36).

[0050] Example 3 Establishment of multiplex fluorescence PCR and quantitative digital PCR systems 1. Primer and probe screening Three sets of primers and probes were designed for *Candida albicans*, *Candida tropicalis*, *Candida glabrata*, *Candida parapsilosis*, and *Candida krusei*. Low concentrations of these fungi were detected using fluorescent PCR. The results are shown in Table 2. For *Candida albicans*, group 1 showed the best performance and highest sensitivity; primers and probes from group 3 were used as alternatives. For *Candida tropicalis*, group 3 showed the best performance and highest sensitivity; primers and probes from group 2 were used as alternatives. For *Candida glabrata*, group 3 showed the best performance and highest sensitivity; primers and probes from group 2 were used as alternatives. For *Candida glabrata*, group 3 showed the best performance and highest sensitivity; primers and probes from group 2 were used as alternatives. For *Candida parapsilosis*, group 1 showed the best performance and highest sensitivity. For *Candida krusei*, group 1 showed the best performance and highest sensitivity; primers and probes from group 3 were used as alternatives. Internal control group 1 showed the best performance and highest sensitivity.

[0051] Table 2. Primer and probe screening results

[0052] 2. Annealing temperature selection The five best-performing primer pairs were subjected to temperature gradient PCR amplification. The results showed that the optimal annealing temperature for the five primer pairs was between 59 and 61℃, and 60℃ was taken as the uniform annealing temperature.

[0053] 3. Establishment of a multiplex fluorescent PCR system 3.1 Screening of reaction solutions The reaction solutions contained hot-start Taq DNA polymerase, PCR buffer, MgCl2, dNTPs, stabilizers, and other commercially available products. Reaction solution 1 was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., product number 16710ES80; reaction solution 2 was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., product number 13891ES60; reaction solution 3 was purchased from Zhuhai Baorui Biotechnology Co., Ltd., product number M2071; and reaction solution 4 was purchased from Feipeng Biotechnology Co., Ltd., product number MDAD080.

[0054] Reaction system: The amount of reaction solution used should be in accordance with the instructions, and the amount of template used should be 6 μL.

[0055] Reaction procedure: Follow the instructions for each reaction solution, with the annealing temperature set to 60℃.

[0056] As shown in Table 3, the test results of the four reaction solutions were not significantly different, but reaction solution 1 had a higher Ct value and the best amplification curve. Therefore, reaction solution 1 was selected as the detection reaction solution for fluorescent PCR. The fluorescent channels labeled with probes for each bacterial species are shown in Table 3. The internal reference probe was labeled with the fluorescent group CY5 and the quencher group BHQ2.

[0057] Table 3. Detection results for different reaction solutions

[0058] 3.2 Selection of primer and probe concentration Primers and probes were tested at three concentrations (0.125 μM, 0.25 μM, and 0.275 μM). The results (CT values) of each concentration group were not significantly different (Table 4). However, the 0.25 μM group had the highest overall Ct values ​​for both primers and probes, indicating the best amplification efficiency. This concentration was used in subsequent tests.

[0059] Table 4. Ct values ​​for different primer and probe concentrations.

[0060] 4. Establishment of a quantitative digital PCR system 4.1 Screening of reaction solutions The reaction solutions contained hot-start Taq DNA polymerase, PCR buffer, MgCl2, dNTPs, stabilizers, and other commercially available products. Reaction solution 1 was purchased from Anhui Global Gene Technology Co., Ltd., catalog number KQMU3001; reaction solution 2 was purchased from Hangzhou Dilan Biotechnology Co., Ltd., catalog number DL-D-001; reaction solution 3 was purchased from Hangzhou Huakui Jinpei Biotechnology Co., Ltd., catalog number QCN121; and reaction solution 4 was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., catalog number 16710ES06.

[0061] Reaction system: The amount of reaction solution used should be in accordance with the instructions, and the amount of template used should be 5 μL.

[0062] Reaction procedure: Follow the instructions for each reaction solution, with the annealing temperature set to 60℃.

[0063] Table 5 shows the detection results of different reaction solutions for quantitative digital PCR. Considering both concentration and scatter plot, reaction solution 2 showed the best performance. Therefore, reaction solution 2 was selected as the detection reaction solution for quantitative digital PCR. The fluorescent channels labeled with probes for each bacterial species are shown in Table 5. The fluorescent group labeled with the internal reference probe is CY5, and the quencher group is BHQ2.

[0064] Table 5. Detection results for different reaction solutions

[0065] 4.2 Selection of primer and probe concentration The primers and probes were tested at three concentrations (0.1 μM, 0.2 μM, and 0.3 μM), and the concentration values ​​are shown in Table 6. The 0.2 μM primer and probe concentration was the most suitable.

[0066] Table 6. Sample quantification concentrations at different primer and probe concentrations

[0067] Example 4 Composition of kits for multiplex fluorescent PCR and quantitative digital PCR 1. Components of a multiplex fluorescent PCR kit (1) Primers and probes The primers consisted of upstream and downstream primers for the target gene and upstream and downstream primers for the internal reference gene. The concentration of the primer and fluorescently labeled probe detection mixture was 0.25 μM. The sequences of primers and probes for the five Candida species and the internal reference gene are shown in Table 1.

[0068] (2) Negative control The negative control plasmid contained only the human housekeeper gene fragment (internal reference plasmid), with a concentration of 10 ng / mL.

[0069] (3) Positive control Positive controls included cloning plasmids containing DNA sequences of five Candida genes and an internal reference plasmid. The final concentration of the five Candida plasmids was 20 ng / mL, and the final concentration of the internal reference plasmid was 10 ng / mL.

[0070] This invention designs five Candida positive plasmids and internal reference plasmids, each containing the target gene sequence amplified by the fluorescent PCR and quantitative digital PCR of this kit, and the sequence of the human housekeeping gene fragment.

[0071] (4) PCR reaction solution The reaction solution in the fluorescent PCR system screened in this invention is Hieff Unicon® UniversalTaqMan Pro U+ qPCR Mix (One Tube), containing dNTP / dUTP Mix, Mg 2+ Universal TaqManPolymerase, UDG, etc., were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., product number 16710ES80.

[0072] Table 7 Composition of the fluorescent PCR kit

[0073] 2. Components of a Quantitative Digital PCR Kit (1) Primers and probes The primer and probe sequences are identical to those for fluorescent PCR (see Table 1). The working concentrations of primers and probes in the digital PCR primer and probe detection mixture are both 0.2 μM.

[0074] (2) Negative control Same as the negative control for fluorescent PCR.

[0075] (3) Positive control Same as the positive control for fluorescent PCR.

[0076] (4) Quantitative digital PCR reaction solution (1) Digital PCR enzyme: Taq enzyme, provided by the digital PCR universal kit produced by Hangzhou Dilan Biotechnology Co., Ltd., containing UDG enzyme, catalog number: DL-D-001.

[0077] (2) Digital PCR buffer: 3×dPCR Buffer, provided by the Digital PCR Universal Kit produced by Hangzhou Dilan Biotechnology Co., Ltd., catalog number: DL-D-001.

[0078] (3) Nuclease-free water: produced by Hangzhou Dilan Biotechnology Co., Ltd., product number: HX22020.

[0079] Table 8 Composition of the Quantitative Digital PCR Kit

[0080] Example 5 Detection methods of multiplex fluorescent PCR and quantitative digital PCR 1. Detection method of multiplex fluorescent PCR Before using a multiplex fluorescent PCR kit for detection, DNA needs to be extracted from the sample to be tested. DNA extraction can be performed using a nucleic acid extraction or purification kit from Hangzhou Dilan Biotechnology Co., Ltd., catalog number DL-A-006.

[0081] 1.1 Preparation of PCR reaction tubes (reagent preparation area) (1) Determine the required number of reaction tubes n (number of samples + negative control + positive control). Prepare n tubes if the target is present in primer-probe mixture 1 and 2 respectively. Remove the primer-probe mixture and PCR reaction solution and thaw them on ice or at room temperature. All kit components need to be briefly centrifuged before use. Each reaction system is shown in Table 9: Table 9 Fluorescent PCR Reaction System

[0082] Calculate the amount of primer-probe mixture and PCR reaction solution (excluding sample / control) according to the number of reaction tubes n, add them to centrifuge tubes, mix thoroughly, centrifuge briefly, and then aliquot 19 μL into each PCR reaction tube.

[0083] 1.2 Sample addition (sample processing area or sample addition area) Add 6 μL of the DNA of the sample to be tested, or the negative control or positive control sample to the prepared PCR reaction tube, tighten the cap, centrifuge briefly, and transfer to the sample detection area.

[0084] 1.3 PCR amplification and fluorescence detection (sample detection area) Place the prepared reaction tubes in a fluorescence PCR instrument and perform the amplification reaction and detection according to the edited sample information under the following conditions (Table 10): Table 10 Fluorescent PCR Amplification Reaction Procedure

[0085] 1.4 Setting of Results Analysis Conditions (1) When analyzing the amplification plot results, the plot type / amplification plot algorithm can generally be set as: Rn vs Cycle (ABI 7500) or fluorescence absolute value method (Hongshi fluorescence PCR instrument).

[0086] (2) Baseline setting: The analysis software of the fluorescence PCR instrument can automatically set the baseline, usually from cycle number 2 to the 3 cycles before the first amplification curve.

[0087] (3) Threshold setting: The analysis software of the fluorescence PCR instrument can automatically set the threshold line or set it manually. Usually, the threshold line is set at the part of the exponential growth phase of the amplification curve above the baseline. The point where the amplification curve intersects with the threshold line is the Ct value, which represents the variable value of the reporter group fluorescence intensity (Rn, The Normalized Intensity of the Reporter) before and after amplification. The Ct value is linearly negatively correlated with the logarithmic amount of the target DNA fragment at the beginning of the reaction.

[0088] 1.5 Quality Control Standards The negative and positive controls for this kit must simultaneously meet the following conditions; otherwise, the experiment is considered invalid and needs to be repeated: Negative control: Target gene Ct value > 38 or "Undetermined", while internal reference Ct value < 45.

[0089] Positive control: Target gene Ct value ≤ 38, and internal reference Ct value < 45.

[0090] 5.1.6 Reading Experimental Results According to the instruction manual of the analysis software that comes with the fluorescence PCR instrument, first set the baseline and threshold (it is recommended to select automatic for both baseline and threshold settings), then click Analyse in the software. The system will automatically generate the results, observe the Ct value of the amplification curve for each sample, and download it to an Excel file.

[0091] The instrument's software was used for automatic analysis to obtain the Ct values ​​for each sample, and the results were determined according to Table 11.

[0092] Table 11 Method for Determining Ct Value Results

[0093] In the presence of high concentrations of the target gene, its amplification may result in a negative internal reference test result.

[0094] 2. Detection method of multiplex quantitative digital PCR Before using a multiplex digital PCR kit for testing, DNA needs to be extracted from the sample to be tested. The DNA extraction can be performed using a nucleic acid extraction or purification kit (catalog number: DL-A-006) produced by Hangzhou Dilan Biotechnology Co., Ltd.

[0095] The droplet preparation instrument, PCR amplification instrument, and chip reader described in this patent are all products of Shanghai Little Turtle Technology Co., Ltd., the BioDigital digital PCR system "Qing" series, which includes three instruments: 1) a fully automated sample processing system (Xiangzhu Medical Equipment Registration No. 20210021), model Loader Z200; 2) a PCR amplification instrument (Xiang Medical Equipment Registration No. 20212220277), model Cycler Z200; 3) a biochip reader (Xiang Medical Equipment Registration No. 20212220236), model Imager Z200.

[0096] 2.1 Preparation of Quantitative Digital PCR Reaction Tubes (Reagent Preparation Area) (1) Determine the required number of reaction tubes n (number of samples + negative control + positive control). Prepare n tubes if the target is present in primer-probe mixture 1 and 2 respectively. Remove sterile purified water (provided by the user) and other components from the kit, and thaw them on ice or at room temperature. All kit components need to be briefly centrifuged before use. Each reaction system is shown in Table 12: Table 12 Quantitative Digital PCR Reaction System

[0097] Calculate the amounts of digital PCR enzyme, digital PCR buffer, corresponding primer-probe detection mixture, and sterile water according to the number of reaction tubes n, add them to centrifuge tubes, mix thoroughly, centrifuge briefly, and then dispense 25 μL into each PCR reaction tube.

[0098] 2.2 Sample addition (sample processing area or sample addition area) Add 5 μL of the DNA sample to be tested, or the negative control or positive control sample, to the prepared PCR reaction tubes. After sealing the tubes with a membrane, centrifuge briefly and transfer them to the corresponding positions on the Little Turtle fully automated microdroplet preparation instrument. Open the sealing membrane and add oil A and oil B in a 2:1 ratio to the corresponding positions on the oil tank plate (2+1 mL can prepare 24 chips). After placing the consumables (chips, pipette tips, waste boxes, etc.), start the droplet preparation process in the instrument.

[0099] 2.3 Digital PCR Amplification Place the prepared reaction chip in the PCR amplification instrument and perform the amplification reaction according to the edited sample information under the following conditions (Table 13): Table 13 Digital PCR Amplification Reaction Procedure

[0100] 2.4 Chip Reading Transfer the amplified chip to a chip reader for reading. Select the FAM, HEX, ROX, and CY5 channels according to actual needs, choose the Direct Quantification (DQ) mode, and set the dilution factor to 6 (total volume of the detection system / sample volume in the reaction solution). After setting the sample name, start reading.

[0101] 2.5 Quality Control Standards The negative and positive controls for this kit must simultaneously meet the following conditions; otherwise, the experiment is considered invalid and needs to be repeated: In a one-dimensional scatter plot, the positive control is clearly divided into two layers, with few or no discrete droplets in the middle (a "rainfall" phenomenon). The negative control consists of only one layer, and its lower layer is roughly the same as that of the positive control, with less than one positive droplet.

[0102] Negative control: The number of positive droplets in the negative control is <1, and the internal reference quantitative concentration is >1000 copies / μL.

[0103] Positive control: The quantitative concentration of the positive control is >1000 copies / μL, and the quantitative concentration of the internal reference is >1000 copies / μL.

[0104] 2.6 Data Analysis Open the read chip data using the Little Turtle Biochip Analysis Software. In the threshold line mode of the one-dimensional scatter plot, adjust the threshold lines for the positive and negative controls to be in the same position, ensuring a clear distinction between positive and negative results for the positive control, and that all points in the negative control are negative. Adjust the threshold line for the detection group to the same position as the positive and negative control lines, ensuring that the threshold line is located in a clearly defined blank area. If the threshold line can only be adjusted to fit a large number of discrete droplets, or if the distinction between positive and negative droplets is not clear, it is recommended to investigate sample loading issues and repeat the experiment to obtain results with a clear distinction between positive and negative results, thus ensuring the accuracy of the quantitative data.

[0105] After adjusting the threshold, the "Results List" displays the detection results of the chip. The method for determining the results is shown in Table 14.

[0106] Table 14 Methods for Interpreting Quantitative Digital PCR Results

[0107] Example 6 Performance evaluation of multiplex fluorescent PCR and quantitative digital PCR kits 1. Performance evaluation of the multiplex fluorescent PCR kit 1.1 Amplification efficiency The dose-response curves of positive reference standards for Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, and Candida krusei in this invention's kit are shown in Table 15. As can be seen from the results, the results for the five targets conform to linearity (R²). 2 The amplification efficiency was greater than 85% (>0.998), indicating high efficiency.

[0108] Table 15 Detection results for different template concentrations

[0109] 1.2 Detection Limit Positive reference: Plasmids of different copy numbers (1000 copies / mL, 100 copies / mL) were extracted using a nucleic acid extraction kit from Hangzhou Dilan Biotechnology Co., Ltd. and then tested. Five replicates were set up for each concentration.

[0110] Using the kit from Example 4 of this invention, and following the method from Example 5, five Candida positive reference samples were detected. As shown in Table 16, all targets could be successfully amplified at a concentration of 100 copies / mL, demonstrating high amplification sensitivity. Figure 2 ).

[0111] Table 16 Results of Detection Limit Experiment

[0112] 1.3 Model Equivalence Using the kit from Example 4 of this invention, and following the method described in Example 5, the PCR was performed on the company's existing ABI 7500 fluorescence PCR instrument and Hongshi SLAN-96P fluorescence PCR instrument. The results show that the ABI 7500 fluorescence PCR instrument and the Hongshi SLAN-96P fluorescence PCR instrument yielded equivalent results.

[0113] 1.4 Repeatability (Precision) 10 samples each of Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, and Candida krusei were tested. 7 copies / mL, 10 5 Two positive mixed plasmids at two concentrations of copies / mL were tested 20 times for each concentration (4 batches, 5 tests per batch, and the coefficient of variation (CV) of Ct values ​​for each target was calculated. The results are shown in Table 17. The CV value of each target is ≤5%.

[0114] Table 17 Repeatability Tests

[0115]

[0116] 1.5 Specificity Test Streptococcus pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Staphylococcus aureus, Staphylococcus epidermidis, Klebsiella pneumoniae, Enterococcus faecalis, Escherichia coli, Proteus mirabilis, Aspergillus versicolor, Aspergillus terreus, Aspergillus niger, Aspergillus flavus, Aspergillus fumigatus, Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, Candida krusei, Pichia pastoris, and human genomic DNA were detected. As shown in Table 18, the designed primers exhibited good specificity, generating signals only against the target Candida species and showing no cross-reactivity with common human and clinical bacteria and fungi. Figure 1 Information on the sources of the strains used for cross-reaction is shown in Table 19.

[0117] Table 18 Primer and probe specificity results

[0118] Table 19 Information on the source of strains

[0119] 1.6 Clinical Real Sample Testing 1.6.1 Sputum Samples Using the kit from Example 4 of this invention, and following the method from Example 5, nucleic acid was detected in 11 sputum samples. The results showed that *Candida albicans* was detected in 7 cases, *Candida tropicalis* in 2 cases, *Candida glabrata* in 2 cases, *Candida parapsilosis* in 1 case, and *Candida krusei* in 3 cases (Table 20). Figure 3The results show that the method of the present invention can accurately and sensitively detect Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, and Candida krusei. The total number of detected samples is higher than the number of sample cases because some samples contain mixed species.

[0120] Table 20 Results of sputum sample detection by fluorescent PCR

[0121] 1.6.2 Vaginal secretion samples Using the kit from Example 4 of this invention, and following the method from Example 5, nucleic acid was detected in 46 vaginal secretion samples. The results showed that 45 samples contained Candida albicans, 2 samples contained Candida tropicalis, 16 samples contained Candida glabrata, 0 samples contained Candida parapsilosis, and 6 samples contained Candida krusei (Table 21). Figure 4 The results show that the method of this invention can accurately and sensitively detect Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, and Candida krusei, without interference between them. The total number of detected samples is higher than the number of sample cases because some samples contained mixed bacterial species.

[0122] Table 21 Results of fluorescent PCR detection in vaginal secretion samples

[0123]

[0124] 1.6.3 Urine Samples Using the kit from Example 4 of this invention, and following the method from Example 5, nucleic acid was detected in 40 urine samples. The results showed that 12 samples contained *Candida albicans*, 25 samples contained *Candida tropicalis*, 0 samples contained *Candida glabrata*, 1 sample contained *Candida subglabrata*, and 1 sample contained *Candida krusei* (Table 22). Figure 5 The results show that the method of the present invention can accurately and sensitively detect Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, and Candida krusei, without interference between them.

[0125] Table 22 Results of urine sample detection by fluorescent PCR

[0126]

[0127] 1.7 Anti-interference test Three sputum samples showing weak positive results for Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, and Candida krusei were collected. One sample had bovine serum albumin (BSA) added to achieve a final BSA concentration of 0.05 ng / mL; one sample had fluconazole added to achieve a final fluconazole concentration of 0.001 mg / mL; and one sample had no added substances. Nucleic acid extraction or purification was performed using a nucleic acid extraction or purification kit (catalog number: DL-A-006) manufactured by Hangzhou Dilan Biotechnology Co., Ltd. The samples were then tested using a nucleic acid detection kit for Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, and Candida krusei (multiplex fluorescence PCR method). Each test was repeated three times. The results are shown in Table 23, and all results were positive. This indicates that the kit of the present invention has anti-interference capabilities and can detect weakly positive samples without being affected by the presence of 0.05 ng / mL BSA and 0.05 ng / mL fluconazole. Table 23 Interference Substance Testing

[0128] 2. Performance evaluation of the multiplex quantitative digital PCR kit 2.1 Precision The plasmids at the following two concentrations were tested, with 10 replicate tests for each concentration: 1.0E+06 copies / mL and 1.0E+05 copies / mL. The mean and standard deviation of the test results (concentration values) were calculated for each concentration, and the CV value was then calculated. The requirement was that the CV value ≤ 10% for both the high and low concentrations. The results are shown in Table 24. The precision CV values ​​for the two concentrations of *Candida albicans* (FAM) were 3.4% and 4.9%, respectively; for *Candida tropicalis* (ROX) they were 4.5% and 4.7%, respectively; for *Candida glabrata* (HEX) they were 4.3% and 4.7%, respectively; for *Candida parapsilosis* (CY5) they were 4.9% and 5.7%, respectively; and for *Candida krusei* (ROX) they were 2.9% and 8.9%, respectively, meeting the precision requirements.

[0129] Table 24 Precision Test Results

[0130]

[0131]

[0132] 2.2 Accuracy The plasmid was tested at four different concentrations, with 10 replicates per concentration: high (3.0E+06 copies / mL), medium (3.0E+05 copies / mL), low (3.0E+04 copies / mL), and very low (3.0E+03 copies / mL). The deviation between the logarithmic value of the test result and the logarithmic value of the theoretical concentration was calculated for each concentration, and the deviation was required to be less than or equal to ±0.45 log values. The results are shown in Table 25. The deviations between the logarithmic value of the test result and the logarithmic value of the theoretical concentration were all within ±0.45 log values, meeting the accuracy verification requirements.

[0133] Table 25 Accuracy Test Results

[0134]

[0135]

[0136]

[0137]

[0138] 6.2.3 Linear Range The standard plasmid was serially diluted 5-fold to test six concentrations (copies / mL): 1.50E+07, 3.00E+06, 6.00E+05, 1.20E+05, 2.40E+04, and 4.80E+03. Each concentration was tested three times. The logarithmic correlation coefficient between the theoretical and measured average concentrations was calculated, and R0 was required. 2 >0.980. The results are shown in Tables 26 and 27, with R values ​​for each channel. 2 >0.980.

[0139] Table 26 Experimental data on linear range

[0140]

[0141]

[0142] Table 27 Statistical table of regression analysis of the logarithmic values ​​of the mean theoretical concentration and the mean measured concentration for each channel.

[0143] 2.4 Detection Limit The plasmids at the following two concentrations were tested, with five replicates for each concentration: the limit of detection (LOD) was 0.9 copies / µL and an even lower concentration of 0.3 copies / µL. A positive result was considered positive if the number of positive samples was ≥1. The results are shown in Table 28. The LOD was 0.3 copies / µL. Figure 6 ).

[0144] Table 28 Detection Limit Experimental Data

[0145]

[0146] 2.5 Real Sample Detection Using the kit from Example 4 of this invention and following the method from Example 5, nucleic acid was detected in 11 samples. The results showed that *Candida albicans* was detected in 7 cases, *Candida tropicalis* in 2 cases, *Candida glabrata* in 2 cases, *Candida parapsilosis* in 1 case, and *Candida krusei* in 3 cases (Table 29). The results demonstrate that the method of this invention can accurately and sensitively detect *Candida albicans*, *Candida tropicalis*, *Candida glabrata*, *Candida parapsilosis*, and *Candida krusei*. Digital PCR detection can accurately and stably determine the concentration of target genes. The total number of positive bacteria detected was higher than the number of samples because some samples contained mixed bacterial species.

[0147] Table 29 Sample Detection Results of Digital PCR

[0148] In summary, this invention yielded five primer and probe sets capable of qualitative and quantitative detection of *Candida albicans*, *Candida tropicalis*, *Candida glabrata*, *Candida parapsilosis*, and *Candida krusei*. Furthermore, two detection methods based on fluorescence / digital PCR technology were established, enabling qualitative identification and absolute direct quantification of genes in samples (without the need for a standard curve). The minimum sample concentration for fluorescence PCR detection is 100 copies / mL; the limit of detection for nucleic acids in quantitative digital PCR is 0.3 copies / µL, providing more accurate, sensitive, and quantitative detection. This invention can not only be used for the typing, qualitative, and quantitative detection of five *Candida* species in three clinical sample types (sputum, vaginal secretions, and urine), but also effectively shortens the detection time, providing a new technical method for clinical detection of fungal infections and further research on *Candida*.

[0149] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer and probe set for the detection of five Candida species by multiplex fluorescent PCR and / or multiplex quantitative digital PCR, characterized in that, The invention includes primers ca-alb-F and ca-alb-R and probe ca-alb-P for detecting Candida albicans; primers ca-tro-F and ca-tro-R and probe ca-tro-P for detecting Candida tropicalis; primers ca-gla-F and ca-gla-R and probe ca-gla-P for detecting Candida glaciformis; primers ca-par-F and ca-par-R and probe ca-par-P for detecting Candida parapneumoniae; and primers ca-kru-F and ca-kru-R and probe ca-kru-P for detecting Candida krusei. The nucleotide sequence of ca-alb-F is shown in SEQ ID NO.1; the nucleotide sequence of ca-alb-R is shown in SEQ ID NO.2; the nucleotide sequence of ca-alb-P is shown in SEQ ID NO.3; the nucleotide sequence of ca-tro-F is shown in SEQ ID NO.4; the nucleotide sequence of ca-tro-R is shown in SEQ ID NO.5; and the nucleotide sequence of ca-tro-P is shown in SEQ ID NO.

6. As shown in NO.6; the nucleotide sequence of ca-gla-F is shown in SEQ ID NO.7; the nucleotide sequence of ca-gla-R is shown in SEQ ID NO.8; the nucleotide sequence of ca-gla-P is shown in SEQ ID NO.9; the nucleotide sequence of ca-par-F is shown in SEQ ID NO.10; the nucleotide sequence of ca-par-R is shown in SEQ ID NO.11; the nucleotide sequence of ca-par-P is shown in SEQ ID NO.12; the nucleotide sequence of ca-kru-F is shown in SEQ ID NO.13; the nucleotide sequence of ca-kru-R is shown in SEQ ID NO.14; the nucleotide sequence of ca-kru-P is shown in SEQ ID NO.15; the 5' end of ca-alb-P, ca-tro-P, ca-gla-P, ca-par-P and ca-kru-P are respectively labeled with fluorescent groups, and the 3' end is respectively labeled with quenching groups.

2. The primer-probe set according to claim 1, characterized in that, The primer-probe set further includes internal reference primers GF and GR and probe GP; the nucleotide sequence of GF is shown in SEQ ID NO.16; the nucleotide sequence of GR is shown in SEQ ID NO.17; the nucleotide sequence of GP is shown in SEQ ID NO.18; the 5' end of GP is labeled with a fluorescent group and the 3' end is labeled with a quencher group.

3. The primer-probe set according to claim 1 or 2, characterized in that, The fluorescent group is selected from any one of FAM, ROX, Texas-Red, HEX, VIC, JOE, TET, CY5, Quasar705, CY5.5, ATTO425, and AF405; the quenching group is selected from any one of BHQ1, BHQ2, BHQ3, and MGB.

4. The use of the primer and probe set according to any one of claims 1 to 3 in the preparation of kits for detecting Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis and Candida krusei, or kits for detecting infectious diseases caused by Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis and Candida krusei.

5. A kit for detecting five Candida species using multiplex fluorescent PCR and / or multiplex quantitative digital PCR, characterized in that, It includes the primer and probe set and reaction solution as described in any one of claims 1 to 3.

6. The reagent kit according to claim 5, characterized in that, The reaction solution includes one or more of the following: hot-start Taq DNA polymerase, PCR buffer, MgCl2, dNTPs, and stabilizers.

7. The reagent kit according to claim 5, characterized in that, The kit also includes a positive control and a negative control; the positive control includes a cloning plasmid containing the nucleotide sequences of five Candida genes and an internal reference plasmid; the negative control includes an internal reference plasmid.

8. The reagent kit according to claim 7, characterized in that, The cloning plasmids containing the nucleotide sequences of five Candida genes include a cloning plasmid containing the Candida albicans gene nucleotide sequence as shown in SEQ ID NO.21, a cloning plasmid containing the Candida tropicalis gene nucleotide sequence as shown in SEQ ID NO.24, a cloning plasmid containing the Candida glabrata gene nucleotide sequence as shown in SEQ ID NO.27, a cloning plasmid containing the Candida subglabrata gene nucleotide sequence as shown in SEQ ID NO.30, and a cloning plasmid containing the Candida krusei gene nucleotide sequence as shown in SEQ ID NO.33; the internal reference plasmid contains the human housekeeper gene nucleotide sequence as shown in SEQ ID NO.

36.

9. The reagent kit according to claim 5, characterized in that, The samples to be tested include sputum, vaginal secretions, or urine.

10. The reagent kit according to claim 5, characterized in that, When using multiplex fluorescent PCR to detect five Candida species, the concentrations of primers and probes were 0.25 μM; when using multiplex quantitative digital PCR to detect five Candida species, the concentrations of primers and probes were 0.2 μM.

Images