Cotton fiber length KASP molecular marker and application

Abstract

The invention discloses a cotton fiber length KASP molecular marker and application, and relates to the technical field of cotton molecular breeding, a specific KASP primer group is designed according to a site sequence, nucleotide sequences of the specific KASP primer group are respectively shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, a genome molecular marker with polymorphism is screened from segregation population offspring, and the molecular marker is used for detecting cotton fiber length. And a single cotton plant can be subjected to genetic typing at the functional site. When the genotype is G: G, the single plant is indicated to have relatively long fiber length potential; the method can accurately track and locate a target gene and efficiently screen the fiber length character, is high in typing accuracy, low in cost and simple and convenient to operate, can be used for auxiliary selection of the fiber length character in early generation of cotton breeding, and further can be used for molecular design breeding.

Description

Technical Field

[0001] This invention relates to the field of cotton molecular breeding technology, specifically to a KASP molecular marker for cotton fiber length and its application. Background Technology

[0002] Cotton is an important economic crop, and its fiber quality is crucial to the development of the textile industry and downstream industries. Fiber length is one of the important indicators for measuring cotton quality and determines its commercial value. However, cotton fiber length is a typical quantitative trait, controlled by polygenic inheritance. Traditional breeding methods for improving fiber quality suffer from problems such as long cycles, low phenotypic selection efficiency, and difficulty in co-selecting high-yield and high-quality traits.

[0003] Combining molecular marker technology with traditional breeding techniques to improve crop traits can eliminate the influence of gene interactions and environment on phenotypic selection, accelerate the breeding process, and significantly improve selection efficiency, making it an important means of modern breeding. Therefore, screening molecular markers associated with target traits, identifying key genes controlling target traits, and understanding the effectiveness of molecular marker breeding selection are of great significance for transitioning from traditional "empirical breeding" to targeted and efficient "design breeding," improving target traits, and accelerating the development of superior varieties.

[0004] KASP technology is a simple gel-free fluorescent polymerase chain reaction that can meet the requirements of low, medium, and high throughput genotyping with the aid of ordinary laboratory procedures. It is suitable for experimental designs with large variations in target loci and sample numbers. DNA is extracted from young leaves of the sample during the seedling or budding stage. Using pre-designed KASP primers, the genotyping results are obtained by reading the KASP marker fluorescence colorimetric pattern using a quantitative real-time PCR instrument.

[0005] In recent years, among numerous molecular marker technologies, the KASP genotyping technology (competitive allele-specific PCR) based on high-throughput single nucleotide polymorphisms (SNPs) has been widely used in crop-assisted breeding due to its low cost, high flexibility, and high accuracy. In crops such as rice, wheat, and maize, converting gene variant sites related to important traits such as adaptability, yield, quality, and stress resistance into KASP markers has significantly improved the selection efficiency for target traits.

[0006] In the study of cotton fiber length, a large number of SNPs that are significantly associated with fiber length have been identified using methods such as genome-wide association analysis. However, these developed markers still face some limitations in practical breeding applications: many genetic markers are far from the target genes that truly control traits, and their application value depends on their degree of linkage with genes. Even if some markers are initially closely linked to target genes, they will decay during multiple cycles of genetic recombination, leading to a decrease in the accuracy of fiber length trait selection and thus reducing the application value of the markers.

[0007] In summary, although some studies have reported loci related to cotton fiber length, the regulatory mechanism of fiber length is complex. Therefore, developing KASP molecular markers related to cotton fiber length can provide more options and support for breeding cotton varieties with different fiber lengths. Summary of the Invention

[0008] To address the problems that existing identified SNPs significantly associated with fiber length are far removed from the functional genes that truly control the trait, and that their application value is highly dependent on the linkage strength of the genes; even if some markers are initially closely linked to genes, linkage decay may occur during multiple generations of genetic recombination, leading to a decrease in their predictive accuracy and limiting their practical value, this invention provides a KASP molecular marker for cotton fiber length and its application.

[0009] This invention is achieved using the following techniques: Previous studies have revealed a non-synonymous SNP (G / T) variant at position D11_24001762 in the coding region of the calmodulin-like gene CML1, corresponding to an amino acid variation from aspartic acid to glutamic acid. Materials carrying the GG genotype exhibited longer fibers. The G site at the functional marker D11_24001762 is a superior allelic variant that positively promotes fiber elongation.

[0010] This invention provides a KASP molecular marker for cotton fiber length, with the SNP site located in the 23.99~24.01 Mb region of chromosome D11 of upland cotton. The SNP site is located at the 24001762nd position on chromosome D11 of upland cotton, and the allele is G or T. The primer sequences for the molecular markers are as follows: Forward primer F1 has the following nucleotide sequence as shown in SEQ ID NO.1: GAAGGTGACCAAGTTCATGCTCATCTTTGTTGGTGTCGAATTTG; Forward primer F2, its nucleotide sequence is shown in SEQ ID NO.2: GAAGGTCGGAGTCAACGGATTCATCTTTGTTGGTGTCGAATTTT; The reverse universal primer R has the following nucleotide sequence as shown in SEQ ID NO.3: TGTGGAAGAAATGAAATGGGTG.

[0011] Furthermore, in the long-fiber homozygous line, the genotype of the molecular marker site was G:G, corresponding to primer SEQ ID NO.1; in the short-fiber homozygous line, the genotype of the molecular marker site was T:T, corresponding to primer SEQ ID NO.2; and in the fiber length heterozygous segregating line, the genotype of the molecular marker site was G:T.

[0012] This invention provides a method for genotyping cotton fiber length using the KASP molecular marker, comprising the following steps: S1. Extract genomic DNA from cotton offspring. Specifically, take one unopened young leaf from each cotton plant and place it in a 1.5 ml centrifuge tube. Add 600 μl of pre-cooled, freshly prepared extraction buffer for extraction.

[0013] S2, PCR was performed on the extracted genomic DNA using the primer sequences shown in SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3. The PCR reaction system was 5 µL, containing 1.25 µL of primer mixture, 1.25 µL of DNA sample, and 2.5 µL of KASP reaction mixture. The PCR reaction conditions were as follows: activation at 95 °C for 10 min, 1 cycle; denaturation at 95 °C for 20 s, 10 cycles; annealing and extension at 61-55 °C for 60 s, 10 cycles; denaturation at 95 °C for 20 s, 27 cycles; annealing and extension at 55 °C for 60 s, 27 cycles.

[0014] S3, detect the fluorescence signal, and determine the genotype of the D11 chromosome 24001762 locus based on the fluorescence signal; wherein, when the genotype is G:G, it indicates that the locus carried by the cotton plant is the long fiber type.

[0015] This invention provides an application of the KASP molecular marker for cotton fiber length. The KASP molecular marker is used for the identification of superior haplotypes and candidate genes for cotton fiber length. If the offspring single plant detection is G:G, it indicates that the locus carried by the single plant is of the long fiber type; if the offspring single plant detection is T:T, it indicates that the locus carried by the single plant is of the short fiber type; if the offspring single plant detection is G:T, it indicates that the locus carried by the single plant is of the heterozygous type.

[0016] This invention provides an application of the KASP molecular marker for cotton fiber length in marker-assisted breeding of cotton.

[0017] This invention provides a KASP molecular marker for cotton fiber length, which can be used to screen individual plants with excellent fiber length traits in the early generations of cotton breeding.

[0018] This invention provides a kit for identifying cotton fiber length, the kit containing KASP molecular marker primer sequences as follows: Forward primer F1 has the following nucleotide sequence as shown in SEQ ID NO.1: GAAGGTGACCAAGTTCATGCTCATCTTTGTTGGTGTCGAATTTG; Forward primer F2, its nucleotide sequence is shown in SEQ ID NO.2: GAAGGTCGGAGTCAACGGATTCATCTTTGTTGGTGTCGAATTTT; The reverse universal primer R has the following nucleotide sequence as shown in SEQ ID NO.3: TGTGGAAGAAATGAAATGGGTG.

[0019] Compared with the prior art, the present invention has the following beneficial effects: This invention presents a KASP molecular marker for cotton fiber length, based on genetic analysis of a major fiber length locus on chromosome D11 of upland cotton. It selects SNP polymorphism allelic variations in a key region closely linked to the fiber length trait on chromosome D11, and designs KASP primers based on the sequence information of the candidate gene CML1 in the genome. SNP microarray detection, phenotypic identification, and genotyping verification are then performed on individual plants from the segregating cotton population. This provides a reliable basis for accelerating fiber quality improvement and marker-assisted breeding.

[0020] The fiber length KASP marker gene CML1 developed in this invention is located within the D11_23834947~D11_24047565 fragment. During genetic segregation, it undergoes exchange and segregation as a whole fragment, with no internal variation, exhibiting a significant genetic effect. The validated genotyping accuracy is high, making it an ideal KASP molecular marker for fiber length. It can directly track key genes controlling fiber length, showing a strong association with the target trait and extremely high predictive accuracy. This solves the problem of reduced accuracy in fiber length trait selection due to linkage decay during multi-cycle genetic recombination. KASP markers enable large-scale, high-throughput detection, facilitating early selection of corresponding traits by breeders in early generations. This reduces heavy fieldwork and subjective bias in selection, significantly lowers experimental costs, and allows for early batch detection. It can determine the homozygosity or heterozygosity of breeding materials at fiber length marker sites, allowing for the continued planting and identification of offspring for heterozygous haplotypes, and further identification and screening of homozygous haplotypes for upgrading lines or varieties. When applied to molecular marker-assisted breeding of cotton fiber quality, it helps improve accuracy and breeding efficiency, and accelerates the breeding process. Attached Figure Description

[0021] Figure 1 Fluorescence chromogenic pattern for KASP labeling detection. Detailed Implementation

[0022] The specific embodiments of the present invention will now be described in detail with reference to the accompanying drawings.

[0023] A KASP molecular marker utilizing cotton fiber length was obtained through the following method: In the early stages, a genome-wide association analysis (GWAS) was performed on fiber length in 306 natural upland cotton accessions using a 40K SNP (single-nucleotide polymorphism) microarray. QTL mapping was also performed on fiber length in 195 upland cotton recombinant inbred lines (RILs). Comprehensive analysis revealed an overlapping region closely associated with fiber length in the 23.99–24.01 Mb region of chromosome D11, with polymorphic allelic variations at six associated SNP loci. Germplasm carrying the Hap1 (AGAGCT) haplotype showed significantly longer or extremely longer fiber lengths than that carrying the Hap2 (GTGATC) haplotype. Through a search and comparison using the cotton functional genomics database, four protein-coding functional genes were identified in this region. Among them, a non-synonymous SNP (G / T) variant was found at position D11_24001762 in the coding region of the calmodulin-like gene CML1, corresponding to an amino acid variation from aspartic acid to glutamic acid. Materials carrying the GG genotype exhibited longer fibers. Therefore, the G site at the functional marker D11_24001762 is a superior allelic variant and has a positive promoting effect on fiber elongation.

[0024] Based on this (1) Construction of segregated groups Using Xinluzao 61, a popular early-maturing cotton variety in Xinjiang, as the female parent and H4R, an insect-resistant and high-yielding cotton line from the Yellow River cotton-growing region, as the male parent, a hybrid combination was constructed. Through comparative experiments in the F1 generation, heterozygous single plants were selected from the F2 generation, based on alleles at key fiber length marker loci (D11_23991504~D11_24019910), to construct segregating F2 and F3 populations.

[0025] (2) Fiber length detection method During the peak boll opening period of cotton, the bolls that have opened normally from each individual plant in the population are harvested, dried, and ginned for seed testing. 10-15 g of fiber samples are weighed and the fiber length is tested by the Cotton Quality Inspection and Testing Center of the Ministry of Agriculture and Rural Affairs using an HVI (High Volume Instrument) large-capacity cotton fiber tester.

[0026] (3) KASP marker genotyping method Genomic DNA was extracted from the cotton offspring. In this embodiment, the modified CTAB method was used for extraction. One unopened young leaf from each plant was placed in a 1.5 ml centrifuge tube, and 600 μl of pre-cooled, freshly prepared extraction buffer was added for extraction.

[0027] Based on the excellent cotton fiber length haplotypes and candidate genes obtained from previous analyses, using upland cotton TM-1 as the reference genome, relevant information and CDS sequences of the genes within the marker fragment were obtained through the cotton functional genomics database website (http: / / cottonfgd.org / ). KASP molecular marker primers were designed using the CML1 gene base sequence D11_24001762 SNP site, which has no mutations within a 50bp range upstream and downstream of the gene coding region.

[0028] Table 1. KASP primers developed based on the cotton CML1 gene base sequence site.

[0029] The two forward primers have universal fluorescent tags added to their 5' ends: F1 (FAM): AAGGTGACCAAGTTCATGCT and F2 (VIC): GAAGGTCGGAGTCAACGGATT. The 3' ends of the primers contain two allelic variants, G and T, for the detection site.

[0030] The primer mixture was prepared in a ratio of upstream genotyping primer F1: downstream genotyping primer F2: downstream universal primer = 1:1:3.

[0031] The PCR reaction volume was 5 µL, containing 1.25 µL of primer mixture, 1.25 µL of DNA sample, and 2.5 µL of KASP reaction mixture. The PCR reaction conditions were: 95 °C activation for 10 min, 1 cycle; 95 °C denaturation for 20 s, 10 cycles; 61–55 °C annealing and extension for 60 s, 10 cycles; 95 °C denaturation for 20 s, 27 cycles; 55 °C annealing and extension for 60 s, 27 cycles.

[0032] After the reaction, the fluorescence signal was detected using a quantitative PCR instrument manufactured by Hangzhou BIOER, FQD-96A. Figure 1 As shown: red signal points represent homozygous allele 1 (GG) linked to the FAX fluorescent tag sequence, blue signal points represent homozygous allele 2 (TT) linked to the VIC fluorescent tag sequence, green signal points represent heterozygous genotype 3 (GT), and black square signal points represent negative controls (NTC).

[0033] Result Validation

[0034] DNA samples were extracted from 24 cotton monoplants whose haplotypes were identified through microarray analysis. Genotyping verification was performed using the designed KASP markers. The results were as follows: 9 Hap1 monoplants were genotyped G:G, with an average fiber length of 30.01 mm; 9 Hap2 monoplants were genotyped T:T, with an average fiber length of 29.12 mm; and 6 Hap3 monoplants were genotyped G:T. The genotyping results of the 24 monoplants using the KASP marker sites were consistent with the microarray analysis results, achieving 100% accuracy. This indicates that the KASP markers used in this experiment can replace SNP haplotypes for verifying fiber length-related loci.

[0035] Based on this, the following year, KASP marker testing was conducted on 725 progeny plants. The genotyping results showed 179 plants were G:G, 226 were T:T, and 320 were G:T. Fiber quality testing revealed that the 122 G:G plants had an average length of 27.19 mm, and the 177 T:T plants had an average length of 26.62 mm. This corroborated the previous year's results, indicating that G:G plants exhibit longer fibers, making this a reliable and effective method for selecting fiber length traits in early breeding.

[0036] The scope of protection claimed by this invention is not limited to the specific embodiments described above. Moreover, for those skilled in the art, this invention can have various modifications and alterations. Any modifications, improvements, and equivalent substitutions made within the concept and principles of this invention should be included within the scope of protection of this invention.

Claims

1. A KASP molecular marker for cotton fiber length, characterized in that, The SNP locus is located in the 23.99-24.01 Mb region of chromosome D11 of upland cotton, specifically at the 24001762nd position on chromosome D11, with alleles of G or T. The primer sequences for the molecular markers are as follows: Forward primer F1 has the following nucleotide sequence as shown in SEQ ID NO.1: GAAGGTGACCAAGTTCATGCTCATCTTTGTTGGTGTCGAATTTG; Forward primer F2, its nucleotide sequence is shown in SEQ ID NO.2: GAAGGTCGGAGTCAACGGATTCATCTTTGTTGGTGTCGAATTTT; The reverse universal primer R has the following nucleotide sequence as shown in SEQ ID NO.3: TGTGGAAGAAATGAAATGGGTG.

2. The cotton fiber length KASP molecular marker according to claim 1, characterized in that, In the long-fiber homozygous line, the genotype at the molecular marker site was G:G, corresponding to primer SEQ ID NO.1; in the short-fiber homozygous line, the genotype at the molecular marker site was T:T, corresponding to primer SEQ ID NO.

2. In the fiber length heterozygous segregating lines, the genotype at the molecular marker site was G:T.

3. A method for genotyping cotton fiber length using the KASP molecular marker for cotton fiber length as described in claim 1, characterized in that, Includes the following steps: S1, Extract genomic DNA from the cotton offspring; S2, PCR reaction was performed on the extracted genomic DNA using the primer sequences shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3; S3, detect the fluorescence signal, and determine the genotype of the D11 chromosome 24001762 locus based on the fluorescence signal; wherein, when the genotype is G:G, it indicates that the locus carried by the cotton plant is the long fiber type.

4. The method for genotyping cotton fiber length using KASP molecular markers according to claim 3, characterized in that, In step S2, the PCR reaction conditions are as follows: activation at 95℃ for 10 min, 1 cycle; denaturation at 95℃ for 20 s, 10 cycles; annealing and extension at 61-55℃ for 60 s, 10 cycles; denaturation at 95℃ for 20 s, 27 cycles; annealing and extension at 55℃ for 60 s, 27 cycles.

5. The application of the KASP molecular marker for cotton fiber length according to any one of claims 1 or 2, characterized in that, The KASP molecular marker was used to identify superior haplotypes and candidate genes for cotton fiber length. If the offspring single plant was detected as G:G, it indicates that the locus carried by the single plant is of the long fiber type; if the offspring single plant was detected as T:T, it indicates that the locus carried by the single plant is of the short fiber type; if the offspring single plant was detected as G:T, it indicates that the locus carried by the single plant is of the heterozygous type.

6. The application of the KASP molecular marker for cotton fiber length according to any one of claims 1 or 2, characterized in that, It is applied to molecular marker-assisted breeding of cotton.

7. The application of the KASP molecular marker for cotton fiber length according to any one of claims 1 or 2, characterized in that, It is used in the early generations of cotton breeding to screen individual plants with excellent fiber length traits.

8. A reagent kit for determining the length of cotton fibers, characterized in that, The kit contains the following KASP molecular marker primer sequence: Forward primer F1 has the following nucleotide sequence as shown in SEQ ID NO.1: GAAGGTGACCAAGTTCATGCTCATCTTTGTTGGTGTCGAATTTG; Forward primer F2, its nucleotide sequence is shown in SEQ ID NO.2: GAAGGTCGGAGTCAACGGATTCATCTTTGTTGGTGTCGAATTTT; The reverse universal primer R has the following nucleotide sequence as shown in SEQ ID NO.3: TGTGGAAGAAATGAAATGGGTG.

Images