KASP molecular marker of wheat drought tolerance gene taFAH47 and application thereof

By developing the KASP molecular marker for the wheat drought-resistant gene TaFAH47, and utilizing PCR amplification and fluorescence detection, the problem of unclear molecular mechanisms of drought resistance in the wheat FAH gene family was solved, enabling rapid identification of wheat drought resistance and improving breeding efficiency and drought resistance.

CN121472474BActive Publication Date: 2026-04-10CROP INST SICHUAN PROVINCE ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-01-08
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Current technologies lack a clear understanding of the molecular mechanisms of drought resistance mediated by the wheat FAH gene family, which affects the improvement of wheat drought resistance and yield stability.

Method used

A KASP molecular marker for the wheat drought-resistance gene TaFAH47 was developed. By using PCR amplification and fluorescence detection, specific primer sets were used to identify the SNP sites of the TaFAH47 gene and to identify the drought resistance of wheat.

Benefits of technology

This method enables rapid and accurate identification of wheat drought resistance, improves breeding efficiency, screens plants with excellent drought resistance traits, and enhances wheat drought resistance and yield stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121472474B_ABST
    Figure CN121472474B_ABST
Patent Text Reader

Abstract

The application discloses a KASP molecular marker of a wheat drought-resistant gene TaFAH47 and application, relates to the technical field of genetic engineering, and the application is screened to a key gene TaFAH47 responding to drought stress based on Chinese spring wheat whole genome identification technology and transcriptome expression data analysis.The expression of the gene is verified to be related to wheat drought resistance by RT-qPCR technology.Based on bioinformatics alignment analysis and sequencing verification, it is confirmed that the gene promoter has a natural variation of C / T base.Through detecting the polymorphism of the SNP site, whether the wheat has the optimal drought-resistant capacity can be accurately and quickly identified, and the marker aiming at the site has the advantages of good genetic stability, high resolution, and being suitable for high-throughput detection application.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, and particularly relates to a KASP molecular marker of a wheat drought-resistant gene TaFAH47 and application. BACKGROUND

[0002] Common wheat (Triticum aestivum L.) is one of the most important food crops in the world. Under the background of rapid global climate change, rising temperatures and water shortages have intensified drought stress, which seriously restricts the growth and development of wheat and the realization of high yield and stable yield. Therefore, it is still a pressing and key challenge in current breeding work to explore wheat drought-resistant genetic resources and breed drought-resistant varieties suitable for water-deficient environments.

[0003] It has been reported that wheat can enhance its drought resistance through multiple pathways. For example, the TaPPR13 gene, which encodes a pentatricopeptide repeat protein, improves drought resistance by regulating the expression of photosynthesis and stress response genes. TaPYL9, as an ABA receptor, regulates stress response genes through the ABA hormone signaling pathway, thereby improving physiological and biochemical processes related to drought and enhancing the drought resistance of wheat. In addition, the MYB transcription factor family member TaMYB7-A1 cooperatively regulates aquaporins, stomatal size, and root development to improve water use efficiency and enhance the drought resistance of wheat. Recent studies have shown that the fatty acid hydroxylase (FAH) gene family (including members such as fatty acid hydroxylase, carotenoid hydroxylase, and sterol desaturase) is also involved in the response of wheat to drought stress. Members of this family play different roles through different mechanisms: fatty acid hydroxylase is involved in the adjustment of fatty acid composition during drought, which helps to maintain cell membrane integrity; carotenoid hydroxylase confers drought and oxidative stress resistance to plants by affecting photosynthesis and ABA synthesis; sterol desaturase is also related to abiotic stress resistance. In addition, FAH genes have been confirmed to significantly affect abiotic stress tolerance in other species such as cotton, Arabidopsis, rice, and tea. Therefore, systematic analysis of the FAH gene family is of great value in revealing its function, especially the role of key enzymes in drought resistance.

[0004] However, the molecular mechanisms of wheat FAH gene family members in mediating drought resistance are still unclear. In-depth exploration of the molecular network of this family of genes in response to drought not only helps to enrich the knowledge of wheat drought-resistant gene resources and functions, but also provides potential gene targets and molecular markers for drought-resistant molecular breeding, which is of great significance for improving the drought resistance and yield stability of wheat. SUMMARY

[0005] In view of the above deficiencies of the prior art, the present application provides a KASP molecular marker of a wheat drought-resistant gene TaFAH47 and application. TaFAH47 The present application has the advantages that the KASP molecular marker of the wheat drought-resistant gene TaFAH47 provided by the present application is simple in operation, low in cost, and high in accuracy, and can be used for marker-assisted selection of wheat drought-resistant genes TaFAH47.

[0006] To achieve the above-mentioned purposes, the technical scheme adopted by the present application is:

[0007] A wheat drought-resistant gene is provided TaFAH47 , characterized in that the wheat drought-resistant gene TaFAH47 is located on the short arm of the 4D chromosome of wheat and is located at the position of 69127088~69129717Mbp of the wheat genome.

[0008] The present application also provides a KASP molecular marker of the wheat drought-resistant gene TaFAH47 , and the wheat drought-resistant gene TaFAH47 is located on the short arm of the 4D chromosome of wheat and is located at the position of 69127088~69129717Mbp of the wheat Chinese Spring genome, the molecular marker is located at 69126089bp, and the polymorphism is C / T.

[0009] Further, the first upper primer has the sequence shown in SEQ ID NO. 1: GCTAGTTAAGCTTAAATGACC, the second upper primer has the sequence shown in SEQ ID NO. 2: GCTAGTTAAGCTTAAATGACT, and the lower primer has the sequence shown in SEQ ID NO. 3: TTGCCGTGTCATTTTAGCTC.

[0010] Further, different fluorescent modification groups are respectively connected to the 5' end or 3' of the first upper primer and the second upper primer.

[0011] The present application also provides a detection reagent or kit containing the primer set.

[0012] The present application also provides a method for identifying the drought resistance of wheat, which comprises: using the DNA of a wheat sample to be tested as a template, using the KASP primer set or the detection reagent or kit to perform PCR amplification, and judging the drought resistance of the wheat sample to be tested according to the amplification result.

[0013] Further, the system used for PCR amplification includes: 5µL Master Mix, 0.4µL first upper primer, 0.4µL second upper primer, 0.8µL lower primer, 1µL (100ng / µL) template DNA, and the rest is water, with a total system of 10µL.

[0014] Further, the reaction program used for PCR amplification is: 95℃ pre-denaturation for 2min; 95℃ denaturation for 15s; 60℃ annealing for 15s; 72℃ extension for 30s, 40 cycles.

[0015] Further, judging the drought tolerance of the plant sample to be tested according to the amplification result comprises: analyzing the genotype of the polymorphic site contained in the molecular marker in the amplification product, and the wheat with the genotype of TT has better drought tolerance compared with the genotype of CC.

[0016] The application further provides any one of the following applications of the above-mentioned molecular marker, the above-mentioned KASP primer combination or the above-mentioned detection reagent or kit:

[0017] (1) used for identifying, selecting and improving the drought tolerance of wheat;

[0018] (2) used for early prediction of the drought tolerance trait of wheat;

[0019] (3) used for molecular marker assisted breeding of wheat.

[0020] The application has the following beneficial effects:

[0021] The application screens a key gene responding to drought stress based on the whole genome identification technology and transcriptome expression data analysis of Chinese spring wheat TaFAH47 . The expression of the gene is verified to be related to the drought tolerance of wheat by RT-qPCR technology. It is confirmed by bioinformatics alignment analysis and sequencing verification that a C / T base natural variation exists in the promoter of the gene. The polymorphism of the SNP site can be detected to accurately and quickly identify whether the wheat has excellent drought tolerance, and the marker for the site has the advantages of good genetic stability, high resolution, suitable for high-throughput detection application and the like.

[0022] The SNP site provided by the application can be used to detect the excellent haplotype of the drought tolerance gene on the 4D chromosome of wheat, quickly screen plants with excellent sites, and then facilitate the molecular assisted breeding of drought tolerance wheat. The molecular marker KASP-0936 provided by the application is closely linked to the drought tolerance gene on the 4D of wheat TaFAH47 , can be used for positioning the drought tolerance trait of wheat, so as to screen plants with strong drought tolerance in the breeding process, improve the work efficiency of breeding, and provide a basis for the research of wheat drought tolerance gene. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 is a plant characterization diagram of three treatment methods of example 1;

[0024] Figure 2 is a gene expression comparison diagram of plants obtained by three treatment methods of example 1;

[0025] Figure 3 is the structure and sequence information of the gene TaFAH47 and the SNP sequencing verification result in Chinese spring and Jimai 22 in example 2;

[0026] Figure 4 The results are the fluorescence readings of the molecular marker KASP-0936 detected in the 84 parental breeding samples in Example 2.

[0027] Figure 5 The results show the comparative characterization of drought resistance of different plant types in Example 2;

[0028] Figure 6 This is a comparison diagram of the rootstock and seedling lengths of different subtypes of plants in Example 2. Detailed Implementation

[0029] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0030] The wheat germplasm resources used in the embodiments of this invention all come from the wheat heterosis project of the Crop Research Institute of Sichuan Academy of Agricultural Sciences (Sichuan Germplasm Resource Center). Unless otherwise specified in the embodiments, the technical means used are conventional methods well known to those skilled in the art, and the raw materials used are all commercially available products.

[0031] Example 1 Wheat TaFAH47 Gene identification and verification

[0032] A total of 116 FAH gene family members were identified using wheat whole-genome identification technology. Transcriptome data analysis of these 116 FAH gene family members was then used to screen for key genes exhibiting the strongest drought resistance response. TaFAH47 .

[0033] Germination of *Prunus cerasifera* plants was carried out, and plants with similar growth were selected and divided into three groups of nine plants each. These groups were treated with normal watering (CK), drought, and PEG6000 (a drought-simulating reagent), respectively. Two weeks later, the plant morphology was as follows: Figure 1 As shown, by Figure 1 It can be seen that plants watered normally are healthy and growing normally: leaves are upright and unfolded, bright green, and the plant shape is full, without any signs of wilting or yellowing. Plants treated with drought, however, show severe stress damage, with leaves drooping and curling significantly, some leaves losing their green color and turning yellow, and the overall plant shape becoming limp and wilted, with the most significant growth inhibition. Plants treated with PEG6000 to simulate drought also showed stress responses, but the degree differed from "actual drought." Although the leaves drooped and wilted, they retained relatively more green, and the degree of limpness was slightly less than in the actual drought group.

[0034] The same part of the leaf was taken to extract RNA, and three biological replicates were used for each treatment.

[0035] The RNA extraction method was as follows:

[0036] A1: 80 mg of leaf tissue was weighed into a 2 mL centrifuge tube, sterilized steel beads were added, and the leaf tissue was ground into powder on a grinder. 1 mL of lysis buffer was quickly added and mixed uniformly using a shaker.

[0037] A2: 200 mL of chloroform was added, and the shaker was shaken for 20 s and stood for 3 min. After centrifugation at 12000 rpm for 10 min at 4°C, the supernatant was transferred to a new sterilized EP tube, and 0.5 times the volume of anhydrous ethanol was added. The mixture was transferred to an adsorption column, and then centrifuged at 12000 rpm for 1 min at 4°C, and the filtrate was discarded.

[0038] A3: 500 μL of deproteinization solution was added to the adsorption column, and centrifuged at 12000 rpm for 1 min at 4°C, and the filtrate was discarded

[0039] A4: 500 μL of rinse solution was added to the adsorption column, and stood for 2 min, and then centrifuged at 12000 rpm for 1 min at 4°C, and the filtrate was discarded. The operation was repeated once.

[0040] A5: Centrifugation at 12000 rpm for 2 min at 4°C to remove residual liquid. The adsorption column was transferred to a new sterilized 1.5 mL centrifuge tube, 50 μL of RNase-Free ddH2O was added, and it was placed at room temperature for 2 min, and then centrifuged at 12000 rpm for 2 min at 4°C. The operation was repeated once to obtain the RNA sample.

[0041] The RNA sample was subjected to reverse transcription using the following method:

[0042] B1: 3 μL of RNA sample was taken, 2 μL of gDNA Buffer was added, 1 μL of gDNA enzyme was added, and 4 μL of RNase-Free ddH2O was added. After mixing, the PCR instrument was reacted at 42°C for 2 min, and at 4°C for 1 min.

[0043] B2: 6 μL of reverse transcriptase premix was added to the above 10 μL liquid, and 4 μL of RNase-Free ddH2O was added. After mixing, the PCR instrument was reacted at 37°C for 15 min, treated at 85°C for 5 s, and reacted at 4°C for 1 min. The cDNA sample was obtained by reverse transcription,

[0044] The cDNA sample was subjected to RT-qPCR verification, and the specific steps were as follows: 1 μL of the reverse-transcribed cDNA sample was taken into a fluorescence quantification special PCR, 10 μL of SYBR MasterMix, 1 μL of the upper primer, the sequence of the upper primer was GATAATGGCGCAACTGACAG, 1 μL of the lower primer, the sequence of the lower primer was CAGCGTGGTAACATGGCATG, 7 μL of RNase-Free ddH2O, and the reaction was carried out in a fluorescence quantification PCR instrument. The program was as follows: 95°C pre-denaturation for 2 min; 95°C denaturation for 15 s; 60°C annealing for 15 s; 72°C extension for 30 s, 40 cycles. The results are shown in Figure 2 FIG. 1, and it can be known from Figure 2 FIG. 2 that the expression level of the gene was significantly increased after drought treatment and PEG6000 treatment, which proved that the gene was induced by drought stress. TaFAH47 TaFAH47

[0045] Example 2 Development of KASP molecular marker for drought tolerance of wheat

[0046] Chinese Spring (CS) and Jimai 22 (JM22) TaFAH47 were used as materials, and the promoter and CDS sequences of the gene were aligned, and the results are shown in Figure 3 FIG. 3, and it can be known from Figure 3 FIG. 4 that there was a natural variation of C / T base at the position of -999 bp of the promoter (namely 69126089 bp of Chinese Spring reference genome IWGSC RefSeq v1.1), and it was found by sequencing that the site really existed.

[0047] The DNA of 84 parent breeding lines / planting strains was extracted by CTAB method.

[0048] ​​DNA samples were subjected to a primer set consisting of a first upper primer as shown in SEQ ID NO.1, a second upper primer as shown in SEQ ID NO.2, and a lower primer as shown in SEQ ID NO.3, with a FAM fluorescent modification group attached to the 5' end of the first upper primer and a HAX fluorescent modification group attached to the 5' end of the second upper primer. PCR amplification was performed using the following system: 5 µL Master Mix, 0.4 µL first upper primer (sequence shown in SEQ ID NO.1), 0.4 µL second upper primer (sequence shown in SEQ ID NO.2), 0.8 µL lower primer (sequence shown in SEQ ID NO.3), 1 µL (100 ng / µL) template DNA, and the remainder being water. The PCR amplification program was: 95 °C pre-denaturation for 2 min; 95 °C denaturation for 15 s; 60 °C annealing for 15 s; 72 °C extension for 30 s, for 40 cycles. In practice, one can choose to connect the 5' end of the first upper primer to the HAX fluorescent modification group and the 5' end of the second upper primer to the FAM fluorescent modification group; or connect the fluorescent modification group to the 3' end of the first / second upper primer.

[0049] The instrument detected fluorescence signals, and the genotyping results of 84 breeding lines / plants are as follows: Figure 4 As shown. Figure 4 The black area represents the blank control. The test samples were divided into homozygous CC genotype (blue), homozygous TT genotype (orange), and heterozygous CT genotype (green) according to different genotypes.

[0050] Plants of the TT and CC phenotypes were selected and treated with PEG6000, with a control group receiving normal watering. After 7 days of cultivation at 25℃ with 16 hours of light and 8 hours of darkness, the plant phenotypes were as follows: Figure 5 As shown, where, Figure 5 In the figure, 'a' represents the drought simulation result of CC-type plants; Figure 5 In the figure, b represents the drought simulation results of TT-type plants; from Figure 5 As can be seen from 'a', the growth of roots and seedlings of CC-type plants was significantly inhibited compared with the control group, and the overall plant shape was limp and wilted with a high degree of curling; while the growth of roots and seedlings of TT-type plants was slightly inhibited compared with the control group, and the degree of curling was not significantly different.

[0051] The seedling length and rhizome length of the two different plant types were measured and statistically analyzed, and the results are as follows: Figure 6 As shown, where, Figure 6 In the diagram, 'a' represents a comparison of the root and stem lengths of the plants. Figure 6 In the diagram, 'b' represents a comparison of seedling lengths; from Figure 6It was found that the length of root and seedling of TT and CC plants were inhibited after PEG6000 treatment, but the inhibition of TT plants was lower than that of CC plants. It was proved that TT plants had better drought tolerance than CC plants.

Claims

1. A method for identifying the drought resistance of wheat, characterized in that, include: Using the DNA of the wheat sample to be tested as a template, PCR amplification was performed using the KASP primer set. The drought resistance of the wheat sample to be tested was determined based on the amplification results. The KASP primer set includes a first upper primer with the sequence shown in SEQ ID NO.1: GCTAGTAAGCTTAAATGACC; a second upper primer with the sequence shown in SEQ ID NO.2: GCTAGTAAGCTTAAATGACT; and... The lower primer, with the sequence shown in SEQ ID NO.3, is TTGCCGTGTCATTTTAGCTC. The drought resistance of the wheat sample to be tested is determined based on the amplification results, including: analyzing the genotype of the polymorphic sites in the amplification product. Wheat with genotype TT has better drought resistance than wheat with genotype CC.

2. The method for identifying wheat drought resistance according to claim 1, characterized in that, The total volume of the PCR amplification system is 10 μL. The system consists of: 5 µL Master Mix, 0.4 µL first upper primer, 0.4 µL second upper primer, 0.8 µL lower primer, 1 µL template DNA at a concentration of 100 ng / µL, and the remainder is water.

3. The method for identifying wheat drought resistance according to claim 2, characterized in that, The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 15 s; 60℃ annealing for 15 s; 72℃ extension for 30 s, for 40 cycles.

4. Any of the following applications of the KASP primer set: (1) Used for the identification, selection and improvement of wheat drought resistance; (2) Used for early prediction of drought resistance traits in wheat; The KASP primer set includes a first upper primer with the sequence shown in SEQ ID NO.1: GCTAGTAAGCTTAAATGACC; a second upper primer with the sequence shown in SEQ ID NO.2: GCTAGTAAGCTTAAATGACT; and a lower primer with the sequence shown in SEQ ID NO.3: TTGCCGTGTCATTTTAGCTC.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker for identifying drought tolerance of wheat, haplotype, primer and application

    CN121575139A