KASP molecular marker of wheat drought-enduring gene TaFAH47 and application of KASP molecular marker

By developing the KASP molecular marker for the wheat drought-resistant gene TaFAH47, and using PCR amplification and fluorescence detection, the problem of unclear molecular mechanisms of drought resistance in the wheat FAH gene family was solved, enabling rapid identification of wheat drought resistance and improving breeding efficiency and drought resistance.

CN121472474AActive Publication Date: 2026-02-06CROP INST SICHUAN PROVINCE ACAD OF AGRI SCI
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202610020364.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-08
Publication Date
2026-02-06
Estimated Expiration
2046-01-08

AI Technical Summary

Technical Problem

Current technologies lack a clear understanding of the molecular mechanisms of drought resistance mediated by the wheat FAH gene family, which affects the improvement of wheat drought resistance and yield stability.

Method used

We developed a KASP molecular marker for the wheat drought-resistant gene TaFAH47, and identified polymorphic sites in the TaFAH47 gene using a specific primer set through PCR amplification and fluorescence detection, thereby assessing the drought resistance of wheat.

Benefits of technology

This method enables rapid and accurate identification of wheat drought resistance, improves breeding efficiency, selects plants with excellent drought resistance traits, and enhances wheat drought resistance and growth stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121472474A_ABST
    Figure CN121472474A_ABST
Patent Text Reader

Abstract

The invention discloses a KASP molecular marker of a wheat drought-enduring gene TaFAH47 and application, relates to the technical field of gene engineering, and aims to screen a key gene TaFAH47 responding to drought stress based on a Chinese spring wheat whole genome identification technology and transcriptome expression data analysis. The RT-qPCR technology verifies that the expression of the gene is related to the drought tolerance of wheat. Bioinformatics comparative analysis and sequencing verification prove that the gene promoter has natural variation of a C / T basic group. By detecting the polymorphism of the SNP site, whether the wheat has excellent drought tolerance or not can be accurately and quickly identified, and the marker aiming at the site has the advantages of good genetic stability, high resolution, suitability for high-throughput detection application and the like.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, and particularly relates to a KASP molecular marker of a wheat drought-resistant gene TaFAH47 and application. BACKGROUND

[0002] Common wheat (Triticum aestivum L.) is one of the most important food crops in the world. Under the background of rapid global climate change, rising temperatures and water shortages have intensified drought stress, which seriously restricts the growth and development of wheat and the realization of high yield and stable yield. Therefore, it is still a pressing and key challenge in current breeding work to explore wheat drought-resistant genetic resources and breed drought-resistant varieties suitable for water-deficient environments.

[0003] It has been reported that wheat can enhance its drought resistance through multiple pathways. For example, the TaPPR13 gene, which encodes a pentatricopeptide repeat protein, improves drought resistance by regulating the expression of photosynthesis and stress response genes. TaPYL9, as an ABA receptor, regulates stress response genes through the ABA hormone signaling pathway, thereby improving physiological and biochemical processes related to drought and enhancing the drought resistance of wheat. In addition, the MYB transcription factor family member TaMYB7-A1 cooperatively regulates aquaporins, stomatal size, and root development to improve water use efficiency and enhance the drought resistance of wheat. Recent studies have shown that the fatty acid hydroxylase (FAH) gene family (including members such as fatty acid hydroxylase, carotenoid hydroxylase, and sterol desaturase) is also involved in the response of wheat to drought stress. Members of this family play different roles through different mechanisms: fatty acid hydroxylase is involved in the adjustment of fatty acid composition during drought, which helps to maintain cell membrane integrity; carotenoid hydroxylase confers drought and oxidative stress resistance to plants by affecting photosynthesis and ABA synthesis; sterol desaturase is also related to abiotic stress resistance. In addition, FAH genes have been confirmed to significantly affect abiotic stress tolerance in other species such as cotton, Arabidopsis, rice, and tea. Therefore, systematic analysis of the FAH gene family is of great value in revealing its function, especially the role of key enzymes in drought resistance.

[0004] However, the molecular mechanisms of wheat FAH gene family members in mediating drought resistance are still unclear. In-depth exploration of the molecular network of this family of genes in response to drought not only helps to enrich the knowledge of wheat drought-resistant gene resources and functions, but also provides potential gene targets and molecular markers for drought-resistant molecular breeding, which is of great significance for improving the drought resistance and yield stability of wheat. SUMMARY

[0005] In view of the above deficiencies of the prior art, the present application provides a KASP molecular marker of a wheat drought-resistant gene TaFAH47 and application. TaFAH47 The present application has the advantages that the KASP molecular marker of the wheat drought-resistant gene TaFAH47 provided by the present application is simple in operation, low in cost, and high in accuracy, and can be used for marker-assisted selection of wheat drought-resistant genes TaFAH47.

[0006] To achieve the above-mentioned purposes, the technical scheme adopted by the present application is: A wheat drought-resistant gene is provided TaFAH47 , characterized in that the wheat drought-resistant gene TaFAH47 is located on the short arm of the 4D chromosome of wheat and is located at the position of 69127088~69129717Mbp of the wheat genome.

[0007] The present application also provides a KASP molecular marker of the wheat drought-resistant gene TaFAH47 , and the wheat drought-resistant gene TaFAH47 is located on the short arm of the 4D chromosome of wheat and is located at the position of 69127088~69129717Mbp of the wheat Chinese Spring genome, the molecular marker is located at 69126089bp, and the polymorphism is C / T.

[0008] Further, the first upper primer has the sequence shown in SEQ ID NO. 1: GCTAGTTAAGCTTAAATGACC, the second upper primer has the sequence shown in SEQ ID NO. 2: GCTAGTTAAGCTTAAATGACT, and the lower primer has the sequence shown in SEQ ID NO. 3: TTGCCGTGTCATTTTAGCTC.

[0009] Further, different fluorescent modification groups are respectively connected to the 5' end or 3' end of the first upper primer and the second upper primer.

[0010] The present application also provides a detection reagent or kit containing the primer set.

[0011] The present application also provides a method for identifying the drought resistance of wheat, which comprises: using the DNA of a wheat sample to be tested as a template, using the KASP primer set or the detection reagent or kit to perform PCR amplification, and judging the drought resistance of the wheat sample to be tested according to the amplification result.

[0012] Further, the system used for PCR amplification includes: 5µL Master Mix, 0.4µL first upper primer, 0.4µL second upper primer, 0.8µL lower primer, 1µL (100ng / µL) template DNA, and the rest is water, with a total system of 10µL.

[0013] Further, the reaction program used for PCR amplification is: 95℃ pre-denaturation for 2min; 95℃ denaturation for 15s; 60℃ annealing for 15s; 72℃ extension for 30s, 40 cycles.

[0014] Further, judging the drought tolerance of the plant sample to be tested according to the amplification result comprises: analyzing the genotype of the polymorphic site contained in the molecular marker in the amplification product, and the wheat with the genotype of TT has better drought tolerance compared with the genotype of CC.

[0015] The application further provides any one of the following applications of the above molecular marker, the above KASP primer combination or the above detection reagent or kit: (1) used for identifying, selecting and improving the drought tolerance of wheat; (2) used for early prediction of the drought tolerance trait of wheat; (3) used for molecular marker-assisted breeding of wheat.

[0016] The application has the following beneficial effects: The application screens a key gene responding to drought stress based on the whole genome identification technology and transcriptome expression data analysis of Chinese Spring wheat TaFAH47 , and verifies that the expression of the gene is related to the drought tolerance of wheat by RT-qPCR technology. It is confirmed by bioinformatics alignment analysis and sequencing verification that there is a natural variation of C / T base in the promoter of the gene. The polymorphism of the SNP site can be detected to accurately and quickly identify whether the wheat has excellent drought tolerance, and the marker for the site has the advantages of good genetic stability, high resolution, suitable for high-throughput detection application and the like.

[0017] The SNP site provided by the application can be used to detect the excellent haplotype of the drought tolerance gene on the 4D chromosome of wheat, quickly screen plants with excellent sites, and then facilitate the molecular assisted breeding of drought tolerance wheat. The molecular marker KASP-0936 provided by the application is closely linked to the drought tolerance gene on the 4D of wheat TaFAH47 , and can be used for positioning the drought tolerance trait of wheat, so as to screen plants with strong drought tolerance in the breeding process, improve the work efficiency of breeding, and provide a basis for the research of wheat drought tolerance gene. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 It is a plant characterization diagram of three treatment methods in Example 1; Figure 2 It is a gene expression comparison diagram of plants obtained by three treatment methods in Example 1; Figure 3 It is the structure and sequence information of the gene TaFAH47 and the SNP sequencing verification result in Chinese Spring and Jimai 22 in Example 2; Figure 4 It is the fluorescence reading value result of the molecular marker KASP-0936 detection of 84 breeding parents in Example 2; Figure 5The results show the comparative characterization of drought resistance of different plant types in Example 2; Figure 6 This is a comparison diagram of the rootstock and seedling lengths of different subtypes of plants in Example 2. Detailed Implementation

[0019] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0020] The wheat germplasm resources used in the embodiments of this invention all come from the wheat heterosis project of the Crop Research Institute of Sichuan Academy of Agricultural Sciences (Sichuan Germplasm Resource Center). Unless otherwise specified in the embodiments, the technical means used are conventional methods well known to those skilled in the art, and the raw materials used are all commercially available products.

[0021] Example 1 Wheat TaFAH47 Gene identification and verification A total of 116 FAH gene family members were identified using wheat whole-genome identification technology. Transcriptome data analysis of these 116 FAH gene family members was then used to screen for key genes exhibiting the strongest drought resistance response. TaFAH47 .

[0022] Germination of *Prunus cerasifera* plants was carried out, and plants with similar growth were selected and divided into three groups of nine plants each. These groups were treated with normal watering (CK), drought, and PEG6000 (a drought-simulating reagent), respectively. Two weeks later, the plant morphology was as follows: Figure 1 As shown, by Figure 1 It can be seen that plants watered normally are healthy and growing normally: leaves are upright and unfolded, bright green, and the plant shape is full, without any signs of wilting or yellowing. Plants treated with drought, however, show severe stress damage, with leaves drooping and curling significantly, some leaves losing their green color and turning yellow, and the overall plant shape becoming limp and wilted, with the most significant growth inhibition. Plants treated with PEG6000 to simulate drought also showed stress responses, but the degree differed from "actual drought." Although the leaves drooped and wilted, they retained relatively more green, and the degree of limpness was slightly less than in the actual drought group.

[0023] RNA was extracted from leaves from the same part of the plant, with three biological replicates for each treatment.

[0024] The RNA extraction method is as follows: A1 : Take 80 mg of leaf tissue in a 2 mL centrifuge tube, add sterilized steel beads, grind the leaf tissue into powder on a bead beater, quickly add 1 mL lysis buffer, and mix well with a vortexer.

[0025] A2: Add 200 mL of chloroform, vortex for 20 s, and stand for 3 min. After centrifugation at 12000 rpm for 10 min at 4°C, transfer the supernatant to a new sterilized EP tube, and add 0.5 times the volume of anhydrous ethanol. Transfer the mixture to an adsorption column, and centrifuge at 12000 rpm for 1 min at 4°C, and discard the filtrate.

[0026] A3: Add 500 μL of deproteinization solution to the adsorption column, centrifuge at 12000 rpm for 1 min at 4°C, and discard the filtrate. A4: Add 500 μL of rinse solution to the adsorption column, stand for 2 min, centrifuge at 12000 rpm for 1 min at 4°C, discard the filtrate, and repeat once.

[0027] A5: Centrifuge at 12000 rpm for 2 min at 4°C to remove residual liquid. Transfer the adsorption column to a new sterilized 1.5 mL centrifuge tube, add 50 μL of RNase-Free ddH2O, stand for 2 min at room temperature, and centrifuge at 12000 rpm for 2 min at 4°C. Repeat once to obtain the RNA sample.

[0028] Reverse transcription is performed on the RNA sample as follows: B1 : Take 3 μL of the RNA sample, add 2 μL of gDNA Buffer, 1 μL of gDNA enzyme, and 4 μL of RNase-Free ddH2O, mix well, and perform 42°C reaction for 2 min and 4°C reaction for 1 min in a PCR instrument.

[0029] B2: Add 6 μL of reverse transcriptase premix and 4 μL of RNase-Free ddH2O to the above 10 μL liquid, mix well, and perform 37°C reaction for 15 min, 85°C treatment for 5 s, and 4°C reaction for 1 min in a PCR instrument to obtain the reverse-transcribed cDNA sample. The cDNA sample was subjected to RT-qPCR verification, and the specific steps were as follows: 1 μL of the reverse-transcribed cDNA sample was taken into a fluorescence quantification special PCR, 10 μL of SYBR MasterMix, 1 μL of the upper primer, the sequence of the upper primer was GATAATGGCGCAACTGACAG, 1 μL of the lower primer, the sequence of the lower primer was CAGCGTGGTAACATGGCATG, 7 μL of RNase-Free ddH2O, and the reaction was carried out in a fluorescence quantification PCR instrument. The program was as follows: 95°C pre-denaturation for 2 min; 95°C denaturation for 15 s; 60°C annealing for 15 s; 72°C extension for 30 s, 40 cycles. The results are shown in Figure 2 It can be seen from Figure 2 that the expression level of the gene was significantly increased after drought treatment and PEG6000 treatment, which proved TaFAH47 that the gene was induced by drought stress. TaFAH47

[0030] Example 2 Development of KASP molecular markers for drought tolerance of wheat Chinese Spring (CS) and Jimai 22 (JM22) TaFAH47 The promoter and CDS sequences of the gene were aligned, and the results are shown in Figure 3 It can be seen from Figure 3 that there is a natural variation of C / T base at the position of -999 bp of the promoter (that is, 69126089 bp of the Chinese Spring reference genome IWGSC RefSeq v1.1), and it is found by sequencing that the site really exists.

[0031] The DNA of the 84 parent breeding lines / planting strains was extracted by the CTAB method.

[0032] ​The DNA sample is subjected to a primer group of a first upper primer as shown in SEQ ID NO. 1, a second upper primer as shown in SEQ ID NO. 2 and a lower primer as shown in SEQ ID NO. 3, and the 5' end of the first upper primer is connected with a FAM fluorescent modification group, and the 5' end of the second upper primer is connected with a HAX fluorescent modification group; PCR amplification is carried out by using the following system: 5 μL Master Mix, 0.4 μL first upper primer (the sequence is shown in SEQ ID NO. 1), 0.4 μL second upper primer (the sequence is shown in SEQ ID NO. 2), 0.8 μL lower primer (the sequence is shown in SEQ ID NO. 3), 1 μL (100 ng / μL) template DNA, and the rest is water; the PCR amplification program is: 95°C pre-denaturation for 2 min; 95°C denaturation for 15 s; 60°C annealing for 15 s; 72°C extension for 30 s, 40 cycles. In specific implementation, the 5' end of the first upper primer can be connected with a HAX fluorescent modification group, and the 5' end of the second upper primer can be connected with a FAM fluorescent modification group; or the fluorescent modification group can be connected at the 3' end of the first / second upper primer.

[0033] The instrument detects the fluorescence signal, and the genotyping of 84 breeding lines / planting strains is as shown in Figure 4 . Figure 4 The blank control is represented by black color, and the detection samples are divided into homozygous CC genotype (blue color), homozygous TT genotype (orange yellow color) and heterozygous CT genotype (green color) according to different genotypes.

[0034] The TT-typed and CC-typed plants are selected respectively and treated by PEG6000, and a normal watering control group is set respectively; after 7 days of culture at 25°C with 16 h of illumination and 8 h of darkness, the plant phenotypes are as shown in Figure 5 , wherein, Figure 5 a is the drought simulation result of the CC-typed plant; Figure 5 b is the drought simulation result of the TT-typed plant; and Figure 5 It can be known from a in that the growth of the root stem and seedling of the CC-typed plant is obviously inhibited compared with the control group, the overall plant type is soft and wilted, and the curling degree is high; and the growth of the root stem and seedling of the TT-typed plant is slightly inhibited compared with the control group, and there is no obvious difference in the curling degree.

[0035] The seedling length and root stem length of the two types of plants are measured and counted respectively, and the results are as shown in Figure 6 , wherein, Figure 6 a is the comparison diagram of the root stem length of the plant, Figure 6 b is the comparison diagram of the seedling length of the plant; and Figure 6It was found that the length of root and seedling of TT and CC plants were inhibited after PEG6000 treatment, but the inhibition of TT plants was lower than that of CC plants. It was proved that TT plants had better drought tolerance than CC plants.

Claims

1. A wheat drought-resistant gene TaFAH47 Its characteristics are, The wheat drought-resistant gene TaFAH47 Located on the short arm of wheat chromosome 4D, at position 69127088~69129717 Mbp in the wheat genome.

2. A wheat drought-resistant gene TaFAH47 The KASP molecular marker, characterized by, The wheat drought-resistant gene TaFAH47 Located on the short arm of wheat chromosome 4D, at positions 69127088~69129717 Mbp in the wheat Chinese Spring genome, the molecular marker is located at 69126089 bp and has a polymorphism of C / T.

3. A KASP primer set for detecting the KASP molecular marker as shown in claim 2, characterized in that, It includes a first upper primer with the sequence shown in SEQ ID NO.1: GCTAGTAAGCTTAAATGACC; a second upper primer with the sequence shown in SEQ ID NO.2: GCTAGTAAGCTTAAATGACT; and a lower primer with the sequence shown in SEQ ID NO.3: TTGCCGTGTCATTTTAGCTC.

4. The KASP primer set according to claim 3, characterized in that, The 5' or 3' ends of the first and second upper primers are respectively connected to different fluorescent modifying groups.

5. A detection reagent or kit containing the primer set as described in claim 3.

6. A method for identifying the drought resistance of wheat, characterized in that, include: Using the DNA of the wheat sample to be tested as a template, PCR amplification is performed using the KASP primer set described in claim 3 or the detection reagent or kit described in claim 5, and the drought resistance of the wheat sample to be tested is determined based on the amplification results.

7. The method for identifying the drought resistance of wheat according to claim 6, characterized in that, The total volume of the PCR amplification system is 10 μL. The system consists of: 5 µL Master Mix, 0.4 µL first upper primer, 0.4 µL second upper primer, 0.8 µL lower primer, 1 µL template DNA at a concentration of 100 ng / µL, and the remainder is water.

8. The method for identifying the drought resistance of wheat according to claim 7, characterized in that, The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 15 s; 60℃ annealing for 15 s; 72℃ extension for 30 s, for 40 cycles.

9. The method for identifying the drought resistance of wheat according to any one of claims 6 to 8, characterized in that, Determining the drought resistance of the plant sample to be tested based on the amplification results includes: analyzing the genotypes of the polymorphic sites contained in the molecular markers in the amplification products; wheat with genotype TT has better drought resistance than wheat with genotype CC.

10. Any of the following applications of the molecular marker of claim 2, the KASP primer combination of claim 3, or the detection reagent or kit of claim 5: (1) Used for the identification, selection and improvement of wheat drought resistance; (2) Used for early prediction of drought resistance traits in wheat; (3) Used for molecular marker-assisted breeding of wheat.

Citation Information

Patent Citations

  • HapDR related to identification of drought tolerance in corn seedling stage and application of HapDR

    CN115948591A

  • Identification of total root tip number QTL (Quantitative Trait Loci) of root system in seedling stage under drought stress of wheat and linked KASP marker of QTL

    CN118531158A

  • Molecular marker closely linked with major QTL-qSHL-3B of coleoptile length under wheat drought stress and application of molecular marker

    CN119162376A

  • Molecular marker closely linked with heat-resistance-related wheat grain weight major QTL (Quantitative Trait Loci) and application of molecular marker

    CN119776568A

  • KASP molecular marker closely linked with wheat drought resistance related gene TaRPL36-8, primer and application

    CN120505448A