Modified fusion proteins for controlling insect pests
By developing the chimeric protein SCW112, the problem of poor control of pests such as sugarcane weevils in existing technologies has been solved, achieving highly efficient insecticidal control of sugarcane weevils and reducing harm to beneficial organisms and the risk of resistance.
Patent Information
- Application Number
- CN202480035522.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-03-31
- Filing Date
- 2024-03-28
- Publication Date
- 2026-02-06
AI Technical Summary
Existing technologies are insufficient to effectively control beetle and other coleopteran pests. Chemical pesticides are harmful to beneficial organisms, while biological pesticides are costly and have strict application requirements. Bt proteins have limited selectivity for specific pests and are prone to developing resistance.
A chimeric protein, SCW112, was developed, which combines the structural domains of Cry8Ba1 and Cry1Ad proteins, for use in the preparation of insecticidal compositions that can be applied to crops such as sugarcane via transgenic plants or directly to target Coleoptera pests such as the sugarcane weevil.
It improves the insecticidal effect against pests such as sugarcane weevils, reduces harm to beneficial organisms, reduces the use of chemical pesticides, has wider adaptability, and reduces the risk of resistance.
Smart Images

Figure CN121487969A_ABST
Abstract
Description
[0001] Cross-references to related applications
[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 493,441, filed March 31, 2023, the entire contents of which are incorporated herein by reference.
[0003] Reference to electronic sequence listing
[0004] The entire contents of the electronic sequence list (207422000440seqlist.xml; size: 93,213 bytes; creation date: March 26, 2024) are incorporated here by reference. Technical Field
[0005] This disclosure relates to chimeric proteins, as well as their variants and fragments, for the control of insect pests (particularly coleopteran pests, more specifically, those affecting the crop sugarcane). Sugarcane weevil Methods and compositions for protecting sugarcane from pests. More specifically, this disclosure relates to a novel chimeric protein named SCW112 for protecting sugarcane from pests. Sugarcane weevil Infection. This disclosure also relates to the production of insecticidal compositions using the protein. Furthermore, this disclosure relates to the control of insect pests using the protein, more specifically, the control of Coleoptera pests (e.g., Sugarcane weevil The method. Background Technology
[0006] Invertebrate pests cost the global economy hundreds of billions of dollars annually, consuming and destroying cultivated crops vital to human health and survival. In addition to these economic losses, the damage caused by invertebrate pests also wastes a significant portion of potential agricultural food.
[0007] Sugarcane (Saccharum genus) is an important crop used to produce a variety of foods and ethanol. A clonal crop, sugarcane belongs to the same family as maize, rice, and wheat, and is cultivated as the world's largest source of sugar. In addition to its importance as food, sugarcane is also a source of biofuel, ethanol, with a global market size of approximately $50 billion. Sugarcane pests include borers (such as the sugarcane borer), suckers (such as whiteflies), and soil pests (such as termites). The most important sugarcane pests belong to the orders Lepidoptera, Coleoptera, Hemiptera, Hymenoptera, and Isoptera; examples of pests from each order are the sugarcane borer, bollweevil, red-leafhopper, leaf-cutting ant, and termite. One particularly harmful insect pest is the sugarcane weevil or sugarcane billbug (official name: sugarcane billbug). Sugarcane weevil It is a type of Coleoptera pest belonging to the family Cercopithecidae. Sugarcane weevil The damage to sugarcane plants is twofold: first, the insect burrows into the plant's stem tissue and lays eggs; second, the larvae hatching from the eggs feed voraciously on the plant. This damage can result in the loss of 60% of the young stems and 30% of the total crop loss.
[0008] To combat insects affecting sugarcane, the most common solution is the use of chemical mixtures or biopesticides containing at least one insecticidal and / or nematicidal ingredient. These chemical mixtures work by inhibiting multiple stages of the insect's life cycle, affecting behaviors essential for its survival, or directly causing its death. However, these chemicals often affect a wide range of pest groups beyond the target pest, which can harm beneficial symbiotic organisms in the crop, leading to yield reduction. Other problems with these chemical mixtures include the potential environmental accumulation of toxic compounds in the mixture within the crop's surrounding environment. Furthermore, chemical pesticides may not be effective against pests on sugarcane because the feeding behavior of larvae in the stalks prevents effective contact between the pesticide and the insect pests. Some insect pests, such as... Sugarcane weevil They feed at the base of the stem. This feeding behavior increases the difficulty of large-scale application of chemical agents because effective application is done on the ground, not in the air. For biological pesticides, several options are available, including parasitoid wasps (e.g., Cotesia flavipes , Trichogramma galloi and Tetrastichus howardii ), insect pathogenic fungi (e.g., Metarhizium anisopliae) Metarhizium anisopliae ) and Beauveria bassiana ( Beauveria bassianaBiological pesticides (Bacillus thuringiensis) and bacteria (e.g., Bacillus thuringiensis). Compared to chemical mixtures, biological pesticides are more expensive. Furthermore, biological pesticides have strict requirements for application methods and are only effective under limited conditions. To achieve a certain level of treatment efficacy, multiple approaches are usually required to control insect pests.
[0009] The use of heterologous Bacillus thuringiensis (Bt) proteins, such as delta-endotoxin proteins, can replace chemical mixtures and biopesticides because these proteins can target pests more precisely, degrade more rapidly in the surrounding soil, and have lower levels of bioaccumulation compared to many chemical pesticide mixtures. Furthermore, these proteins allow for the use of other delivery methods, including through compositions and / or transgenic plants. These active delta-endotoxin proteins exert toxicity on target insect pests by inducing selective stomach poisoning in the insect gut. These proteins attach to the interior of the insect gut and cause deterioration of the intestinal cell membrane, ultimately creating holes in the gut that kill the insect. Unlike the insect gut, the human gut is capable of rapidly and harmlessly breaking down any Bt proteins it comes into contact with.
[0010] Many Bt proteins are species-selective, thus limiting their applicability to specific pest species. While this species selectivity makes Bt proteins more suitable for human consumption than some chemical pesticides, it also means that targeted Bt proteins are needed to address specific pests. Therefore, extensive research is required to identify specific Bt proteins effective against specific target pests. Furthermore, there have been numerous cases of insects developing resistance to specific Bt proteins. This is particularly evident for Bt proteins that have been used in crops for multiple generations.
[0011] Clearly, we need to find new and effective proteins that are toxic to plant pests, especially sugarcane pests, and more specifically, sugarcane weevil or sugarcane beetle. Sphenophorus levis Bt proteins have not yet been successfully targeted at this harmful pest, but their advantages over chemical mixtures make them an ideal tool for controlling it. Summary of the Invention
[0012] To meet these needs, this disclosure provides chimeric Cry proteins comprising portions of both the Cry8Ba1 and Cry1Ad proteins. The protein disclosed herein, designated SCW112 (SEQ ID NO: 2), is a chimeric protein comprising domains I and II of the Cry8Ba1 protein (SCW35; SEQ ID NO: 1) and domain III of the Cry1Ad protein (SCW39; SEQ ID NO: 3). This disclosure also provides methods for controlling coleopteran pests using such chimeric proteins and their recombinant, modified, truncated, and / or mutant forms, including insecticidal compositions of these proteins, expression cassettes encoding these proteins, and plants containing them. Specifically, this disclosure relates to the control of coleopteran pests. Sugarcane weevil Uses of toxic chimeric Cry proteins (e.g., SCW112).
[0013] In some aspects, this disclosure relates to a chimeric polypeptide having: a) a sequence comprising domain I and domain II of the Cry8Ba1 protein; and b) a domain III sequence of the Cry1A protein. In some embodiments of this aspect, the domain III sequence is derived from the Cry1Ad protein. In some embodiments of this aspect, the polypeptide comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity with SEQ ID NO: 2, and / or a variant or fragment thereof. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the sequences comprising domains I and II of the Cry8Ba1 protein include sequences having at least 80%, at least 83%, at least 85%, at least 87%, at least 90%, at least 93%, at least 95%, or at least 97% sequence identity with SEQ ID NO: 1, and the sequence comprising domain III of the Cry1A protein includes sequences having at least 80%, at least 83%, at least 85%, at least 87%, at least 90%, at least 93%, at least 95%, or at least 97% sequence identity with SEQ ID NO: 3. In some embodiments of this aspect, the polypeptide includes sequences having at least 90% sequence identity with SEQ ID NO: 1 and at least 90% sequence identity with SEQ ID NO: 3. In some embodiments of this aspect, the polypeptide includes the sequence of SEQ ID NO: 2. In another embodiment of this aspect, the polypeptide comprises a sequence having at least one amino acid substitution, deletion, and / or insertion compared to SEQ ID NO: 1 and / or a sequence having at least one amino acid substitution, deletion, and / or insertion compared to SEQ ID NO: 3; a sequence having at least one N-terminal or C-terminal addition compared to SEQ ID NO: 1 and / or a sequence having at least one N-terminal or C-terminal addition compared to SEQ ID NO: 3; a sequence having at least one domain exchange compared to SEQ ID NO: 1 and / or a sequence having at least one domain exchange compared to SEQ ID NO: 3; a sequence having at least one truncated sequence compared to SEQ ID NO: 1 and / or a truncated sequence compared to SEQ ID NO: 3, and / or a sequence having at least one other alteration compared to SEQ ID NO: 1 and / or a sequence having at least one other alteration compared to SEQ ID NO: 3.
[0014] In another aspect, this disclosure relates to a chimeric polypeptide comprising: at least one amino acid substitution, deletion, and / or insertion compared to SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22; and at least one amino acid substitution, deletion, and / or insertion compared to SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 22. Compared with SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, at least one addition at the N-terminus or C-terminus; compared with SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, at least one domain swap;With SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22 is at least one truncation; and / or is SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22 are modified compared to at least one other. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polypeptide has insecticidal activity against at least one agricultural insect pest. In some embodiments of this aspect, the at least one insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus,Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .
[0015] Certain aspects of this disclosure relate to polynucleotides encoding polypeptides of any of the foregoing embodiments. In some embodiments of this aspect, the polynucleotide comprises the sequence of SEQ ID NO: 4. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polynucleotide has codons optimized for expression in agriculturally important crops. In some embodiments of this aspect, the agriculturally important crop is sugarcane, and the polynucleotide comprises SEQ ID NO: 5. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polynucleotide is a non-genomic polynucleotide. In some embodiments of this aspect, the polynucleotide is a synthetic polynucleotide, and / or said polynucleotide is cDNA.
[0016] Certain aspects of this disclosure relate to an isolated construct or expression cassette comprising a nucleotide or polynucleotide encoding a polypeptide of any of the foregoing embodiments, wherein the nucleotide or polynucleotide is operatively linked to a promoter and optionally operatively linked to a heterologous regulatory element. In some embodiments of this aspect, the polypeptide comprises SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, and / or other fragments and / or variants. In some embodiments of this aspect, the polynucleotide includes SEQ ID NO: 4 or SEQ ID NO: 5. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the promoter is selected from constitutive promoters, inducible promoters, and tissue-specific promoters.
[0017] In some aspects, this disclosure relates to a transgenic plant, plant part, propagule, seed, tissue, organ, embryo, or plant cell comprising a polypeptide, a polynucleotide, or an isolated construct or expression cassette of any of the foregoing embodiments. In some embodiments of this aspect, the polypeptide comprises SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, other fragments, and / or variants. In some embodiments of this aspect, the polynucleotide comprises SEQ ID NO: 4 or SEQ ID NO: 5.
[0018] Another aspect of this disclosure relates to an insecticidal composition comprising: (i) one or more polypeptides of any of the foregoing embodiments, wherein the concentration of said one or more polypeptides is sufficient to control at least one agricultural insect pest; (ii) one or more polynucleotides of any of the foregoing embodiments, wherein said polynucleotides optionally have codons optimized for expression in agriculturally important crops; and / or (iii) one or more isolated constructs or expression cassettes of any of the foregoing embodiments. In some embodiments of this aspect, said one or more polypeptides comprise SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, other fragments and / or variants. In some embodiments of this aspect, the one or more polynucleotides comprise SEQ ID NO: 4 or SEQ ID NO: 5. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the at least one insect pest is a coleopteran pest. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), when the composition is applied to plants or plantations, the concentration of the one or more polypeptides present is sufficient to control at least one agricultural insect pest in or on sugarcane plants. In some embodiments of this aspect, the plants and plantations comprise sugarcane. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition further comprises one or more inert components and / or an acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste, colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as an orally acceptable, orally applicable, or orally ingestible feed for consumption by insect pests.In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated for direct soil application and / or direct potting substrate application. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a controlled-release formulation. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), control of coleopteran pests includes: a) reducing pest infestation by 40%, 50%, 60%, 70%, 80%, 90%, or 100%; or b) increasing pest mortality by 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the coleopteran pest is selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus, Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabaeidae ( Scarabaeidae ) species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .
[0019] Another aspect of this disclosure relates to a method for controlling insect pest populations, comprising: a) providing a composition comprising at least one polypeptide from any of the foregoing embodiments, or providing a composition from any of the foregoing embodiments; and b) contacting an insect pest population with an effective amount of the composition. In some embodiments of this aspect, the at least one polypeptide comprises SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 and / or SEQ ID NO: 22, other fragments and / or variants. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the contact in step (b) includes one or more of the following: providing the pest with a composition formulated as insect bait; feeding the pest with the composition; applying the composition to the outer surface of the pest; applying the composition to a plant; applying the composition to a plant part fed by the pest; applying the composition to a soil area where the pest may be present; applying the composition to an area where the pest population may be present; applying the composition formulated as a controlled-release formulation to an area where the pest is expected to appear; applying the composition to an insect pest trap; injecting the composition into a plant; or injecting the composition into the pest. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the contact in step (b) includes applying the composition to a plant or a planting area. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is applied to the plant in at least one of the following ways: foliar treatment, seed coating, injection treatment, pre-emergence treatment, and / or post-emergence treatment. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is prepared by drying, lyophilizing, homogenizing, extracting, filtering, centrifuging, settling, cryopreservation, or concentration.In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste, colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), pests are brought into contact with an effective amount of the composition by feeding, spraying, spreading, coating, or wetting the composition or any combination thereof. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest population is reduced by 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to insect pest populations that have not been exposed to the composition. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest or insect pest population is resistant to at least one Bt toxin. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the method further includes providing a chemical mixture, an insecticidal protein, and / or a biocontrol agent, and contacting the insect pest population with an effective amount of the chemical mixture, the insecticidal protein, and / or the biocontrol agent before, during, or after step (b). In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus, Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .
[0020] Another aspect of this disclosure relates to a method for controlling insect pest populations, comprising: a) providing an insecticidal composition comprising SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21 and / or SEQ ID NO:22, other fragments and variants; b) introducing the insecticidal composition into an insect pest population, wherein the introduction is achieved by providing the composition in or on a food source of the insect pest; and wherein the insect pest population is reduced. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the introduction of step (b) includes one or more of the following: providing the pest with a composition formulated as an insect bait; feeding the pest with the composition; applying the composition to a plant; applying the composition to plant parts fed on by the pest; applying the composition to an insect pest trap; or injecting the composition into a plant. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste, colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is applied to plants by at least one of foliar treatment, seed coating, injection treatment, pre-emergence treatment, and / or post-emergence treatment. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is prepared by drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, cryopreservation, or concentration. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), compared to insect pest populations not exposed to the composition, the insect pest population is reduced by 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or the pest mortality rate is increased by 40%, 50%, 60%, 70%, 80%, 90%, or 100%.In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the method further includes providing a chemical mixture, an insecticidal protein, and / or a biocontrol agent, and contacting an insect pest population with an effective amount of the chemical mixture, the insecticidal protein, and / or the biocontrol agent before, during, or after step (b). In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest or insect pest population is resistant to at least one Bt toxin. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus, Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .
[0021] Other aspects of this disclosure relate to the use of the polypeptides in any of the foregoing embodiments for the purpose of inhibiting insect growth, controlling or killing insects, and / or controlling or killing insect populations. Brief description of the attached diagram
[0023] Figure 1 The results showed that the chimeric protein SCW112 and other Cry proteins were tested against the sugarcane weevil (or sugarcane beetle). Sugarcane weevil The results of toxicity bioassay screening of larvae of [unspecified species]. The vertical axis shows the actual mortality percentage for each tested protein, and the horizontal axis lists these proteins. The bars from left to right correspond to the following tested proteins (the prefix "P-" indicates "protein"): SCW35 (Cry8Ba1; SEQ ID NO: 1), SCW39 (Cry1Ad; SEQ ID NO: 3), and SCW112 (chimera; SEQ ID NO: 2).
[0024] Figure 2 The LC50 measurements of the chimeric protein SCW112 (SEQ ID NO: 2) are shown. The vertical axis represents the percentage of mortality, and the horizontal axis represents the dose of the Cry protein (μg / mL).
[0025] Figure 3The workflow of homology modeling used in the examples is shown. The sequence of general steps is on the left, and the right side is a visual description of the homology model of SCW112 obtained by changing the target amino acid sequence of the template sequence (right side, top) (right side, bottom).
[0026] Figure 4 A three-dimensional homology model of the resulting protein SCW112 is shown, with 0.88 GMQE representing 87.98% identity.
[0027] Figure 5 The SDS-PAGE results for solubility assessment of the protein sequence of the initial SCW112 (labeled “A”; SEQ ID NO: 2) and the protein sequence of the variant SCW112 (labeled “B”; SEQ ID NO: 26) are shown.
[0028] The arrow marks the location of the SCW112 protein.
[0029] Figures 6A-6D The SDS-PAGE results for SCW112 at different points in the purification process are shown, with lanes described below each image. Figures 6A-6C In the image, the arrow marks the location of SCW112. Figure 6A Results for SCW112 up to 4 liters are shown (SEQ ID NO: 2).
[0030] The lanes are as follows: "M" contains protein molecular weight markers; "PC" contains BSA; "NC" contains uninduced cell lysis products; "1" contains cell lysis products induced at 15°C for 16 hours; "2" indicates supernatant containing cell lysis products induced at 15°C for 16 hours; and "3" contains precipitate of cell lysis products induced at 15°C for 16 hours. Figure 6B The results of SCW112 purified by Ni column are shown (SEQ ID NO: 2).
[0031] The lanes are as follows: "M" contains protein molecular weight markers; "1" contains the supernatant of centrifuged cell lysate (for loading); "2" contains flow-through buffer; "3" and "4" contain elution buffer with 20 mM imidazole; "5", "6" and "7" contain elution buffer with 250 mM imidazole; "8" and "9" contain elution buffer with 500 mM imidazole. Figure 6C The results show the digestion of SCW112 (SEQ ID NO: 2) with SUMO protease followed by purification with a Ni column.
[0032] The lanes are as follows: "M" contains a protein molecular weight marker; "1" contains a fusion protein; "2" contains a 1:100 SUMO protease-to-fusion protein; "3" contains flow-through buffer; "4" contains an elution buffer with 20 mM imidazole; "5" contains an elution buffer with 500 mM imidazole; and "6" contains a SUMO protease. Figure 6D The results of SCW112 purified by Superdex are shown (SEQ ID NO: 2); lane "1" contains SCW112 before purification and lane "2" contains purified SCW112.
[0033] Figure 7 The standard curves generated by three different antibody combinations in a sandwich ELISA experimental design are shown.
[0034] The horizontal axis plots the log concentration (ng / mL) for each data series, along with the corresponding optical density (average absorbance, “OD450”) at a wavelength of 450 nm.
[0035] The square data points correspond to samples of combined antibodies 6C11C4 and 13C2A4 (“6C11C4&13C2A4-Biotin”); the circle data points correspond to samples of combined antibodies 2B1B2 and 6H5F8 (“2B1B2&6H5F8-Biotin”); and the triangle data points correspond to samples of combined antibodies 14H5B6 and 15E1E10 (“14H5B6&15E1E10-Biotin”).
[0036] Figure 8 A box plot showing the absorbance values (Abs in nanometers, vertical axis) of various proteins tested by ELISA is displayed.
[0037] Along the horizontal axis from left to right, the proteins tested are SCW112; non-target proteins (“Non-target 1”, “Non-target 2”, and “Non-target 3”); bovine serum albumin standard (“BSA”); and a separate calibration standard (phosphate-buffered saline and Tween™) (“PBST”).
[0038] Figure 9 The in vivo expression of the construct targeting the protein SCW112 (SEQ ID NO: 25) in plants is shown. The construct components are labeled as follows: "P-SCBV" represents the promoter from sugarcane bacilliform virus; "SCW112" represents the coding sequence of the protein SCW112; "T-NOS" and "T-NOS(1)" represent the Agrobacterium tumefaciens terminator of the carmine synthase gene (…). Agrobacterium tumefaciens t erminators of no paline s The coding sequence for ynthase genes; "p-ZmUbi1" represents the maize ubiquitin protein promoter; "NPTII" represents the coding sequence for the nptII gene; "korA" and "korB" each represent the repressor protein encoded by the plasmid derived from the incompatible group P plasmid; "trbA" represents the coding sequence for another such repressor, named "trbA"; "IncC2" represents the coding sequence for one of the two products (named product 2) of the gene named "incompatible group C", which has an ATP-binding motif; "OriT" indicates the transfer source used to provide genetic material during bacterial conjugation ( ori gin of t The coding sequence for ransfer; "ssb" represents a single-stranded DNA binding protein ( s ingle- s tranded DNA- b The sequence lists the coding sequence of the ssb gene (inding protein); "trfA1" and "tfrA2" represent the longer and shorter protein forms of the replication initiation protein named "TrfA", respectively; "nptIII" represents the coding sequence of the kanamycin resistance determinant gene nptIII; and "OriV" represents the trophic replication origin named "V" derived from the pCU1 plasmid. Lengths are listed in base pairs (bp), with left and right boundaries indicated.
[0039] Figure 10 The results of the toxicity bioassay screening are shown, testing the chimeric protein SCW112 transformation events 0013.02 and 0017.03 (“Event.0013.02” and “Event.0017.03”, respectively) and the negative control (“CTRL (-)”) of unmodified plants against the sugarcane weevil (or sugarcane beetle). Sugarcane weevil Larvae. The vertical axis shows the percentage of larval mortality, calculated as described in the method of Example 6. Detailed Implementation
[0040] The following description illustrates exemplary methods, parameters, etc. However, it should be understood that these descriptions are not intended to limit the scope of this disclosure, but rather to describe exemplary embodiments.
[0041] Methods for controlling insect pests
[0042] One aspect of this disclosure relates to a method for controlling insect pest populations, comprising: a) providing a composition comprising at least one polypeptide from any of the foregoing embodiments, or providing a composition from any of the foregoing embodiments; and b) contacting an insect pest population with an effective amount of the composition. In some embodiments of this aspect, the at least one polypeptide comprises SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 and / or SEQ ID NO: 22, and / or variants or fragments thereof. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), contact in step (b) includes one or more of the following: providing the pest with a composition formulated as an insect bait; feeding the pest with the composition; applying the composition to the outer surface of the pest; applying the composition to a plant; applying the composition to a plant part (e.g., a sugarcane stalk) that the pest feeds on; applying the composition to a soil area where the pest may be present; applying the composition to an area where the pest population may be present; applying the composition formulated as a controlled-release formulation to an area where the pest is expected to appear; applying the composition to an insect pest trap; injecting the composition into a plant; or injecting the composition into the pest. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste (e.g., for coating or smearing), colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the pest is brought into contact with an effective amount of the composition by feeding, spraying, spreading, coating, or wetting the composition or any combination thereof. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the contact in step (b) includes applying the composition to the plant or the area to be planted.In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is applied to plants by at least one of foliar treatment, seed coating, injection treatment, pre-emergence treatment, and / or post-emergence treatment. The method of plant treatment may vary depending on factors known in the art, such as planting timing, the resilience of individual plant parts or organs, the timing of insect pest emergence, the degree and location of insect pest infestation, and / or the effective amount of the composition included in the treatment. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is prepared by drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, cryopreservation, or concentration. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest population is reduced by 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% compared to an insect pest population that has not been exposed to the composition. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest or insect pest population is resistant to at least one Bt toxin. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the method further includes providing a chemical mixture, an insecticidal protein (e.g., Bt protein), and / or a biocontrol agent, and contacting the insect pest population with an effective amount of the chemical mixture, the insecticidal protein, and / or the biocontrol agent before, during, or after step (b). In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus, Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .
[0043] Another aspect of this disclosure relates to a method for controlling insect pest populations, comprising: a) providing an insecticidal composition comprising SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, and / or variants or fragments thereof; b) introducing the insecticidal composition into an insect pest population, wherein the introduction is achieved by providing the composition in or on a food source of the insect pest; and wherein the insect pest population is reduced. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the introduction of step (b) includes one or more of the following: providing the pest with a composition formulated as an insect bait; feeding the pest with the composition; applying the composition to a plant; applying the composition to plant parts fed on by the pest; applying the composition to an insect pest trap; or injecting the composition into a plant. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste (e.g. for coating or smearing), colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is applied to plants by at least one of foliar treatment, seed coating, injection treatment, pre-emergence treatment, and / or post-emergence treatment. The method of plant treatment may vary depending on factors known in the art, such as planting timing, the resilience of individual plant parts or organs, the timing of insect pest appearance, the extent and location of insect pest infestation, and / or the effective amount of the composition included in the treatment. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is prepared by drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, cryopreservation, or concentration.In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest population is reduced by 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% compared to an insect pest population not exposed to the composition. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the method further includes providing a chemical mixture, an insecticidal protein (e.g., Bt protein), and / or a biocontrol agent, and contacting the insect pest population with an effective amount of the chemical mixture, the insecticidal protein, and / or the biocontrol agent before, during, or after step (b). In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest or insect pest population is resistant to at least one Bt toxin. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus, Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .
[0044] Other aspects of this disclosure relate to the use of the peptides in any of the foregoing embodiments for inhibiting insect growth, controlling or killing insects, and / or controlling or killing insect populations. In some embodiments, contact with one or more peptides from the foregoing embodiments results in insect stunting, cessation of plant damage, or insect death.
[0045] The active ingredient (e.g., a chimeric peptide) in this embodiment is typically present in the composition and can be applied to the crop area, plant, or seed to be treated. The composition of this embodiment can be applied simultaneously or sequentially with other compounds. The number of applications and the application rate depend on the severity of insect pest infestation.
[0046] "Controlling insect pest populations" aims to limit or eliminate associated damage to plants caused by insect pests by, for example, inhibiting their ability to grow, feed, and / or reproduce, or by killing them. The method includes preparing a compound or mixture containing an insecticidal recombinant polypeptide, and then contacting the compound or mixture with the insect pest. In some embodiments, this contact may include delivering the insecticidal polypeptide from insect bait to the insect pest. Another embodiment includes coating the insecticidal polypeptide onto plant seeds, whereby an insect interacts with the seeds or the resulting plant, thereby triggering the insecticidal activity of the polypeptide. In some embodiments, contacting the pest with the insecticidal composition of this disclosure includes exposing the insect pest to the insecticidal polypeptide at the site of insect attack. "Contact" also includes applying the composition to the outer surface of the pest, applying the composition to the plant on which the pest feeds, applying the composition to the soil where the pest may be present, applying the composition to a general area of the pest population, applying the composition to an insect pest trap, injecting the composition into the plant or the pest, and any combination thereof.
[0047] The presence of the insecticidal polypeptides protects plants from insect pests, thereby controlling insect pests. On one hand, the use of expression cassettes to produce active insecticidal polypeptides can be used to prepare the compositions disclosed herein. In another embodiment, the invention provides recombinant microorganisms, transgenic plants, and / or any other animal organisms expressing active insecticidal polypeptides. These methods include transforming the organism with a nucleic acid sequence encoding the insecticidal polypeptide. Specifically, the nucleic acid sequences disclosed herein can be used to prepare plants and microorganisms with insecticidal activity. Thus, the invention provides transformed bacteria, yeast, plants, plant cells, plant tissues, plant parts, propagules, organs, tissues, embryos, and seeds. The compositions are insecticidal nucleic acids and proteins of bacterial species. The embodiments described herein can be used in agriculture as methods for protecting plants from insect pests and methods for influencing insect pests.
[0048] Compositions and formulations containing insecticidal polypeptides or variants or fragments thereof can be used in methods of controlling or influencing insect pests. "Influencing insect pests" is intended to mean, for example, preventing insect pests from further feeding on plants, harming insect pests, or killing insect pests. In this use, "influencing insect pests" is a form of insect pest control. Certain aspects and embodiments of this disclosure further provide methods for influencing plant insect pests, including, for example, applying a composition or formulation containing an insecticidal polypeptide to the environment of the insect pest. In one embodiment, the insecticidal polypeptide is combined with a carrier and subsequently applied to the environment of the insect pest. While these embodiments are not bound by any operational theory, in one embodiment, the insect pest ingests the insecticidal polypeptide, thereby influencing the insect pest. Insect pests can be contacted with an effective amount of the insecticidal composition by feeding, spraying, spreading, coating, wetting, and / or combinations thereof. The insecticidal composition can be applied to plants that insect pests are feeding on and / or will feed on by foliar treatment, seed coating, injection treatment, pre-emergence treatment, post-emergence treatment, and / or any combination thereof.
[0049] The compositions of this embodiment can be used to protect plants, plant parts, propagules, embryos, tissues, organs, seeds, and plant products in a variety of ways. For example, these compositions can be used in methods involving placing an effective amount of an insecticidal composition in the environment of pests by spraying, spreading, or seed coating. In one specific embodiment, such plants are sugarcane plants. Plant propagation material (fruits, tubers, bulbs, stems, tissue-cultured seedlets, corms, grains, seeds, artificial seeds) is typically treated with a protective coating before being sold commercially. This coating comprises a herbicide, insecticide, fungicide, bactericide, nematicide, molluscicide, or a mixture of several of these formulations, and, if desired, may be used with other carriers, surfactants, or adjuvants commonly used in the formulation field to provide protection against damage caused by bacteria, fungi, or animal pests. The protective coating can be applied by impregnating the plant material with a liquid formulation or by coating them with a combination of wet or dry formulations. Furthermore, in special cases, other methods of application to plants may be employed, such as treatment of buds or fruits. The plant material in embodiments coated with the insecticidal polypeptides of this disclosure can be treated with a protective coating comprising a treatment compound, such as captan, carboxin, thiram, methaxamic acid, pyrimiphos-methyl, and other substances commonly used in seed treatment. Alternatively, the material in the embodiments includes a protective coating comprising the insecticidal composition of the embodiments, used alone or in combination with one of the protective coatings commonly used in seed treatment.
[0050] In other embodiments, the insecticidal composition of this disclosure can be applied to areas where plants are grown or will be grown, for example, directly to the soil or the substrate in plant pots used to prepare planting material. This treatment method may be particularly suitable for sugarcane, as sugarcane is typically propagated using tissue-cultured seedlings or stem segments (rather than seeds). Furthermore, Sugarcane weevil The larvae lay their eggs near the sugarcane roots and feed on the sugarcane stalks, meaning that treatment of the soil or planting substrate may be effective.
[0051] Those skilled in the art will understand that the compositions and methods of this embodiment can be used alone or in combination with other compositions and methods for controlling insect pests affecting plants. For example, this embodiment can be used in combination with other insecticidal proteins, chemical mixtures, and / or biocontrol agents (e.g., biological insecticides). In another embodiment, the insecticidal polypeptides, variants of insecticidal peptides, and / or fragments thereof disclosed herein can be used in integrated pest management practices.
[0052] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. These terms apply to amino acid polymers, where one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, and also to naturally occurring amino acid polymers.
[0053] The methods described herein can provide control by reducing pest populations by 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% compared to pest populations that have not been exposed to the composition or preparation.
[0054] Coleoptera pests and other insect pests
[0055] The recombinant protein disclosed herein is effective in killing a variety of insect pests. Specifically, the recombinant protein disclosed herein is effective in killing a variety of Coleoptera insect pests. Examples of non-restricted Coleoptera insect pests in this disclosure include species of the genus *Leptinotarsa*, such as the potato leaf beetle (*Leptinotarsa spp.*). L. decemlineata(Colorado potato beetle); Chrysomela spp., such as C. scripta (cottonwood leaf beetle); Hypothenemus spp., such as H. hampei (coffee berry borer); Rhynchophorus ferrugineus (red palm weevil); Sitophilus spp., such as S. zeamais (maize weevil); Epitrix spp., such as E. hirtipennis (tobacco flea beetle) and E. cucumeris (potato flea beetle). Flea beetle species (Phyllotreta spp.), such as *P. cruciferae* (crucifer flea beetle) and *P. pusilla* (western black flea beetle); flower weevil species (Anthonomus spp.), such as *A. eugenii* (pepper weevil); *Hemicrepidus spp.), such as *H. memnonius* (wireworms); click beetle species (Melanotus spp.), such as *M. communis* (wireworm); *Ceutorhychus spp.*, such as *C. assimilis* (cabbage seedpod weevil); flea beetle species (Phyllotreta spp.), such as *P. cruciferae* (crucifer flea beetle). *Cruciferae* (flea beetles of the Brassicaceae family); *Aeolus* spp., e.g., *A. mellillus* (wireworm); *Aeolus* spp., e.g., *A. mancus* (wheat wireworm); *Horistonotus* spp., e.g., *H. uhlerii* (sand wireworm); species of the genus *Phyllophaga* (white grub); species of the genus *Chaetocnema*, e.g., *C.**Pulicaria* (corn flea beetle); *Popillia* spp., such as *P. japonica* (Japanese beetle); *Epilachnas* spp., such as *E. varivestis* (Mexican bean beetle); *Cerotoma* spp., such as *C. trifurcate* (bean leaf beetle); *Epicauta* spp., such as *E. pestifera* and *E. lemniscata* (blister beetles); *Sphenophorus* spp., such as the sugarcane weevil and *S. maidis*; *Diabrotica* spp., such as *Diabrotica speciosa*, *Trechus subsignatus*, *Migdolus fryanus*, and *Cerotoma*. *Arcuatatingomariana*, *Cosmopolites* spp., for example, the banana bulb weevil (*C. sordidus*) (banana borer); and the scarab beetle family (*Scarabaeidae*).
[0056] In some embodiments, the insecticidal protein of this disclosure is effective against species of the genus *Cryptocarya* (*Cryptocarya*). Sphenophorus spp. It is active. The genus *Billbug* is a genus of beetles in the family Cicadaeidae of the order Coleoptera, commonly known as "billbugs". This genus contains over 60 species, but exemplary *Billbug* species include, but are not limited to, species of the genus *Billbug*, such as... Sugarcane weevil (Sugarcane weevil or sugarcane beetle) S. maidis (Corn elephant armor) S. zeae (Timothy billbug) S. parvulus (Bluegrass billbug) and S. callosus (Southern corn weevil).
[0057] Of particular note is Sugarcane weevil Sugarcane weevil, or sugarcane beetle. Adults of this insect drill holes in the internodes of sugarcane plants near the ground and lay their eggs near the roots or inside the stalks. sugar cane Elephant ArmorThe larvae hatch after 7-12 days and feed directly on sugarcane stalks. Although the burrowing behavior of the female adults causes some initial damage, the main damage comes from the larvae's feeding. The larvae's activity is limited to the first and second internodes of the sugarcane plant. The larval feeding period is 26 to 50 days, followed by a pupal stage of 5 to 13 days. According to research by Degaspari et al., Sugarcane weevil Adults can survive in the soil for up to 250 days (Degaspari, N., et al. Biologia deSphenopherus levis Vaurie, 1978 (Col.: Curculionidade), em dieta artificial eno campo. Pesquisa Agropecuária Brasileira, Brasília, DF, v. 22, n. 3, p.553-558, 1987).
[0058] For every 1% of root and stem biomass destroyed by the sugarcane weevil, 1% of sugarcane is lost (Casteliani, A). et al. Crop Protection 137, 105262, 2020). Sugarcane weevil The impact on sugarcane plants can lead to the death of up to 60% of sugarcane tillers, resulting in a yield loss of up to 30% and significantly shortening the lifespan of sugarcane fields (Precetti and Arrigoni). Vaurie, 1978 (Coleoptera: Curculionidae). Copersucar, (São Paulo, Brazil. 1990). Since sugarcane weevils cannot fly long distances, it is believed that infection spreads in the field through the transport of infected seedlings (Vinha, F). people, Sci. Agrar. Parana., 280-288 (2020).
[0059] breeding Sugarcane weevilThe larvae presented a challenge to the experimental design because their larval stage lasted 26 to 50 days, with a larval survival rate of only 35.8%. Among larvae entering the pupal stage, the survival rate was as high as 93%, with the pupal stage lasting 5 to 13 days (Degaspari, N., et al., Biologia de Sphenopherus levis Vaurie, 1978 (Col.:Curculionidade), em dieta artificial e no campo. Pesquisa Agropecuária Brasileira, Brasília, DF, v. 22, n. 3, p. 553-558, 1987). These survival challenges and the long duration of metamorphosis resulted in the insect population growing slowly to a suitable, sustainable sample size.
[0060] The potential insecticidal activity of the proposed proteins against Hemiptera, Diptera, *Miscanthus* species, and / or other piercing-sucking insects (e.g., Orthoptera or Thysanoptera) was considered. Diptera include, but are not limited to, *Leymus* species, such as *Leymus trifoliata*. L. trifolii (leafminer) and American serpentine leafminer ( L. sativae (Vegetable leafminer) Scrobipalpula spp., for example S. absoluta (Tomato leafminer) Delia spp., for example, the gray ground fly ( D. platura (seedcorn maggot) D. brassicae (cabbage maggot) and D. radicum (cabbage rootfly) Psilia spp .,For example P. rosae (Carrot rust fly); and the genus *Spotted leaf fly* (…). Tetanops spp .),For example T. myopaeformis (Beetroot maggot).
[0061] The potential activity of the insecticidal proteins disclosed herein against Lepidoptera insects has been further considered. Lepidoptera insects include, but are not limited to, any Lepidoptera insects currently known or later identified, including insect species in the suborders Zeugloptera, Glossata, and Heterobathmiina, and any combination thereof. Typical Lepidoptera insects include, but are not limited to: species of the genus *Ostrinia*, such as *O. nubilalis* (European corn borer); species of the genus *Plutella*, such as *P. xylostella* (diamondbackmoth); species of the genus *Spodoptera*, such as *S. frugiperda* (fall armyworm), *S. ornithogalli* (yellow-striped armyworm), *S. praefica* (western yellow-striped armyworm), *S. eridania* (southern armyworm), and *S. exigua* (beet armyworm); and species of the genus *Agrotis*, such as *A. ipsilon* (black cutworm), *A. segetum* (common cutworm), and *A.*. Gladiaria (claybacked cutworm) and A. orthogonia (pale western cutworm); Striacosta spp., e.g. S. albicosta (western bean cutworm); Helicoverpa spp., e.g. H. zea (corn earworm), H. punctigera (native cotton bollworm), S. littoralis (Egyptian cotton leafworm), and H. armigera (cottonbollworm); Heliothis spp., e.g. H. virescens (tobacco budworm); Diatraeaspp., e.g. D.*Graniosella* (southwestern corn borer) and *D. saccharalis* (sugarcane borer); species of *Trichoplusia*, such as *T. ni* (cabbage looper); *Sesamia* spp., such as *S. nonagroides* (Mediterranean corn borer); *Pectinophora* spp., such as *P. gossypiella* (pinkbollworm); *Cochylis* spp., such as *C. hospes* (banded sunflowermoth); *Manduca* spp., such as *M. sexta* (tobacco hornworm) and *M. quinquemaculata* (tomato hornworm); *Elasmopalpus* spp., e.g., *E. lignosellus* (lesser cornstalk borer); *Pseudoplusia* spp., e.g., *P. includens* (soybean looper); *Anticarsia* spp., e.g., *A. gemmatalis* (velvetbean caterpillar); *Plathypena* spp., e.g., *P. scabra* (green cloverworm); *Pieris* spp., e.g., *P. brassicae* (cabbage butterfly); *Papaipema* spp., e.g., *P. nebris* (stalk borer); *Pseudaletia* spp., e.g., *P. unipuncta* (common armyworm); *Peridroma* spp., e.g., *P. saucia* (Peridroma moth). saucia); Keiferia spp., e.g. K. lycopersicella (tomato pinworm); Artogeia spp., e.g. A. rapae (imported cabbage worm); Phthorimaea spp., e.g. P.operculella (potato tuberworm); Crymodes spp., e.g., C. devastator (glassy cutworm); Feltia spp., e.g. F. ducens (Dingy cutworm); and Telchin spp., such as the giant stem borer ( T. licus In one aspect of this embodiment, the insecticidal protein disclosed herein is active against blackcutworm, sugarcane borer, and / or southwestern corn borer.
[0062] The preferred developmental stage for testing insecticidal activity is the larvae or immature forms of the aforementioned insect pests. The insects can be reared in complete darkness at approximately 20°C to approximately 25°C and a relative humidity of approximately 30% to approximately 70%. Bioassays can be performed as described by Czapla and Lang (1990) J. Econ. Entomol. 83(6):2480-2485. Methods for rearing insect larvae and performing bioassays are well known to those skilled in the art.
[0063] Those skilled in the art are familiar with various bioassay techniques for assessing insecticidal activity and efficacy. Common protocols involve adding an experimental compound to a pest's food source in a sealed container. Common measures of insecticidal activity and efficacy include changes in mortality or other behaviors. Insectic activity can be measured by (but is not limited to) mortality, weight loss, attraction, repellency, and other behavioral and physiological changes following feeding and adequate exposure.
[0064] Cry protein from Bacillus thuringiensis
[0065] Bacillus thuringiensis (Bt) strains expressing insecticidal toxins have been used as biopesticides. This is because they produce delta-endotoxins, also known as crystalline toxins or cry proteins. Bt toxins are a class of insecticidal proteins that are synthesized as protoxins and crystallized as parasporal inclusions. When ingested by insect pests, their microcrystalline structure is dissolved by the alkaline pH of the insect's midgut, and the protoxin is cleaved by intestinal proteases to produce the active toxin. The activated Bt toxin binds to receptors in the insect's intestinal epithelium, causing membrane damage and associated swelling and dissolution of the insect's gut. The insect dies from starvation and septicemia. See, for example, Li et al. (1991) Nature 353:815-821. Any bacterial host cell expressing the novel nucleic acid sequences disclosed herein and producing crystalline proteins is considered useful, such as Bacillus thuringiensis (Bt). B. thuringiensis ), Bacillus megaterium, Bacillus subtilis, Escherichia coli or Pseudomonas species.
[0066] The classification of various delta-endotoxins is based on their activity profiles and sequence homology. Until 1990, the major categories were determined by their activity profiles, with Cry1 proteins active against Lepidoptera (moths and butterflies), Cry2 proteins active against both Lepidoptera and Diptera (flies and mosquitoes), Cry3 proteins active against Coleoptera (beetles), and Cry4 proteins active against Diptera (Hofte and Whitely, 1989, Microbiol. Rev. 53: 242-255). In 1998, a new nomenclature was developed that systematically classified Cry proteins based on amino acid sequence homology rather than activity against certain insect species (Crickmore et al. 1998, Microbiol. Molec. Biol. Rev. 62: 807-813). The Bacillus thuringiensis δ-endotoxin Nomenclature Committee maintains a database of Cry protein nomenclature and the perceived cladistic relationships between various proteomes, accessible at: http: / / www.lifescissexac.uk / home / Neil_Crickmore / Bt / .
[0067] Comparison of the amino acid sequences of Cryotoxins with different specificities further revealed five highly conserved sequence segments. The structure of Cryotoxins comprises three distinct domains, from the N-terminus to the C-terminus: a cluster of seven α-helices involved in pore formation (referred to as "domain I" or "domain 1"), three antiparallel β-sheets involved in cell binding (referred to as "domain II" or "domain 2"), and a β-sandwich (referred to as "domain III" or "domain 3"). The location and characteristics of these domains are known to those skilled in the art. See, for example, Li et al. (1991), ibid., and Morse et al. (2001), Structure 9:409-417.
[0068] Bt (Bacillus thuringiensis) protein
[0069] Certain aspects of this disclosure relate to a chimeric Bt protein comprising portions of both a Cry8 protein (e.g., Cry8Ba1 protein) and a Cry1 protein (e.g., Cry1Ad protein). Specifically, this disclosure relates to a chimeric Cry protein designated “SCW112” and its recombinant and / or modified variants. The chimeric protein of this disclosure comprises portions of both the Cry8Ba1 and Cry1Ad proteins. For example, the protein designated SCW112 (SEQ ID NO: 2) is a fusion of SCW35 (Cry8Ba1; SEQ ID NO: 1) and SCW39 (Cry1Ad; SEQ ID NO: 3), wherein domains I and II of SCW35 are fused with domain III of SCW39. Furthermore, the N-terminal and C-terminal tail regions of SCW112 are truncated. This disclosure covers various variants of SCW112, including fragments, deletions, substitutions, and other modifications. In addition, this disclosure also includes chimeric proteins, including different domains of SCW35 (e.g., domain III) and different domains of SCW39 (e.g., domain I and domain II), different combinations of domains of SCW35 and SCW39, and combinations of fragments of SCW35 and SCW39.
[0070] Specifically, this disclosure relates to Cry8-type Bt proteins. Studies have shown that Cry8 proteins have insecticidal activity against Coleoptera pests, such as those in the families Scarabaeidae, Aphididae, and Leaf Beetle. To date, approximately 60 Cry8 genes have been reported (Naveenarani M. et al., 2022). Cry8 proteins are 1160-1210 amino acids in length and have a molecular weight of 128-137 kDa. Among them, the isolated Cry8Aal and Cry8Bal have insecticidal activity against some pests in the family Scarabaeidae (Michaels T. et al., 1994, US Patent No. 5554534) and have been used in the development of transgenic insect-resistant corn (Abad A. et al., 2002, WO). (02 / 34774A2). Despite this research history, Bt protein members of the Cry8 family have not yet been found effective against many coleopteran pests because Bt proteins typically exhibit insecticidal effectiveness patterns specific to insect taxonomic units. Specifically, previously known coleopteran toxic proteins from the Cry3, Cry7, and Cry8 families have been found to be effective against many coleopteran pests. Sugarcane weevil Non-toxic (data not shown).
[0071] Many Cry proteins have been successfully used for transgenic defense in various crops, with an early application being the transformation of Cry1Ab, Cry1Ac, and Cry2A into corn (Huang, F). people, Science. 284(5416), 965–967. 1999). To date, more than 100 Cry1A genes have been reported, including at least fourteen Cry1Ab genes, at least thirty-nine Cry1Ac genes, and at least two Cry1Ad genes (Crickmore, N. “Full list of delta-endotoxins”; accessed March 29, 2023; available at www.lifesci.sussex.ac.uk / home / Neil_Crickmore / Bt / toxins2.html). For example, Cry1Aa, Cry1Ab, Cry1Ac, Cry1B, and Cry1F are known to have activity against lepidopteran insects, and are known to have protoxin forms of 130–140 kDa to toxic protein forms of approximately 60–70 kDa (see, for example). Hart et al. (2016, US20160304569A1) also disclosed a chimeric protein called “2OL-10” (SEQ ID NO: 42 of Hart et al.) containing the N-terminal portion of Cry3A055 (known for its activity against coleopteran pests) and the C-terminal portion of Cry1Ab (known for its activity against lepidopteran pests). However, Hart et al. found that “adding only 25% of the Cry1Aa sequence disrupted the activity against coleopteran insects to which the parent Cry3A was active”, and stated that “hybrid proteins prepared by fusing portions of coleopteran active Cry proteins (e.g., Cry3A) and lepidopteran active Cry proteins (e.g., Cry1A) will not have activity against coleopteran insects” (Hart et al.). et al. 2016, US20160304569A1, paragraph
[0015] ). This disclosure by Hart et al. indicates that a chimeric protein between Cry8Ba1 and Cry1A proteins would eliminate the toxicity of either Cry8 or Cry1 proteins to coleopteran pests, and that such a chimera would therefore be ineffective against coleopteran pests.
[0072] In some aspects, this disclosure relates to a chimeric polypeptide having: a) a sequence comprising domain I and domain II of the Cry8Ba1 protein; and b) a domain III sequence of the Cry1A protein. In some embodiments of this aspect, the domain III sequence is derived from the Cry1Ad protein. In some embodiments of this aspect, the polypeptide comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity with SEQ ID NO: 2, and / or a variant or fragment thereof. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the sequences comprising domains I and II of the Cry8Ba1 protein include sequences having at least 80%, at least 83%, at least 85%, at least 87%, at least 90%, at least 93%, at least 95%, or at least 97% sequence identity with SEQ ID NO: 1, and the sequence comprising domain III of the Cry1A protein includes sequences having at least 80%, at least 83%, at least 85%, at least 87%, at least 90%, at least 93%, at least 95%, or at least 97% sequence identity with SEQ ID NO: 3. In some embodiments of this aspect, the polypeptide comprises sequences having at least 90% sequence identity with SEQ ID NO: 1 and sequences having at least 90% sequence identity with SEQ ID NO: 3. In some embodiments of this aspect, the polypeptide comprises the sequences of SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 and / or SEQ ID NO: 22, and / or variants or fragments thereof.
[0073] In another aspect, this disclosure relates to a chimeric polypeptide comprising: at least one amino acid substitution, deletion, and / or insertion compared to SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, and / or variants or fragments thereof; and at least one amino acid substitution, deletion, and / or insertion compared to SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 22, and / or variants or fragments thereof. 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, and / or variants or fragments thereof, with at least one addition at the N-terminus or C-terminus; and at least one domain exchange compared to SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, and / or variants or fragments thereof;At least one of the following is truncated compared to SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, and / or variants or fragments thereof; and / or is truncated compared to SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 22, and / or variants or fragments thereof. 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, and / or variants or fragments thereof, with at least one other variation. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polypeptide has insecticidal activity against at least one agricultural insect pest. In some embodiments of this aspect, the at least one insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from:; Sugarcane weevil , Sphenophorus maidis Cotton boll weevil ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .
[0074] Certain aspects of this disclosure relate to polynucleotides encoding polypeptides of any of the foregoing embodiments. In some embodiments of this aspect, the polynucleotide comprises the sequence of SEQ ID NO: 4. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polynucleotide has codons optimized for expression in agriculturally important crops. In some embodiments of this aspect, the agriculturally important crop is sugarcane, and the polynucleotide comprises SEQ ID NO: 5. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polynucleotide is a non-genomic polynucleotide. In some embodiments of this aspect, the polynucleotide is a synthetic polynucleotide, and / or said polynucleotide is cDNA.
[0075] Certain aspects of this disclosure relate to an isolated construct or expression cassette comprising a nucleotide or a polynucleotide encoding a polypeptide of any of the foregoing embodiments, wherein the nucleotide or polynucleotide is operatively linked to a promoter and optionally operatively linked to a heterologous regulatory element. In some embodiments of this aspect, the polypeptide comprises SEQ ID NO: 2. In some embodiments of this aspect, the polynucleotide comprises SEQ ID NO: 4 or SEQ ID NO: 5. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the promoter is selected from constitutive promoters, inducible promoters, and tissue-specific promoters.
[0076] This disclosure provides a chimeric protein named SCW112 (SEQ ID NO: 2), variants thereof, and fragments thereof. The nucleotide sequence encoding SCW112 is shown in SEQ ID NO: 4 and SEQ ID NO: 5 (optimized for sugarcane expression codons).
[0077] In some embodiments (which may be combined with any of the foregoing embodiments), the insecticidal Bt protein is a polypeptide, and / or a variant or fragment thereof, having at least 80% sequence identity with SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22. In a further embodiment (which may be combined with any of the foregoing embodiments), the insecticidal Bt protein is a polypeptide, and / or a variant or fragment thereof, that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22.
[0078] Not wishing to be bound by theory, we believe that insecticidal activity can be maintained if at least domains I and II of the proteins disclosed herein (e.g., Cry8Ba1, SCW35) are present and bind to domain III of different Bt proteins (e.g., Cry1Ad, SCW39). This disclosure contemplates chimeras incorporating two or more of the protein domains disclosed herein. Variants and / or fragments of the proteins disclosed herein include, but are not limited to, homologous (or partially homologous) sequences and peptides based on sequences selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and / or derived from polynucleotides altered by site-directed mutagenesis, domain exchange, DNA shuffling, or any other method known in the art.
[0079] In one embodiment, this disclosure covers an engineered hybrid insecticidal protein (i.e., a chimeric protein) comprising an amino acid sequence from a first Bacillus thuringiensis (Bt) Cry protein fused to an amino acid sequence from a second Bt Cry protein, wherein the second Bt Cry protein is different from the first Bt Cry protein. In some embodiments, the first Bt Cry protein is a Cry8 protein (e.g., Cry8Ba1 protein), and the second Bt Cry protein is a Cry1 protein (e.g., Cry1Ad protein). The amino acid sequences of the first and second Bt Cry proteins used for the engineered chimeric protein may include complete or incomplete variable and conserved regions (including domains I and II) of the first Cry protein, and complete or incomplete variable and conserved regions (including domain III) of the second Cry protein. In one embodiment, such a chimeric protein has targeting at least the sugarcane weevil or sugarcane beetle ( Sugarcane weevil )active.
[0080] It is known in the art that the possibility of creating chimeric proteins with enhanced properties by rearranging the structural domains of a variety of naturally occurring insecticidal crystal proteins known in the art is extremely low. See, for example, Jacqueline S. Knight, et al., “A Strategy for Shuffling Numerous Bacillus thuringiensis Crystal Protein Domains.” J. Economic Entomology, 97 (6) (2004): 1805-1813.
[0081] In other embodiments, the isolated and / or recombinant proteins disclosed herein can be used as recombinant proteins expressed in transgenic plants, microorganisms, and fungi. Thus, a recombinant microorganism or fungus expressing an active insecticidal protein and a transgenic plant are provided. The method involves transforming an organism with a nucleic acid sequence encoding an insecticidal polypeptide. Specifically, these insecticidal polynucleotides can be used to prepare plant, microorganism, fungal, and other animal cells with insecticidal activity. Therefore, the present invention provides transformed bacteria, yeast, fungi, plants, plant cells and animal cells, plant tissues, plant parts, propagules, organs, tissues, embryos, and seeds. Another embodiment of this disclosure includes a composition comprising insecticidal nucleic acids and / or insecticidal proteins incorporated into or expressed in a microorganism, fungus, or plant. The embodiments herein can be used in agriculture as methods for protecting plants from insect pests and for controlling insect pests or insect pest populations.
[0082] As used herein, the terms “insecticide activity,” “insecticide gene,” or “insecticide polynucleotide” refer to the nucleotide sequence encoding a polypeptide that exhibits insecticidal activity. As used herein, the term “insecticide activity” refers to the ability of a substance (e.g., a polypeptide) to inhibit the growth, feeding, or reproduction of insect pests and / or kill insect pests. “Insecticide polypeptide,” “insecticide protein,” or “insect toxin” are intended to refer to proteins with insecticidal activity.
[0083] As used herein, the terms “insecticide activity” and “pesticide efficacy” are synonymous and refer to the activity of an organism or substance (e.g., a protein) that can be measured by, but is not limited to, pest mortality, pest weight loss, pest repellency, and other behavioral and bodily changes following appropriate feeding and exposure. In this way, insecticide activity affects at least one measurable parameter of pest fitness. Assessments of insecticide activity are well known in the art. See U.S. Patent Nos. 6,570,005 and 6,339,144. As used herein, “insecticide efficacy” refers to the level of insecticide or pesticidal activity exhibited by an organism or substance. Generally, higher insecticide efficacy corresponds to lower pest fitness and higher pest mortality.
[0084] The isolated and / or recombinant proteins disclosed herein include a variety of embodiments that can be conveniently used as insecticidal compositions for exogenous applications, such as for topical and / or systemic application to field crops, forage grasses, fruits and vegetables, and ornamental plants, and / or as recombinant proteins for expression in transgenic plants or microorganisms. The insecticidal compositions of the present invention will be described in more detail in the next section (“Compositions Containing SCW Proteins”). In one embodiment, the biological insecticidal composition comprises a water-dispersible granule. The granule comprises one or more of the SCW proteins disclosed herein. In another embodiment, the insecticidal composition comprises an oil-flowable suspension of one or more of the SCW proteins disclosed herein.
[0085] Orally acceptable or orally applicable insect feeds in which the insecticidal proteins of this disclosure can be incorporated are well known in the art, as described herein. These can be contained in any composition that can be orally ingested by the target insect pest, for example, in the form of cell extracts, cell suspensions, cell homogenates, cell lysates, cell supernatants, cell filtrates, cell precipitates, and / or protein extracts or purified proteins or fusion proteins of this disclosure, when the proteins or fusion proteins of this disclosure are expressed from host cells (e.g., plant, fungal, or bacterial cells). In one embodiment, a composition containing the insecticidal peptides of this disclosure can be formulated as a powder, granule, pellet, granule, spray, emulsion, gel, or solution, any of which can be topically applied to a matrix that is, or can be, an orally ingestible, orally acceptable, or orally applicable feed for the target insect pest.
[0086] In some embodiments, controlling insect pests includes feeding the composition to the pests, applying the composition to the outer surface of the pests, applying the composition to plants that the pests feed on, applying the composition to soil where the pests may be present, applying the composition to a general area of the pest population, or injecting the composition into the plant or the pest. In one specific embodiment, the plant is a sugarcane plant. In some embodiments, the insect pest population is reduced by 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%. In some embodiments, insect infestation is reduced by 50% to 100% compared to methods of treating insect infestation using SCW proteins without the exogenous application of this disclosure.
[0087] SCW protein in expression cassette
[0088] Certain aspects of this disclosure relate to an isolated construct or expression cassette comprising a nucleotide or polynucleotide encoding a polypeptide of any of the foregoing embodiments, wherein the nucleotide or polynucleotide is operatively linked to a promoter and optionally operatively linked to a heterologous regulatory element. In some embodiments of this aspect, the polypeptide comprises SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 and / or SEQ ID NO: 22, and / or variants or fragments thereof. In some embodiments of this aspect, the polynucleotide includes SEQ ID NO: 4 or SEQ ID NO: 5. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the promoter is selected from constitutive promoters, inducible promoters, and tissue-specific promoters.
[0089] In another aspect, this disclosure provides a method for preparing an expression cassette comprising a nucleic acid sequence encoding one of the SCW proteins of this disclosure. Methods for preparing expression cassettes are well known in the art. Expression cassettes are generally designed with a promoter at the 5' end of the expression cassette, upstream of the desired polynucleotide segment encoding the protein of this disclosure, including SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, and variants, fragments, and combinations thereof.
[0090] The promoter may consist of multiple different promoter elements that are operatively linked to initiate transcription of a sequence encoding a protein disclosed herein. The DNA sequence comprising the promoter-protein-coding DNA may be operatively linked at its 3' end to a transcription termination signal sequence that functions in *E. coli* and / or Bt cells to produce a recombinant DNA construct.
[0091] On one hand, the aforementioned recombinant DNA construct is contained in an expression cassette for expression in cells. The expression cassette is designed with a promoter upstream of the desired polynucleotide segment encoding the protein of this disclosure at its 5' end. The 5' untranscribed DNA may contain a promoter, which may consist of multiple different promoter and enhancer elements operatively linked to initiate transcription of a downstream sequence, including a sequence encoding the polypeptide of this disclosure. One or more transcribed but not translated DNA sequences may be operatively linked to the 3' end of the promoter in the expression cassette, including a leader sequence and / or intron sequences. The intron sequences are optionally located at the 3' end of the leader sequence, or in some cases within an open reading frame encoding the desired protein. A polynucleotide segment encoding an optional translocation polypeptide (e.g., a signal peptide or chloroplast transport peptide) may be inserted into the 5' end of the protein-coding sequence of this disclosure to localize the protein of this disclosure to a specific subcellular location. The nucleotide sequence encoding the protein disclosed herein is optionally operably located within the above-described expression cassette and operably linked with any necessary polyadenylation (polyA) and / or transcription termination sequences that function in the cell.
[0092] As used herein, an "expression cassette" refers to a nucleic acid sequence capable of directing the expression of a specific nucleotide sequence in a suitable host cell. It contains a promoter operatively linked to the target nucleotide sequence, which in turn is operatively linked to a termination signal. It typically also contains the sequence required for the correct translation of the nucleotide sequence. An expression cassette containing the target nucleotide sequence may have at least one component that is heterologous to at least one of its other components. Expression cassettes may also be naturally occurring but obtained through recombinant processes for heterologous expression. However, typically, expression cassettes are heterologous relative to the host; that is, the specific nucleic acid sequence of the expression cassette is not naturally present in the host cell and must be introduced into the host cell or a progenitor cell of the host cell through a transformation event. Expression of the nucleotide sequence in the expression cassette can be controlled by a constitutive promoter or an inducible promoter, the latter initiating transcription only when the host cell is exposed to certain specific external stimuli. In the case of multicellular organisms such as plants, the promoter may also be tissue- or organ- or developmentally stage-specific.
[0093] Expression cassettes containing the target nucleotide sequence can be chimeric, meaning that at least one component is heterologous relative to at least one of its other components. Expression cassettes can also be expression cassettes containing a natural promoter driving their native gene; however, they are obtained in a recombinant form that can be used for heterologous expression. This use of the expression cassette means that it is not naturally present in the cell in which it is introduced. The term "isolated nucleic acid molecule" as used herein refers to a synthetically produced nucleic acid molecule that exists outside its natural environment and is therefore not a natural product. Isolated nucleic acid molecules can exist in purified form or in non-natural environments, such as, but not limited to, recombinant microbial cells, plant cells, plant tissues, or plants.
[0094] The aforementioned elements are arranged sequentially and can be used in various combinations depending on the desired expression outcome. Other aspects of this disclosure include an isolated nucleic acid sequence or construct containing a promoter operatively linked to a coding region encoding, for example, a recombinant SCW112 protein. Other aspects of this disclosure include an isolated nucleic acid sequence or construct containing a promoter operatively linked to a coding region encoding, for example, a chimeric Cry protein having the sequence SEQ ID NO: 2. In some embodiments, the nucleic acid sequence nucleotide includes SEQ ID NO: 4. Such coding regions are typically operatively linked to a transcription termination region, thereby enabling the promoter to drive transcription of the coding region, thereby allowing the cell to produce the recombinant protein in vivo.
[0095] In one embodiment, this disclosure provides isolated or recombinant polynucleotides encoding the insecticidal polypeptides disclosed herein, wherein said polynucleotides have codons optimized for expression in crops. In one aspect, the crop is sugarcane, and the polynucleotide comprises SEQ ID NO: 5.
[0096] Recombinant polynucleotides can be used to construct expression vectors for subsequent transformation into target organisms, to develop probes for isolating other homologous (or partially homologous) genes, and to generate altered SCW polypeptides by methods known in the art, such as site-directed mutagenesis, domain exchange, or DNA shuffling. In a specific embodiment, the polynucleotide sequence is SEQ ID NO: 4 or SEQ ID NO: 5.
[0097] In some embodiments, the SCW peptide comprises an amino acid sequence derived from the full-length nucleic acid sequence disclosed herein, as well as shorter amino acid sequences resulting from the use of alternative downstream start sites or from processing to produce a shorter protein with insecticidal activity. Processing may occur in the organism expressing the protein or in pests that have ingested the protein. Therefore, isolated or recombinant nucleic acid sequences conferring insecticidal activity are provided herein. The amino acid sequence of the SCW peptide is also provided herein. Proteins translated from these genes enable cells to control or kill pests that ingest them.
[0098] Molecular biology and biotechnology methods
[0099] Any method known in the art for modifying cellular DNA (e.g., genomic DNA and organelle DNA) and producing proteins can be used to practice the inventions disclosed herein.
[0100] The term "recombinant" or "modified nucleic acid" refers to a polynucleotide synthesized by artificially manipulating isolated polynucleotide segments through genetic engineering or chemical synthesis, combining two originally separate sequence segments. In this way, polynucleotide segments with desired functions can be linked together to produce the desired functional combination.
[0101] In some implementations, a non-integrative expression system can be used to induce the expression of one or more introduced genes. The expression system (expression vector) may include, for example, an origin of replication or autonomous replication sequence (ARS) and expression control sequences, promoters, enhancers, and necessary processing information sites, such as ribosome binding sites, RNA splicing sites, polyadenylation sites, transcription termination sequences, and mRNA stabilizing sequences. Where appropriate, it may also contain signal peptides of secretory polypeptides from the same or related species, which enable the protein to cross and / or remain in the cell membrane, cell wall, or be secreted from the cell.
[0102] The screening and molecular analysis of recombinant strains and / or plants or plant cells and materials disclosed herein can be performed using nucleic acid hybridization techniques. Hybridization procedures can be used to identify polynucleotides with sufficient homology to the useful subject regulatory sequences taught herein, such as those modified using the techniques described herein. Specific hybridization techniques are not essential to this invention. These techniques can be readily applied by those skilled in the art as hybridization techniques have been improved. Hybridization probes can be labeled with any suitable markers known to those skilled in the art. Hybridization and washing conditions (e.g., temperature and salt concentration) can be varied to alter the stringency of the detection threshold. For further guidance on hybridization conditions, see, for example, Sambrook et al. (1989) (see below) or Ausubel et al. (1995) Current Protocols in Molecular Biology, John Wiley & Sons, NY, NY).
[0103] Similarly, screening can be performed using peptide-based techniques, including enzyme-linked immunosorbent assay (ELISA), fluorescence detection (if fluorescent labeling is used), or Western blotting. Those skilled in the art will understand that any available peptide-based technique can be used for the screening aspects or implementations disclosed herein.
[0104] In addition, polymerase chain reaction (PCR) can be used for screening and molecular analysis of genetically modified strains and / or plants or plant cells and materials, as well as for creating desired isolated nucleic acids. PCR is a repetitive, enzymatic, primerized method for synthesizing nucleic acid sequences. This procedure is well known and commonly used by those skilled in the art (see Mullis, U.S. Patents 4,683,195, 4,683,202, and 4,800,159; Saiki et al. (1985) Science 230: 1350-1354). PCR is based on the enzymatic amplification of a target DNA fragment flanked by two oligonucleotide primers that hybridize to the opposite strand of the target sequence. The 3' ends of the primers face each other. Repeated cycles of template denaturation, primer annealing to their complementary sequences, and extension of the annealed primers in DNA polymerase result in the amplification of the segment defined by the 5' end of the PCR primer. Since the extension product of each primer can serve as a template for another primer, each cycle effectively doubles the amount of DNA template produced in the previous cycle. This leads to the exponential accumulation of specific target fragments, reaching millions of times within hours. This can be achieved by using thermostable DNA polymerases, such as those from thermophilic bacteria. Thermus aquaticus The Taq polymerase isolated from it allows for a fully automated amplification process. Other available enzymes are known to those skilled in the art.
[0105] The nucleic acids and proteins disclosed herein may also contain homologs of the specific disclosed sequences. Homology or genetic identity can be 40%–100%. In some cases, such homology or genetic identity is greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. Those skilled in the art can readily determine the degree of homology or identity required for any intended use of the sequence. The percentage of sequence identity between the two nucleic acids used herein was determined using algorithms known in the art, such as those disclosed in Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264–2268, with modifications thereof found in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873–5877. Such algorithms are incorporated into the NBLAST and XBLAST procedures of Altschul et al. (1990) J. Mol. Biol. 215:402–410. Use the NBLAST procedure for BLAST nucleotide searching with a score of 100 and a word length of 12 to obtain nucleotide sequences with the desired percentage of sequence identity. For vacancy alignments used for comparison, use Gapped BLAST, as described in Altschul et al. (1997) Nucl. Acids. Res. 25:3389-3402. When using the BLAST and GappedBLAST procedures, use the default parameters for the respective procedures (NBLAST and XBLAST). See www.ncbi.nih.gov.
[0106] Plant cells and all forms of plants are also preferred targets for coatings and other applications of the insecticidal compositions disclosed herein. Monocotyledonous plant cells can be used, particularly including sugarcane (e.g., species of the genus *Saccharum*). SaccharumCells can be derived from tissue types including embryos, callus, leaf discs, and other explants. The plant cells targeted by the insecticidal composition can be differentiated or undifferentiated (e.g., callus, undifferentiated callus, immature and mature embryos, immature zygotic embryos, immature cotyledons, hypocotyls, suspension culture cells, protoplasts, leaves, leaf cells, root cells, phloem cells, and pollen). Plant cells include, but are not limited to, cells derived from: seeds, suspension cultures, explants, immature embryos, embryos, zygotic embryos, somatic embryos, embryogenic callus, meristems, somatic meristems, organogenic callus, protoplasts, leaf bases, leaves from mature plants, leaf tips, immature inflorescences, cotyledons, immature cotyledons, hypocotyls, meristematic zones, callus, cells from leaves, cells from stems, cells from roots, cells from buds, gametophytes, sporophytes, pollen, and microspores. Plant cells also include various forms of cultured cells (e.g., single cells, protoplasts, embryos, and callus), wherein the protoplasts or cells are generated from plant parts selected from leaves, stems, anthers, pistils, roots, fruits, flowers, seeds, cotyledons, hypocotyls, embryos, or meristematic cells. In this document, recombinant host cells refer to cells that have been genetically modified to contain isolated or recombinant nucleic acid molecules, or contain one or more genes to produce at least one recombinant protein. Nucleic acids encoding the SCW proteins of this disclosure can be introduced by any method known in the art suitable for a particular cell type, including but not limited to transformation, liposome transfection, electroporation, or any other method known to those skilled in the art.
[0107] This invention provides a method for detecting any nucleotide or polypeptide in the foregoing embodiments, comprising the following steps: a) Obtain plant material samples for analysis; b) Extract DNA from the sample; c) Provide primer pairs that contain at least forward and reverse primers; d) Amplify the region between primer pairs; and e) Detecting the presence of amplification products; or including the steps (a) Obtain plant material samples for analysis; (b) Extract DNA or RNA from the sample; (c) Provide a probe or combination of probes designed to bind to a polynucleotide comprising the foregoing embodiments; (d) Hybridize the probe with the sample; and (e) Actual hybridization of the detection probe.
[0108] Antibody
[0109] This invention also covers antibodies against the SCW peptide or variants or fragments thereof of this embodiment. The antibodies disclosed herein include polyclonal antibodies and monoclonal antibodies, as well as antibody fragments that retain their ability to bind to the SCW peptide. An antibody, monoclonal antibody, or fragment thereof is said to be able to bind to a molecule if it can specifically react with the molecule, thereby causing the molecule to bind to the antibody, monoclonal antibody, or fragment thereof.
[0110] This invention provides a kit for detecting the presence of an SCW peptide in a sample or for detecting the presence of a nucleotide sequence encoding an SCW peptide in a sample. In one embodiment, the kit provides antibody-based reagents for detecting the presence of an SCW peptide in a sample. In another embodiment, the kit provides labeled nucleic acid probes for detecting the presence of one or more polynucleotides encoding an SCW peptide. The kit is accompanied by suitable reagents and controls for carrying out the detection method, as well as instructions for use.
[0111] This invention provides a kit for detecting one or more polynucleotides or peptides in the materials of the foregoing embodiments. In one embodiment, the kit includes tools for detecting the presence of one or more polynucleotides in the foregoing embodiments and / or tools for detecting one or more peptides in the foregoing embodiments, wherein the tools include primer pairs designed for binding to the polynucleotide, or wherein the tools include primer pairs and probes designed for binding to the polynucleotide, and / or wherein the tools include antibodies for detecting one or more peptides in the foregoing embodiments.
[0112] Composition including SCW protein and related nucleotides
[0113] Another aspect of this disclosure relates to an insecticidal composition comprising: (i) one or more polypeptides of any of the foregoing embodiments, wherein the concentration of said one or more polypeptides is sufficient to control at least one agricultural insect pest; (ii) one or more polynucleotides of any of the foregoing embodiments, wherein said polynucleotides have codons optimized for expression in agriculturally important crops; and / or (iii) one or more isolated constructs or expression cassettes of any of the foregoing embodiments. In some embodiments of this aspect, said one or more polypeptides comprise SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 and / or SEQ ID NO: 22, and / or variants or fragments thereof. In some embodiments of this aspect, the one or more polynucleotides comprise SEQ ID NO: 4 or SEQ ID NO: 5. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the at least one insect pest is a coleopteran pest. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), when the composition is applied to sugarcane plants or sugarcane plantations, the concentration of the one or more polypeptides present is sufficient to control at least one agricultural insect pest in or on sugarcane plants. Some embodiments of this aspect (which may be combined with any of the foregoing embodiments) further comprise one or more inert ingredients, acceptable carriers, surfactants or adjuvants commonly used in the formulation field, or other components that facilitate product handling and application to specific target pests. Suitable carriers and adjuvants may be solid or liquid and correspond to substances commonly used in formulation technology, such as natural or recycled minerals, solvents, dispersants, wetting agents, thickeners, binders, or fertilizers. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition further comprises one or more inert ingredients and / or acceptable carriers.In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste (e.g., for coating or smearing), colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier (e.g., polymeric material). In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as an orally acceptable, orally applicable, or orally ingestible feed for insect pests. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated for direct soil application and / or direct potting substrate application. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a controlled-release formulation. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), control of coleopteran pests includes: a) reducing pest infestation by 40%, 50%, 60%, 70%, 80%, 90%, or 100%; or b) increasing pest mortality by 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the coleopteran pests are selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil
[0114] ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabaeidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil Such formulations can be prepared by conventional methods, such as drying, lyophilizing, homogenizing, extracting, filtering, centrifuging, sedimentation, or concentrating cell cultures containing the polypeptides.
[0115] The compositions disclosed herein comprise at least one SCW112 protein disclosed herein, or a mutant, recombinant, or otherwise modified version thereof. In some embodiments, the composition further comprises one or more other Bt proteins, such as Cry8 protein, Cry1 protein, or any other Cry protein. In some embodiments, the compositions disclosed herein further comprise additional active agents, such as chemical mixtures (e.g., insecticidal chemicals), insecticidal proteins (e.g., Bt proteins), or biocontrol agents (e.g., Bacillus thuringiensis). In some embodiments, the compositions disclosed herein further comprise agricultural-related agents (i.e., agrochemicals). In some embodiments, the compositions disclosed herein comprise one or more agrochemicals, including but not limited to herbicides, insecticides, fungicides, bactericides, nematicides, molluscicides, acaricides, plant growth regulators, harvesting aids, and fertilizers.
[0116] In one embodiment, the formulation of the bio-insecticide composition can be prepared by a variety of methods well known in the art, including but not limited to drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, or concentration. In any such orally acceptable, orally applicable, orally ingestible bait intended for consumption by target insect pests, the concentration of the protein disclosed herein should be at least about 0.001% to about 99% of the total weight of the composition. In one embodiment, the concentration of the protein disclosed herein should be about 1 part protein to 4 parts target insect pest bait.
[0117] The above composition can be obtained by adding surfactants, inert carriers, preservatives, humectants, feeding stimulants, attractants, encapsulating agents, adhesives, emulsifiers, dyes, UV protectants, buffers, flow aids or fertilizers, micronutrient donors or other formulations that affect plant growth. Suitable surfactants include, but are not limited to, anionic compounds, such as carboxylates, including metal carboxylates; carboxylates of long-chain fatty acids; N-acylsarcosine salts; monoesters or diesters of phosphates and fatty alcohol ethoxylates, or salts of such esters; fatty alcohol sulfates, such as sodium dodecyl sulfate, sodium octadecyl sulfate, or sodium cetyl sulfate; ethoxylated fatty alcohol sulfates; ethoxylated alkylphenol sulfates; lignin sulfonates; petroleum sulfonates; alkylaryl sulfonates, such as alkylbenzene sulfonates or lower alkylnaphtalene sulfonates, such as butylnaphtalene sulfonate; salts of sulfonated naphthalene-formaldehyde condensate; and sulfonated phenol-formaldehyde condensate. Salts of condensates; more complex sulfonates, such as amide sulfonates, such as the sulfonated condensation product of oleic acid and N-methyl taurine; or dialkylsulfosuccinates, such as sodium sulfonate of dioctyl succinate. Nonionic agents include condensation products of fatty acid esters, fatty alcohols, fatty acid amides or fatty alkyl or alkenyl substituted phenols with ethylene oxide, fatty acid esters of polyol ethers (e.g., sorbitol fatty acid esters), condensation products of such esters with ethylene oxide (e.g., polyoxyethylene sorbitol fatty acid esters), block copolymers of ethylene oxide and propylene oxide, alkynyl diols (e.g., 2,4,7,9-tetraethyl-5-decyn-4,7-diol), or ethoxylated alkynyl diols. Examples of cationic surfactants include, for example, aliphatic monoamines, diamines, or polyamines, such as acetates, naphthenic esters, or oleates; or oxyamines, such as amine oxides of polyoxyethylene alkylamines; amide-linked amines prepared by condensation of carboxylic acids with diamines or polyamines; or quaternary ammonium salts.
[0118] Examples of inert materials include, but are not limited to, inorganic minerals such as kaolin, layered silicates, carbonates, sulfates, phosphates, mica, amorphous silica, talc, clay, volcanic ash, or plant materials such as cork, corn cob powder, peanut shells, rice husks, and walnut shells. Kaolin, for example, includes kaolinite, dickite, pearl clay, silica-rich kaolinite, halloysite, and...
[0119] Hydrocarboxylate can be used as a carrier material. Montmorillonite, such as bedeite, chlorodiazepite, lithium montmorillonite, saponite, zinc montmorillonite, and bentonite, can be used as carrier materials. Vermiculite, such as biotite, can be used as a carrier material.
[0120] The composition of this embodiment may be in a suitable form for direct application or a concentrate of the main composition, which needs to be diluted with an appropriate amount of water or other diluent before application. The insecticide concentration will vary depending on the nature of the specific formulation, specifically whether it is a concentrate or for direct application. The composition contains 1% to 98% of a solid or liquid inert carrier and 0% to 50% or 0.1% to 50% of a surfactant. These compositions will be applied according to the label dosage of commercially available products, for example, approximately 0.01 to 5.0 pounds per acre in dry condition or approximately 0.01 to 10 pints per acre in liquid condition.
[0121] The compositions disclosed herein include cell or tissue extracts, suspensions, homogenates, lysates, supernatants, filtrates, and precipitates, wherein such cells or tissues express at least one SCW protein, and / or also provide purified proteins derived from such cells and / or tissues.
[0122] sugarcane plants
[0123] The sugarcane plants disclosed herein include species and hybrids of the genus *Saccharum*, such as the tropical species (*Saccharum officinarum*), the Chinese species (*Saccharum sinense*), the Indian species (*Saccharum barberi*), the large-stemmed wild species (*Saccharum robustum*), the spontaneum species (*Saccharum spontaneum*), species of the genus *Saccharum*, and hybrids of the genus *Saccharum*. Cultivated sugarcane crops are typically hybrids of many sugarcane species that can be crossbred between varieties. Sugarcane is classified as a monocotyledonous plant and belongs to the same plant family (Poaceae) as other important crops (such as maize, rice, and wheat). As one of the world's major sources of sugar, sugarcane is a key crop for the economies of many subtropical and tropical countries that grow sugarcane, particularly Brazil. Furthermore, as a source of ethanol, sugarcane offers a potential environmentally valuable alternative to gasoline for certain fuel processes worldwide.
[0124] The prominent nodes of sugarcane are the most commercially valuable part of the plant, rich in sucrose between the nodes (i.e., the internodes of the stem). The internodes of the stem are rich in vascular tissue, and the vascular tissue of sugarcane contains abundant sucrose deposits.
[0125] Sugarcane propagation is carried out by cutting the top of mature sugarcane near the base, and then removing the stalks from the vegetation. Additionally, tissue-cultured seedlings derived from buds and cultivated in greenhouses can also be used for propagation. Harvesting of mature sugarcane can be done by hand (a labor-intensive process providing thousands of jobs) or by machine using heavy machinery. Sugar is extracted from the sugarcane stalks through a milling process and then supplied to the commercial market through a refining process.
[0126] In some aspects, this disclosure relates to treating seeds, plant parts, or plant tissues with recombinant proteins or compositions containing recombinant proteins according to any of the above embodiments. In some embodiments, the plant part is selected from leaves, stems, anthers, pistils, roots, fruits, flowers, seeds, cotyledons, hypocotyls, embryos, somatic embryos, or meristematic cells. Plant parts include differentiated and undifferentiated tissues, including but not limited to roots, stems, buds, leaves, pollen, and seeds.
[0127] In some aspects, this disclosure relates to a transgenic plant, plant part, propagule, seed, tissue, organ, embryo, or plant cell comprising a polypeptide, a polynucleotide, or an isolated construct or expression cassette of any of the foregoing embodiments. In some embodiments of this aspect, the polypeptide comprises SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, and / or SEQ ID NO: 22, and / or variants or fragments thereof. In some embodiments of this aspect, the polynucleotide includes SEQ ID NO: 4 or SEQ ID NO: 5. In other aspects, this disclosure relates to plants, plant parts, propagules, seeds, tissues, organs, embryos, or plant cells transformed (e.g., transient or stable transformation) with at least one polynucleotide encoding one of the insecticidal polypeptides.
[0128] As used herein, the term "plant" refers to any plant at any developmental stage, particularly seed plants. The term "plant cell" refers to the structural and physiological unit of a plant, comprising a protoplast and cell wall. Plant cells can be isolated single cells or cultured cells, or they can be part of higher-level tissue units such as plant tissues, plant organs, or the whole plant. The term "plant cell culture" refers to a culture of plant units such as protoplasts, cultured cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes, and embryos at various developmental stages. The term "plant material" refers to leaves, stems, roots, flowers or parts of flowers, fruits, pollen, egg cells, zygotes, seeds, cuttings, cell or tissue cultures, or any other part or product of a plant. The term "plant organ" refers to a distinctive and clearly structured and differentiated part of a plant, such as a root, stem, leaf, bud, or embryo. The term "plant tissue" refers to a group of plant cells organized into structural and functional units. Any tissue of a plant, whether within the plant or in a culture state, is included. This term includes, but is not limited to, whole plant, plant organs, plant seeds, tissue cultures, and any group of cells organized into structural and / or functional units. The use of this term in conjunction with or alone with any particular type of plant tissue covered above or in this definition does not exclude any other type of plant tissue.
[0129] In some aspects, this disclosure relates to an insecticidal composition applied to protoplasts or cells of plants from any of the above embodiments. Plant cells can be differentiated or undifferentiated (e.g., callus, undifferentiated callus, immature and mature embryos, immature zygotic embryos, immature cotyledons, hypocotyls, suspension culture cells, protoplasts, leaves, leaf cells, root cells, phloem cells, and pollen). Plant cells include, but are not limited to, cells from: seeds, leaves, stems, roots or buds, suspension cultures, explants, immature embryos, embryos, zygotic embryos, somatic embryos, embryogenic callus, meristems, somatic meristems, organogenic callus, protoplasts, leaf bases, leaves from mature plants, leaf tips, immature inflorescences, cotyledons, immature cotyledons, hypocotyls, meristematic zones, callus, gametophytes, sporophytes, pollen, or microspores. Plant cells also include various forms of cultured cells (e.g., single cells, protoplasts, embryos, and callus tissues), wherein protoplasts or cells are derived from plant parts selected from leaves, stems, anthers, pistils, roots, fruits, flowers, seeds, cotyledons, hypocotyls, embryos, or meristematic cells. Besides sugarcane as described above, plant cells or tissues can also be derived from plants including, but not limited to, maize (e.g., corn), Zea mays ), barley (for example, Hordeum vulgareMillet (e.g., fingermillet, fonio millet, foxtail millet, pearl millet, barnyard millets, millet) Eleusine coracana ), fine-stemmed millet ( Panicum sumatrense ), millet ( Panicum milaceum ), Pennisetum glaucum, species of the genus Digitaria ( Digitaria spp.), species of the genus Barnyardgrass ( Echinocloa spp.), oats (e.g.) Avena sativa Rice (e.g., indica rice, japonica rice, aromatic rice, glutinous rice). Oryza sativa , glumed rice ( Oryza glaberrima ), rye (e.g., Secale cereale , Secale cereanum ), foxtail grass (for example, Setaria italica , Setaria viridis ), species of the genus *Brucea* ( Brachypodium sp.), sorghum (e.g., Sorghum bicolor ), teff (e.g., Eragrostis TEF ), triticale (e.g., X Triticosecale Wittmack, Triticosecale schlanstedtense Wittm. Triticosecale neoblaringhemii A. Camus, Triticosecale neoblaringhemii A. Camus), wheat (e.g., common wheat, spelt, durum, einkorn, emmer, kamut). Triticum aestivum , Triticum spelta , Triticum durum , Triticum urartu , Triticum monococcum , Triticum turanicum Species of the genus *Wheat* ( Triticum spp.), switchgrass (e.g., Panicum virgatum ), species of the genus Brassica ( Brassica sp.), tobacco (e.g., Nicotiana benthamiana , Nicotiana tabacum ),peanut( Arachis hypogaea ), banana (Musa species) Musa sp.)), potato ( Solanum tuberosum),strawberry( Fragaria ananassa ),coffee( Coffea arabica ), cotton (upland cotton) Gossypium hirsutum )),tomato( Solanum lycopersicum (or any other polyploid and / or asexually reproduced plant species.)
[0130] Plant expression
[0131] There are various plant gene transformation technologies, mainly divided into two categories: indirect gene transfer and direct gene transfer. Indirect transfer refers to the insertion of exogenous DNA into the genome through the action of biological vectors, while direct transfer is based on physical and biochemical processes.
[0132] Depending on the genetic transformation technique and the species or genotype to be transformed, different tissues and / or cells may be used. Typically, these tissues or cells include, but are not limited to, embryogenic callus, callus tissue, protoplasts, embryos, somatic embryos, meristems, and any other plant parts, tissues, or cells with regenerative capacity.
[0133] Indirect transformation based on Agrobacterium spp. ( Agrobacterium The bacterial-mediated transformation system (AMPS) is the most widely used method for obtaining transgenic plants. Advantages of this method include the ability to transfer relatively long DNA segments without rearrangement, while maintaining low copy number integration of the transgene, thus ensuring higher genotypic stability of the resulting events. Currently, various Agrobacterium species and strains, plasmids, and protocols have been developed and improved for genetic transformation of multiple plant species. The advantages of these methods include: a higher probability of single-copy events, stable integration, genetically inherited introduced traits, consistent gene expression across generations, and low gene silencing rates.
[0134] Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) and Agrobacterium rhizogenes ( A. Rhizogenes is Gram-negative soil plant pathogens belonging to the Rhizobium family can cause diseases in dicotyledonous plants, namely crown gall. (crown) Agrobacterium is a Gram-negative soil plant pathogen belonging to the Rhizobium family. It can cause diseases in dicotyledonous plants, namely crown gall and hairy root gall. In this plant-pathogen interaction, Agrobacterium (…) AgrobacteriumThere is a natural gene transfer process between bacteria and plant cells, in which a fragment of bacterial DNA (T-DNA) is transferred into the plant cell and integrated into the nuclear genome. In nature, bacteria transfer T-DNA (“transferred DNA”), which is part of the bacterial plasmid Ti (“tumor-inducing”), and integrates it into the genome of the infected plant cell. The T-DNA fragment transferred to the plant cell contains genes involved in the constitutive biosynthesis of plant hormones (auxins and cytokinins), which alter the normal developmental program of the infected tissue and lead to tumor formation. Furthermore, it contains genes for the synthesis of sugars and amino acids (called...).
[0135] The oncogene is opine, while sugars and amino acids are the carbon and nitrogen sources for bacteria (Oger et al., 1997). T-DNA is defined by 25-base-pair repeats at the left and right boundaries, which are crucial for its transfer. Phenolic compounds released from damaged plant tissue activate specific regions (vir regions), initiating the transfer of T-DNA into plant cells. Agrobacterium also possesses chromosome (chv) genes that promote the binding between bacteria and host cells, thereby forming channels containing T-DNA complexes (Sheng & Citovsky, 1996).
[0136] Because the fragment to be transferred is defined by its boundaries, any sequence flanked by those boundaries can be transferred into plants by Agrobacterium, allowing manipulation of these sequences to transfer the target coding sequence. Replacing or deleting the coding region of wild-type T-DNA (oncogene) produces non-oncogenetic (disarmed) Agrobacterium strains that can carry the target sequence. The modified T-DNA is able to transfer the target sequence into plants because the virulence gene (vir region) remains intact.
[0137] Furthermore, the Agrobacterium indirect transformation system allows for the transfer of artificial plasmid constructs into plants, provided the construct contains such a T-DNA boundary, and allows for the flexible use of molecular tools and materials developed for other bacterial strains.
[0138] These artificial plasmid constructs have promoters from different sources, such as plant promoters, viral promoters, bacterial and / or chimeric promoters, as well as genes that confer antibiotic resistance, herbicide resistance or tolerance or enzyme activity (phosphog-mannose isomerase (PMI) / mannose (Man)). Therefore, these markers can be used to select transformed cells or plants.
[0139] These constructs can also contain helper genes that interfere with related morphogenesis signaling pathways, thereby enhancing the efficiency of genetic transformation and plant tissue regeneration. Examples include, but are not limited to, LEAFY COTYLEDON1 (Lotan et al., 1998), Lec1 (Lowe et al., 2002), LEAFY COTYLEDON2 (Stone et al., 2001), WUSCHEL (WUS; Zuo et al., 2002), and e BABY BOOM (BBM; Boulirier et al., 2002).
[0140] In a first aspect of the invention, foreign or exogenous DNA to be introduced into a plant is cloned into a binary plasmid located between shared sequences (T-DNA) on its left and right boundaries. This binary plasmid is transferred into Agrobacterium cells and subsequently used to infect plant tissues. The vector containing the T-DNA region of the exogenous DNA is inserted into the plant genome. Marker gene expression cassettes and characteristic gene expression cassettes may be located in the same region of the T-DNA, in different T-DNA regions of the same plasmid, or in different T-DNA regions of different plasmids. In one embodiment of the invention, these expression cassettes are located in the same region as the T-DNA. Methods of indirect transformation via Agrobacterium are well known to those skilled in the art.
[0141] Alternatively, direct DNA transfer can be used to introduce DNA directly into plant cells. One method of direct DNA transfer is to bombard plant cells with a vector containing the DNA to be inserted using a particle gun (particle-mediated gene gun transformation). Other plant cell transformation methods include protoplast transformation (optionally in the presence of polyethylene glycol); sonication of plant tissues, cells, or protoplasts in a medium containing polynucleotides or vectors; microinjection of polynucleotides or vectors into plant material; microinjection, vacuum permeation, sonication, chemical transformation using silicon carbide, chemical transformation using PEG, and plant cell electroporation. Disadvantages of direct transformation include challenges associated with plant tissue regeneration and low transgene expression.
[0142] Furthermore, gene transformation can be achieved through direct insertion at specific sites via nuclease-mediated homologous recombination (genome editing). In recent years, genome editing technologies based on engineered or chimeric nucleases have made it possible to generate genetically modified organisms in a more precise and specific manner. The introduction of exogenous or foreign genes is achieved through homologous recombination, i.e., the introduction of a homologous recombination template (HR) containing exogenous DNA linked to a DNA fragment homologous to the recipient organism's genome. Available tools include the chimeric enzyme system CRISPR (clustered, regularly spaced, short palindromic repeats)-Cas, zinc finger (ZFN) nucleases, and TAL effector nucleases (TALENs). The Crispr-Cas system is an enzymatic system containing two main components: an endonuclease (Cas) and a guide RNA (single guide RNA - sgRNA; a guide to a specific cleavage site of the Cas endonuclease). The guide RNA may also contain two components: Crispr RNA (crRNA) - a 17-20 base sequence complementary to a specific DNA genomic sequence, and optional tracrRNA. The specific cleavage performed by the endonuclease and the guidance of sgRNA will be repaired through homologous recombination, specifically, the insertion of exogenous DNA side-joined by a homologous sequence into the cleavage site. This enzymatic system can be introduced into cells in various ways, using plasmids, through direct or indirect transformation, or using vectors such as proteins and other chemical reagents. Expression of the system components can occur transiently or stably, utilizing the cellular mechanisms of the recipient organism, or in vitro, delivering all ready-to-use components (endonuclease + sgRNA, transcribed and combined in vitro prior to cellular delivery) to the target cells or tissues. The contents described herein are not exhaustive and should not limit the use of different variants, systems, and methods of genome editing within the scope of this invention, including variants, systems, and methods known in the art and those not yet discovered.
[0143] After transformation, the transgenic plants regenerate from the transformed plant tissues, and offspring with exogenous DNA can be screened using suitable markers (e.g., kanamycin, genimycin, or glufosinate resistance). Those skilled in the art are familiar with the composition of suitable regeneration media.
[0144] Alternatively, other selection methods can be applied without inserting any genetic markers into the host genome (recipient organism) as previously described.
[0145] Promoters suitable for plant expression can be isolated from plants or other organisms. Various promoters have been isolated or developed, including constitutive promoters, "on and off" promoters, and promoters that respond to tissue-specific abiotic stresses. Many of these promoters have intron sequences associated with proper gene expression. In a preferred aspect of the invention, the promoter is a constitutive promoter, selected from the non-limiting group consisting of: CaMV 35s, CoYMV (Commelina yellow mottle virus), FMV 35s, ubiquitin, actin rice promoter (Act-1), Act-2, nopaline synthase promoter (NOS), octopine synthase promoter (OCS), zeatol dehydrogenase promoter (Adh-1), PvUbi1, SCBV, etc.
[0146] Additional elements such as introns, enhancer sequences, and transport proteins can be integrated into the expression cassette to enhance gene expression levels. Examples include transcriptional or translational enhancers such as the CaMV 35s enhancer, FMV 35s, Nos, supP, untranslated leader sequences from wheat major chlorophyll a / b binding polypeptide (L-Cab), and the kosak sequence 5' upstream of the translation initiation site.
[0147] Termination sequences were also considered on the expression cassette. Examples of suitable, functional plant polyadenylation signals include those from Agrobacterium tumefaciens carmine synthase (nos), protease inhibitor II gene rbcS (small subunit of pea ribulose-1,5-bisphosphate carboxylase), Lhcb1 (tobacco chlorophyll a / b binding protein), CaMV 35s, octopus carmine synthase, α-tubulin genes, etc.
[0148] According to the present invention, polynucleotides encoding proteins may have optimized (or otherwise altered) codons to improve their expression in plant material. Such codon optimization can be used to alter the predicted secondary structure of RNA transcripts produced in any transformed cells, or to disrupt hidden RNA instability elements present in unaltered transcripts, thereby enhancing the stability and / or availability of transcripts in transformed cells.
[0149] Several marker genes for plant event selection have been identified, some of which confer antibiotic resistance and others herbicide resistance. Examples of marker genes that can be used selectively in this invention include genes that confer resistance or tolerance to hygromycin, kanamycin, gentamicin, genimycin, glyphosate, and glufosinate, or genes that confer resistance to toxins such as eutypine. Other forms of selection may also be used, such as hormone-based selection systems, visual selection by expressing fluorescent proteins, mannose isomerases, xylose isomerases, etc. In one embodiment of the invention, the event selection marker gene is a gene that confers resistance to kanamycin and genimycin.
[0150] Use selectable marker genes, for example nptII Genes are crucial for selecting transformed cells during gene modification (HORSCH et al., 1985). Therefore, the insertion of genes into the events described in this invention... nptII The purpose of gene selection is to select cells that have been transformed with target genes.
[0151] Suitable methods for detecting plant material derived from genetically modified plants (events) based on antibody binding include (but are not limited to): Western blotting, enzyme-linked immunosorbent assay (ELISA), and mass spectrometry (e.g., surface-enhanced laser desorption / ionization (SELDI)). These immunological techniques are familiar to those skilled in the art. Typical steps involve incubating the sample with an antibody bound to a protein, washing to remove unbound antibodies, and detecting whether the antibody has bound. Many such detection methods are based on enzymatic reactions: for example, antibodies can be conjugated to enzymes such as peroxidase, and a color change can be detected upon application of a suitable substrate. Such antibodies can be monoclonal or polyclonal.
[0152] Methods for detecting plant material in an event include, but are not limited to, biofeeding assays, in which the leaves or other suitable parts of the plant in the event, or any plant material derived from the event, are infested by one or more insect pests. Measurements of the assay may include assessing leaf or plant damage after a time adjustment period, assessing mortality, or assessing other insecticidal effects. Such bioassays can be performed in the field or in a greenhouse and may involve natural or artificial insect infestations.
[0153] In another embodiment of the invention, the kit may include antibody binding detection techniques, such as Western blotting, ELISA, SELDI, or test strips. In another embodiment of the invention, the kit may include techniques for detection by biological insect detection (e.g., leaf-feeding bioassay or biomortality assay). In another embodiment of the invention, the kit may include any combination of the above detection techniques.
[0154] The invention has been generally described, and will be better understood by referring to certain specific embodiments, which are included herein to further illustrate the disclosure and are not intended to limit the scope of the invention as defined by the claims.
[0155] The following words and phrases have the following meanings.
[0156] As used in this article, “associated nucleic acids” or “operably linked nucleic acids” refers to at least two nucleic acids that are physically or functionally related. For example, if a promoter or regulatory DNA sequence is operably linked to a DNA sequence encoding RNA or protein, or is located at a position where the regulatory DNA sequence can affect the expression level of the coding or structural DNA sequence, then the two sequences are said to be “associated.”
[0157] As used herein, the term "biological insecticidal composition" refers to a substance, compound, or mixture that exhibits insecticidal activity against insects and comprises at least one aspect of biological origin. Many embodiments of this disclosure are derived from bacteria and / or plants.
[0158] As used in this article, "insect control / insect population control" refers to the suppression of the survival, growth, feeding, and / or reproductive capacity of insect pests through toxic effects, or the limitation of insect-related damage or loss to crops. "Insect control" may or may not refer to killing insects.
[0159] As used herein, “delivery” means contacting a composition (in the most preferred embodiment herein, an insecticidal protein) with insects to produce a toxic effect and control the insects. Insectic proteins can be delivered in a variety of known ways, such as through transgenic plants expressing insecticidal proteins, formulated protein compositions, sprayable protein compositions, bait substrates, or any other toxin delivery system recognized in the art.
[0160] The terms “identity” and “percentage of identity” used herein refer to the degree of similarity between two nucleic acid or protein sequences. For sequence comparison, one sequence is typically used as a reference sequence and compared with the test sequence. When using a sequence comparison algorithm, the test and reference sequences are input into a computer, subsequence coordinates are specified as needed, and sequence algorithm program parameters are specified. The sequence comparison algorithm then calculates the percentage of sequence identity of the test sequence relative to the reference sequence based on the specified program parameters. In the context of two nucleic acid or two amino acid sequences, the phrase “substantially identical” means that two or more sequences or subsequences have at least about 50% nucleotide or amino acid residue identity when compared and aligned to obtain maximum correspondence. This identity can be measured by one of the following sequence comparison algorithms or by visual inspection. In some embodiments, substantially identical sequences have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or even at least about 90% or 95% nucleotide or amino acid residue identity. In some embodiments, substantially identical sequences exist within a sequence region of at least about 50 residues, or within a sequence region of at least about 100 residues, or within a sequence region of at least about 150 residues. In further embodiments, sequences are said to be substantially identical when they are identical over the entire coding region.
[0161] The term "insecticide" as used in this article refers to the descriptive term for insecticidal activity against insects.
[0162] As used herein, the term "isolated toxin" refers to a synthetically produced toxin that exists outside its natural environment and is therefore not a natural product. Isolated toxins can exist in purified form or in non-natural environments, such as, but not limited to, recombinant microbial cells, plant cells, plant tissues, or plants.
[0163] The term “promoter” as used in this article refers to a recognition site on a DNA sequence or set of DNA sequences that provides an expression control element for a structural gene, and to which RNA polymerase specifically binds and initiates RNA synthesis (transcription) of that gene.
[0164] As used herein, the term "protein" refers to an organic compound consisting of one or more chains of amino acids. These amino acids can be natural, non-natural, or a combination of natural and non-natural amino acids. The terms "protein," "peptide," and "polypeptide" are used interchangeably herein.
[0165] As used herein, the term "recombination" refers to any modification, alteration, or manipulation of a polynucleotide or protein. The terms "recombination" and "genetic modification" are used interchangeably to refer to any modification, alteration, or manipulation of a polynucleotide or protein in its native form or structure, or in its native environment or context. Modifications, alterations, or manipulations of polynucleotides or proteins may include, but are not limited to, the following examples (including, but not limited to): deletion of one or more nucleotides or amino acids; preparation of a fusion protein from two heterologous polypeptide components; whole-gene deletion; codon optimization; conserved amino acid substitution; or insertion of one or more heterologous polynucleotides.
[0166] As used herein, the term "susceptible insect larvae" refers to insect larvae whose growth is inhibited after oral ingestion of a sample of feed containing one or more proteins of the present disclosure, said feed being artificially produced or obtained from plant tissues artificially coated with or expressing one or more proteins of the present disclosure derived from recombinant genes, as measured by: failure to gain weight, suppression of molting cycle frequency, observed lethargy, reduced fecal production, or death compared to: 1) larvae that do not exhibit any of these signs when fed the same feed provided to susceptible larvae, or 2) larvae fed a control feed that does not contain one or more proteins of the present disclosure.
[0167] As used in this article, the term "transformation" refers to the process of introducing a foreign DNA sequence (e.g., a vector, recombinant DNA molecule) into a cell or protoplast, enabling the foreign DNA to integrate into the chromosome or to replicate autonomously. Transformation includes stable or transient transformation of the foreign DNA sequence.
[0168] As used in this article, “transformed cell” refers to a cell whose genetic composition (chromosomal DNA or other naturally occurring intracellular DNA) is altered by introducing exogenous DNA molecules into the cell.
[0169] As used in this article, the term "treatment" refers to the application of a composition to achieve insecticidal activity against target insect pests. Insecticide treatments are typically applied to plants or planted areas to control insect pests.
[0170] As used herein, the term "vector" refers to a DNA molecule capable of replicating in a host cell, and / or a DNA molecule to which another DNA sequence can be operatively linked, thereby enabling the replication of the linked sequence. A plasmid is an exemplary vector.
[0171] Nucleotides are represented by their bases using the following standard abbreviations: adenine (A), cytosine (C), thymine (T), and guanine (G). Amino acids are also represented by the following standard abbreviations: alanine (A), arginine (R), asparagine (N), aspartic acid (D), cysteine (C), glutamine (Q), glutamic acid (E), glycine (G), histidine (H), isoleucine (I), leucine (L), lysine (K), methionine (M), phenylalanine (F), proline (P), serine (S), threonine (T), tryptophan (W), tyrosine (Y), and valine (V).
[0172] The standard recombinant DNA and molecular cloning techniques used in this paper are well known in the art, and for a more detailed description, see Sambrook et al., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989). The transformation methods are well known to those skilled in the art and are detailed below.
[0173] Example
[0174] Example 1. Selection of Cry proteins for bioassay
[0175] This embodiment describes the selection process for candidate Cry proteins and the production of selected Cry proteins for bioassays.
[0176] Materials and methods
[0177] Identification of candidate Cry proteins
[0178] To identify potential Cry proteins, we conducted a literature review outlining Bt proteins reported to have insecticidal activity against insect species, particularly Coleoptera. To narrow this broad list down to the most viable potential candidates, we anticipated those more likely to be effective against sugarcane weevils or sugarcane beetles. Sugarcane weevil Bt proteins can also effectively combat [the virus / the virus]. S.levis Insects with similar phylogenetic structures.
[0179] Most promising for prevention and treatment S.levis The candidate Cry protein is targeted at insects belonging to the superfamily Curculionoidea. S.levisThe active Cry protein is a member of this superfamily. Other candidate Cry proteins were screened from Cry proteins that are active in members of the Chrysomeloidea, Tenebrionoidea, and Scarabaeoidea families.
[0180] Synthesis and Cloning of Candidate Cry Proteins
[0181] A list of 28 candidate Cry proteins was compiled. The coding sequences of these proteins were synthesized and cloned into the pD424-CH E. coli expression vector. This vector was induced by IPTG and produced a recombinant protein fused with a C-terminal histidine (His-6) tag.
[0182] Chimeric Cry Protein
[0183] Preliminary experiments have identified SCW35 and SCW39 as suitable for use. Sugarcane weevil The chimeric proteins exhibited mortality rates of approximately 80% and 66% respectively in the experiments, indicating they are promising candidates for chimeric protein engineering. Researchers designed different chimeric proteins for testing. The chimeric protein, named SCW112 (SEQ ID NO: 2), is a fusion of SCW35 (SEQ ID NO: 1) and SCW39 (SEQ ID NO: 3), where domains I and II of SCW35 (Cry8Ba1) are fused with domain III of SCW39 (Cry1 protein). The N-terminal and C-terminal tail regions of the chimeric protein were truncated.
[0184] Small-scale expression screening
[0185] These vector constructs were then transformed into *E. coli* BL-21(DE3) expression strains. Small-scale expression screening was subsequently performed using 4 mL of induction medium from all 25 clones, followed by cell lysis and small-scale immobilized metal affinity chromatography (IMAC). The recombinant proteins were eluted from the IMAC resin with imidazole-containing buffer, and the presence of soluble recombinant proteins was detected by SDS-PAGE. Proteins detected by SDS-PAGE were considered positive clones.
[0186] Amplify expression
[0187] Positive clones identified in the small-scale expression screening were then scaled up in 4 L of autoinduction medium (FW Studier). Protein Expr. Purif., 41, 207–234. 2005). After induction at 20°C for 48 hours, cells were harvested and lysed using lysis buffer containing lysozyme. Freeze-thaw and sonication were then performed. The lysates were then centrifuged, and the supernatant was purified by IMAC using an Akta Pure® FPLC system (GE Healthcare). The purified eluted sample was dialyzed against buffer A (TrisCl 50 mM, NaCl 300 mM, glycerol 10%) and quantified by BCA assay. Protein purity was then assessed by SDS-PAGE density assay. The final protein sample was concentrated to 500 μg / mL for further processing. Sugarcane weevil Further testing is required in bioassays.
[0188] result
[0189] All expressed proteins showed positive results for solubility. These positive clones were then scaled up for bioassay analysis.
[0190] These results demonstrate the solubility and scalability of these Cry proteins, meaning they are ideal candidates for application to insects in an efficient, insect-ingestible form.
[0191] Example 2. Bioassay using recombinant Cry protein
[0192] This embodiment describes a method for testing the efficacy of the Cry protein as identified by the method of Example 1. More specifically, this embodiment describes the oral delivery of the Cry protein to… Sugarcane weevil The method for detecting the sugarcane weevil (SCW). The identified Cry protein leads to... Sugarcane weevil Larvae may stunt or die.
[0193] Materials and methods
[0194] Sugarcane weevil breeding
[0195] Bioassays require the use of Sugarcane weevil Newborn larvae of (SCW). However, due to the low survival rate of eggs and larvae, rearing... Sugarcane weevil It is quite challenging. S. LevisThe larval stage lasts 26 to 50 days with a survival rate of only 35.8%, while the pupal stage lasts 5 to 13 days with a survival rate as high as 93% (Degaspari, N. et al., Biologia de Sphenopherus levisVaurie, 1978 (Col.: Curculionidade), em dieta artificial e no campo. Pesquisa Agropecuária Brasileira, Brasília, DF, v. 22, n. 3, p. 553-558, 1987). This results in slow insect population growth, requiring continuous collection of adults from the field to replenish the population available for testing. Sugarcane weevil There is a seasonal cycle, so a large number of adult insects can only be collected between October and March. At the beginning of the bioassay screening phase, about 25 larvae / day are available for collection, but the number of larvae available for bioassay increases in late September and October.
[0196] Bioassay
[0197] The purified recombinant Cry protein (selected in Example 1) was added at a concentration of 500 μg / mL to... S.levis In the artificial feed, at 45℃ (maximum), the ratio of protein solution to feed was 1 part protein solution to 4 parts feed, yielding 100 μg Bt protein / mL feed. After incorporation, the feed was evenly distributed into a 96-well detection plate (300 μL feed per well), and one newborn was infected per well. Sugarcane weevil The larvae are incubated at 25°C for 7 days.
[0198] The Cry protein concentration (100 μg / mL feed) used in the bioassay was selected based on the LC50 values of Coleoptera-specific Bt proteins in the literature, ranging from 0.1 to 5.1 μg / mL (GR Oliveira et al.). BMC Biotechnol. 11, 85. 2011; M. Ekobu et al. J. Econ. Entomol. 103, 1493–1502. 2010; IO Oyediran et al. Insect Sci 23, 913–917 (2016). The toxic protein is expected to cause... Sugarcane weevil The larval mortality rate exceeded 50%. Therefore, a feed protein concentration of 100 μg / mL ensured that the Cry protein would not cause death in the sugarcane weevil. Sugarcane weevil Non-toxic.
[0199] Toxicity screening program
[0200] The screening protocol consisted of bioassays using the same concentration of protein (100 μg / mL feed). After 7 days of incubation, the mortality percentage was calculated, taking into account both dead larvae and actual mortality (larvae with low activity after brush touch). The LC50 of the purified chimeric Cry protein SCW112 was also calculated. As described above, Sugarcane weevil The larval survival rate is low; therefore, the mortality rate for screening bioassay controls is consistently 10-30%. The higher mortality rate here is due to the high toxicity of the Cry protein.
[0201] result
[0202] Preliminary experiments with SCW35 and SCW39 resulted in mortality rates of approximately 80% and 66%, respectively (data not shown). Based on these results, we designed different chimeric proteins and specifically identified SCW112 targeting... S.levis It is active.
[0203] The results of the toxicity screening of recombinant Cry protein are shown in Table 1, and... Figure 1 Further summaries were made in the text. Figure 1 The mortality rates of two of the 28 Cry candidate proteins (representing the Bt protein family associated with the chimeric proteins of this invention) are shown, as well as the mortality rate of the chimeric Cry protein SCW112. See Table 1 and... Figure 1 In this context, mortality rate (average actual mortality rate %) refers to the percentage of mortality among all larvae, including those that are completely unresponsive and those that are almost unresponsive; that is, the average percentage of dead larvae to the total number of larvae that actually died, calculated across repeated experiments. In Table 1, "repeated" refers to the number of repeated experiments for each Bt protein, "total infection" refers to the number of larvae included in each repeated experiment, "negative control" refers to the percentage of larvae that did not receive Bt protein feed, and "mortality rate % (actual), average" refers to the percentage of mortality calculated using the above method. Figure 1 In the table, the actual mortality rate (%) average (vertical axis) represents the aforementioned mortality percentage and has been adjusted for mortality rates in the control group. Table 1 shows that the chimeric Cry protein SCW112 (SEQ ID NO: 2) exhibits a higher mortality rate compared to other Cry proteins. Furthermore, Figure 2 The results of this assay are shown, and the LC50 value of the highly efficient chimeric protein SCW112 (SEQ ID NO: 2) is plotted. The LC50 value of SCW112 (12.34) is about three times lower than that of the original non-chimeric protein SCW35, which means that the activity of SCW112 is about three times higher than that of SCW35.
[0204] These surprising results all indicate that the chimeric protein SCW112 plays a crucial role in... Sugarcane weevil It is extremely toxic, especially compared to its isolated protein components.
[0205] Table 1. Bt targeting Sugarcane weevil Mortality results of larval bioassays
[0206] Example 3. Bioassay of SCW112 protein variant
[0207] This embodiment describes a method for testing the efficacy of SCW112 variants. More specifically, this embodiment describes the oral delivery of soluble and / or variant SCW112 protein to sugarcane weevils. Sugarcane weevil The method. Compared to both SCW35 (SEQ ID NO: 1) and SCW39 (SEQ ID NO: 3), the SCW112 variant is expected to result in Sugarcane weevil A significantly higher rate of developmental delay or mortality was observed.
[0208] Synthesis and Cloning of Candidate Cry Proteins
[0209] Variants of the SCW112 chimeric protein described in the above embodiments were constructed, including variants containing one or more of the following modifications, alone or in any combination: point mutations, domain exchanges, truncation, and other variations in amino acid sequence and / or protein structure. The synthesis and cloning of these variants were performed according to the methods described in Example 1.
[0210] Express
[0211] The variants were expressed in small-scale and large-scale expression screenings, as described in Example 1. The variants are expected to exhibit soluble positive results. Positive clones will then be scaled up for bioassay analysis.
[0212] Sugarcane weevil breeding
[0213] As described in Example 2, raising Sugarcane weevil Used for biological assays.
[0214] Bioassay
[0215] Bioassays were performed on the SCW112 variant as described in Example 2.
[0216] Toxicity screening program
[0217] The screening scheme was carried out as described in Example 2.
[0218] result
[0219] The analysis and presentation of bioassay results are as described in Example 2. Compared to the SCW112 protein tested in Example 2, the SCW112 variant is expected to... Sugarcane weevil It has roughly equal or higher toxicity, and compared to SCW35 and SCW39, in Sugarcane weevil This results in a significantly higher rate of developmental delay or mortality. Examples of the resulting variants can be found in SEQ ID NO: 7-22.
[0220] Example 4. Stability and solubility of the SCW112 variant
[0221] This embodiment describes a method for optimizing the protein stability and solubility of Cry protein variants. More specifically, this embodiment describes the visualization of the three-dimensional structure of the Cry protein SCW112 and the substitution of individual amino acids in SCW112.
[0222] Materials and methods
[0223] Homology modeling
[0224] Homology modeling is used to assess proposed changes in amino acid sequences to ensure the maintenance of protein structure (Swiss Model software).
[0225] Figure 3 The workflow for this homology modeling is shown. The modeling can be sorted into five main steps: (1) pattern recognition; (2) multiple alignment of primary sequences; (3) target-based modeling based on standard 3D structures; (4) model refinement, alignment analysis, missing and gap filling; and (5) model validation.
[0226] Synthesis and Cloning of Candidate Cry Proteins
[0227] The coding sequences were synthesized and cloned as described in Example 1, except that they were cloned into the vector pCTC1150 (SEQ ID NO: 27) for expression in BL21 Escherichia coli (Invitrogen™ One Shot™ BL21 Star™ (DE3)).
[0228] Small-scale expression screening
[0229] Small-scale expression screening was performed as described in Example 1 to identify positive clones.
[0230] amplify expression
[0231] The positive clones identified in the small-scale expression screening were then expanded according to the method in Example 1 and purified by affinity chromatography.
[0232] result
[0233] The most suitable SCW112 model obtained was 0.88 GMQE, with 87.98% identity, and the protein showed an acceptable conformation, such as... Figure 4 As shown.
[0234] Based on homology modeling, two amino acid substitutions are proposed: Asparagine is replaced by proline (N73P) and serine by proline (S91P) (SEQ ID NO: 26). Homology modeling of this variant showed no significant observable changes in the 3D structure, maintaining an acceptable conformation (0.88 GMQE, with 87.98% identity). The isoelectric point also remained (6.1), but the molecular size in the variant decreased to 71.7 kDa compared to the corresponding 72.3 kDa of the initial SCW112 sequence.
[0235] The starting protein-coding sequence (SEQ ID NO: 2) and the variant protein-coding sequence (SEQ ID NO: 26) of the SCW112 protein were synthesized and cloned. Subsequent densitometric analysis showed that the variant sequence protein (lane B) had higher solubility than the starting sequence protein (lane A). Figure 5 ).
[0236] Example 5. ELISA Development
[0237] This example describes the development of a sandwich ELISA for the protein SCW112.
[0238] More specifically, this embodiment describes an ELISA designed to detect genetic modifications in plants with SCW112 inserted.
[0239] Materials and methods
[0240] Recombinant protein products and purification
[0241] Synthesis and Cloning of Candidate Cry Proteins
[0242] As described in Example 1, the coding sequences were synthesized and cloned, except that they were cloned into the expression vector pSUMO-M.
[0243] Small-scale expression screening
[0244] Small-scale expression screening was performed as described in Example 1 to identify positive clones.
[0245] Amplify expression
[0246] Then, following the method in Example 1, the positive clones identified in the small-scale expression screening are expanded, except as follows.
[0247] Incubation was performed at 15°C for 16 hours, and the specific lysis buffer used was 50 mM Tris-HCl, 150 mM NaCl, 0.5% Triton™ X-100 nonionic detergent (Sigma-Aldrich, St. Louis, Missouri, USA), 0.5% Triton™ X-114 nonionic detergent (Sigma-Aldrich, St. Louis, Missouri, USA), nuclease, and pH 8.0.
[0248] The supernatant obtained from the centrifuged lysate was purified using a Ni column in an Akta Pure® FPLC System (GE Healthcare, Chicago, Illinois, USA).
[0249] The eluted samples were treated with SUMO protease to remove the tag (incubated overnight at 4°C with 50 mM Tris-HCl, 8M urea and pH 8.0 buffer), and then purified by Superdex 200 column.
[0250] After BCA quantification, the protein was evaluated using SDS-PAGE.
[0251] antibody products
[0252] Immunological and serological tests
[0253] BALB / c female mice were immunized intraperitoneally (ip) with the target protein (SEQ ID NO: 2) and adjuvant at 8-10 weeks of age, three times (primary immunization (d0), 14 days after primary immunization (d14), and 21 days after primary immunization (d21)).
[0254] Serum was collected after the third immunization and used for mouse serum ELISA with purified protein SCW112 as antigen.
[0255] The coating concentration was 1 μg / ml; serum was tested at 100 μl / well; the selected coating buffer was phosphate-buffered saline; pH was 7.4.
[0256] Irrelevant proteins labeled with polyhistidine- (His-) were used as negative controls.
[0257] Peroxidase-AffiniPure™ goat anti-mouse IgG, Fcγ fragment specificity is used as a secondary antibody (detection).
[0258] Dilution tests were conducted according to Tables 2A-2B.
[0259] Table 2A. Results of the initial serum dilution test in animals immunized with antigen SCW112 (SEQ ID NO: 2)
[0260] Table 2B. Results of the reserum dilution test in animals immunized with antigen SCW112 (SEQ ID NO: 2)
[0261] Hybridoma formation
[0262] Cell fusion was performed on day 31 following the first immunization. The materials used were: 1–1.5 L HAT medium, 100 mL HYB-SFM + 10% FBS, 25 mL HYB-SFM, and X63-Ag8.653 cells. X63 cells were thawed one week prior to fusion and split daily at a 1:2 ratio until the day before fusion to maintain exponential growth. Spleens were collected from immunized C0974# mice and transferred to culture dishes containing 5 mL Hyb SFM + 10% FCS. Fat and connective tissue were removed, and spleen cells were mechanically separated.
[0263] Collect the upper cell suspension and centrifuge at 900-1000 rpm for 5 minutes.
[0264] The spleen cells were resuspended in 20 mL of HYB-SFM + 10% FBS.
[0265] 3-5×10 8 One spleen cell and X63 cells ((1.5–2.5) × 10 8 The cell mixture was centrifuged at 900-1000 rpm for 5 minutes, washed with 25 mL of Hyb-SFM medium (additive-free), and centrifuged again. 1.5 mL of PEG was slowly added to 3 × 10⁻³ cells at room temperature. 8 The mixture of cells was then incubated at 37°C for 1 minute. 20 mL of Hyb-SFM was added very slowly, followed by centrifugation and placement in HAT fusion medium at 1000°C. 6A total cell / well concentration was plated onto treated tissue culture plates. These cultures were then incubated (37°C, 5% CO2) for 10–14 days. The supernatant from the cell cultures was then collected and tested by direct ELISA (according to immunoassay and serological testing), and positive clones (hybridomas) were individualized before retesting. Individual hybridomas were selected and used to generate purified monoclonal antibodies.
[0266] Antibody pairing
[0267] Select a monoclonal IgG SCW112 antibody and perform a sandwich ELISA test to determine the optimal combination between the coating antibody and the detection antibody.
[0268] The detection antibody was biotinylated, and the purified, unlabeled protein SCW112 (produced during hybridoma formation) was used as the antigen.
[0269] In short, pre-immunize plates with the coated antibodies according to Table 3, and incubate 100 μL of purified protein in the plates at 37°C for 1 hour, followed by washing with washing buffer.
[0270] After washing, 100 μL of detection antibody (Table 3) was added, followed by incubation at 37°C for 1 hour. The plates were then washed again, and SA-HRP solution (streptavidin, horseradish peroxidase conjugate, 100 ng / mL) was added and incubated at 37°C for 1 hour.
[0271] After a final wash, 100 μL of TMB substrate (5,5'-tetramethylbenzidine) was added, followed by incubation at 25°C for 15 minutes.
[0272] Then, 50 μL of stop solution (HCl 1N) was added, and readings were taken at wavelengths of 450 nm and 630 nm using a spectrophotometer.
[0273] Antibody variable heavy chain (VH) and variable light chain (VL) sequencing
[0274] Total RNA was isolated from selected hybridoma cells according to the technical manual of the Invitrogen™ RNAqueous™ Total RNA Isolation Kit (product model AM1912, Applera Corporation of Norwalk, Connecticut, USA).
[0275] Then, following the technical manual for SMARTScribe™ reverse transcriptase (Takara Bio USA Inc, Mountain View, California, USA), total RNA was reverse transcribed into cDNA using isotype-specific antisense primers or universal primers.
[0276] Antibody fragments of VH and VL were amplified according to the standard operating procedure (SOP) for rapid amplification of cDNA ends (RACE).
[0277] The amplified antibody fragments were cloned into standard cloning vectors.
[0278] Colony PCR was performed to screen clones with the correct-sized insert.
[0279] For each fragment, at least five colonies with the correct-sized insert were sequenced.
[0280] Sequences from different clones were compared, and common sequences among these clones were generated. Analysis of the constant region sequence identified the isotype as mouse IgG1 / κ.
[0281] Specificity analysis
[0282] To determine the specificity of the developed sandwich ELISA targeting protein SEQ ID NO: 2 (SCW112), heterologously purified SCW112 and non-target proteins were added to a plate pre-immunized with coated antibodies 6C11C4 (SEQ ID NO: 33 and SEQ ID NO: 35) and then incubated at 37°C for 1 hour.
[0283] The plate was then washed with washing buffer. After washing, 100 μL of the detection antibody 13C2A4-biotin (100 ng / mL; SEQ ID NO: 29 and SEQ ID NO: 31) was added for subsequent incubation at 37 °C for 1 hour. The plate was washed again, followed by the addition of SA-HRP solution (streptavidin, horseradish peroxidase conjugate, 100 ng / mL) and incubation at 37 °C for 1 hour. After a final wash, 100 μL of TMB substrate (5,5'-tetramethylbenzidine) was added, followed by incubation at 25 °C for 15 minutes. Then, 50 μL of stop solution (HCl 1N) was added, and readings were taken at 450 and 630 nm using a spectrophotometer.
[0284] result
[0285] The results of the SDS-Page analysis showed that... Figures 6A-6D The successful isolation and purification of SCW112 is shown in the figure.
[0286] Mice were immunized with purified protein SCW112 to induce the selection of C0974 mice for hybridoma generation (Tables 2A-2B).
[0287] The antibody pair combinations tested are shown in Table 3, the sensitivities obtained are shown in Table 4, and the standard curves obtained are shown in Table 5. Figure 7 As shown.
[0288] Table 3. Results of antibody pairing combinations
[0289] Table 4. Sensitivity of antibody pairing combinations
[0290] Antibodies 6C11C4 & 13C2A4-Biotin are the optimal combination, demonstrating a sensitivity of 60 pg / mL (Table 4). At least five clones were generated for each antibody when screening for clones with inserts of the correct size corresponding to each of the VH and VL values.
[0291] By comparing the sequences of these clones, common sequences of these clones were generated (antibody 13C2A4: SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 31; antibody 6C11C4-1: SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34 and SEQ ID NO: 35).
[0292] The antibody specificity test results for detecting protein SCW112 (SEQ ID NO: 2) showed that... Figure 8 .
[0293] Example 6. SCW112 Plant expression and efficacy
[0294] This embodiment describes the use of SCW112 in plants to control [a disease / problem] in sugarcane. Sugarcane weevil The method. Specifically, this embodiment describes a method for expressing SCW112 The generation of constructs, the transformation of constructs into sugarcane, and sugarcane SCW112 Assessment of protein presence, determination of the number of inserted transgene copies, and bioassay of the inserted transgene.
[0295] Materials and methods
[0296] Developing constructs using SCW112 and nptII genes
[0297] Constructs for expressing embodiments of this disclosure are developed using conventional gene cloning techniques, including commercial bacterial plasmids, restriction enzyme digestion, and fragment ligation (using ligases).
[0298] The constructor disclosed herein is constructed by using pSCBV- SCW112-tNOS and pZmUbi- nptII Developed using TNOS cassette ligation. The two-cassette T-DNA was transferred from the cloning plasmid to the basal plasmid (a binary plasmid vector with a host bacterial spectrum including *E. coli* and *Agrobacterium tumefaciens*) using restriction endonucleases, thereby generating the publicly disclosed construct. Figure 9 (SEQ ID NO:25).
[0299] After completing the final cloning step, the construct was inserted into *E. coli* strain TOP10 using heat shock technology. The isolated colonies containing the construct were inoculated into LB liquid medium supplemented with 150 µg / mL spectinomycin and cultured at 37°C with shaking at 250 rpm for 16 hours. Then, a stock solution containing bacterial suspension and 10% (v / v) glycerol was prepared and stored in an ultra-low temperature freezer at -80°C.
[0300] The construct of this invention was transferred from *Escherichia coli* to *Agrobacterium tumefaciens* strain EHA105 by isolating and purifying plasmid DNA and transforming it into *Agrobacterium tumefaciens* using electroporation. Similar to the *E. coli* strain, the stock solution containing *Agrobacterium tumefaciens* suspension and 10% (v / v) glycerol was stored in an ultra-low temperature freezer at -80°C.
[0301] Agrobacterium-mediated plant transformation
[0302] To obtain embryogenic callus, sugarcane leaf rolls grown in the field or greenhouse for up to 12 months were collected to isolate the initial explants.
[0303] After surface sterilization, under aseptic conditions, cross sections approximately 0.05–5 mm thick were cut from above the meristem. The sections were placed on the surface of callus induction medium [MS – Murashige and Skoog, from Murashige and Skoog (1962) A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures. Plant Physiology, 15, 473–497; sucrose, vitamin B5, amino acids selected from proline, casein hydrolysate, citric acid, mannitol, copper sulfate, glycine, gelling agent, 2,4-D]. The cultures were kept in the dark at 26 ± 2°C and passaged every 15 days for 3–5 cycles, each cycle lasting 7–28 days. One week before transformation, callus tissue with characteristics favorable to embryogenesis was selected again: nodular, compact, opaque, and slightly yellowish.
[0304] The Agrobacterium culture contained strain EHA105 transformed by the construct of this invention, and was cultured in glycerol stock solution as the starting medium at 28°C in the dark for 2-3 days. The culture was resuspended in MS liquid medium supplemented with acetylsyleugenone to prepare an Agrobacterium suspension, and the final OD was adjusted. 600 It is prepared at a concentration of 0.1-1.0 (MS salt, sucrose, and vitamin B5) for infection of callus tissue.
[0305] Callus tissue with embryogenesis characteristics was selected by visual inspection and directly transferred to Agrobacterium suspension, and stirred at a constant speed of 50 rpm for 30 minutes in the dark.
[0306] Subsequently, callus tissue was isolated from the Agrobacterium suspension and excess suspension was removed. The callus tissue was then placed in a semi-solid culture medium (MS salt, sucrose, vitamin B5, citric acid, gelling agent, 2,4-D and acetylsuccinone) and cultured at 22°C in the dark for 1–5 days.
[0307] After co-culturing, the callus tissue was transferred to DT resting medium (MS salt; sucrose, vitamin B5, amino acids selected from proline and asparagine, casein hydrolysate, citric acid, copper sulfate, glycine, gelling agent, 2,4D, timentin) and stored in the dark at 26°C for 5–14 days.
[0308] Transformed cells were screened by continuous subculturing in a selective medium containing phytoregulators and the selector genistein. The selective medium containing genistein included MS salts, sucrose, vitamin B5, amino acids selected from proline and asparagine, casein hydrolysate, copper sulfate, glycine, a gelling agent, 2,4D, and termetin. Callus was kept in the dark at 26°C for 21 days, then transferred to regeneration medium (equivalent to the selective medium without 2,4D), followed by elongation medium (containing MS salts, sucrose, vitamin B5, casein hydrolysate, a gelling agent, and termetin). The callus was exposed to a 16-hour photoperiod at 4,000 lux in the presence of the selector for proliferation, rooting, and acclimatization, before being transferred to a greenhouse. This process was used to generate clones expressing the target protein.
[0309] Enzyme-linked immunosorbent assay (ELISA)
[0310] To assess SCW112 protein activity using ELISA, different sugarcane tissues at different stages of crop development were studied.
[0311] To analyze SCW112 protein by ELISA, 200 mg ± 1 plant tissue samples were impregnated using a TissueLyser instrument (QIAGEN, Germanytown, Maryland, USA). 350 µL of phosphate extraction buffer (PBS) containing Tween™ 20 (0.138 M NaCl; 0.027 mM KCl; 0.05% Thermo Scientific™ Tween™ 20, pH 7.4) was added to the impregnated tissue.
[0312] After adding buffer, homogenize by vortexing, then centrifuge at maximum speed for 20 minutes. Collect the supernatant and quantify total protein using the Bradford method (SCW112).
[0313] The standards used to obtain calibration curves were the diluted commercially available BSA (bovine serum albumin) standards provided in the kit described above. Standard solutions (prepared with PBST buffer) at concentrations of 2000 µg / mL, 1000 µg / mL, 500 µg / mL, 250 µg / mL, 125 µg / mL, and 0 µg / mL were used. 10 µL of each standard solution was added to the wells of the microplate in triplicate. A total of six curves were generated through independent dilutions. For the samples, 10 μL of the three independent protein extracts was used per well. Then, 200 μL of Coomassie Brilliant Blue reagent solution was added to each well containing the calibrator and sample. The plate was capped and incubated at room temperature for 5 minutes. The absorbance at 595 nm was read using SoftmaxPro® 7.0 software (Molecular Device, US).
[0314] Each study sample was measured three times to obtain total soluble protein. After each repeated quantification of total protein, the sample with the smallest median variation in quantification was selected for ELISA analysis. After total protein quantification, the sample was diluted 8-fold.
[0315] The SpectraMax® microplate reader (Molecular Devices, USA) was used to read the spectra in 96-well plates at two different wavelengths, 450 nm and 630 nm, to obtain the results. For SCW112, a commercially available His-tag kit was used for protein detection and quantification.
[0316] The analysis was based on the correlation between the absorbance values of the test samples and the predicted values in the equation estimated by measuring the absorbance of the standard curve. Synthetic proteins were diluted to the desired concentration in PBST buffer. Each sample was analyzed in duplicate. SCW112 protein concentrations are expressed based on total protein (µg / mg).
[0317] Determine the copy number of the transgene inserted into the host plant germplasm.
[0318] Taqman® PCR (qPCR / Taqman®) assessment of inserted plants SCW112 and nptII Gene copy number. Taqman® real-time PCR reactions were performed using QuantStudio 6 and 7 Flex Real-Time PCR (Applied Biosystems™, EUA). The primer pairs and probes used are shown in Table 5. SCW112 and nptII The endogenous positive control for the reaction (used to confirm the presence and quality of the DNA used and the validity of the reaction), the sugarcane polyubiquitin gene (forward primer: 5'ACCATTACCCTGGAGGTTGAGA 3' (SEQ ID NO: 36); reverse primer: 5'GTCCTGGATCTTCGCCTTCA 3' (SEQ ID NO: 37); probe: VIC-5'CTCTGACACCATCGAC 3'-MGB (SEQ ID NO: 38) was used in multiplex mode.
[0319] Table 5. Primer pairs and probes
[0320] The qPCR reaction used 1X TaqMan® Fast PCR Master Mix II (Applied Biosystems, USA), and the concentrations of each primer and corresponding probe were specified (Table 5). The thermal cycling program was as follows: 50°C for 2 minutes to activate uracil N-glycosylation enzyme; 95°C for 20 seconds to activate DNA polymerase; 40 cycles of 95°C for 3 seconds (denaturation) and 60°C for 30 seconds (annealing and extension).
[0321] Data analysis was performed by manually inputting the threshold for the exponential phase of the amplification curve. For SCW112 and nptII Gene copy number is inferred through DeltaCt (dCt) analysis, which subtracts the Ct value of the target gene (the number of cycles at which the fluorescence signal emitted by the amplified product reaches a threshold) from the Ct value of the endogenous gene. In this analysis, it is assumed that the copy number doubles at each Ct value, and a known copy number of the same control is used as a reference.
[0322] In vitro biological test: Sugarcane weevil
[0323] Using the generated events, in vitro bioassays (feed bioassays) were conducted on the target pest, the sugarcane weevil. The results showed that the insecticidal protein SCW112 expressed in the plant can effectively control the pest.
[0324] For bioassays, plant tissues from genetically modified sugarcane plants (successful events) and non-transgenic sugarcane plants (negative controls) were collected, freeze-dried, mixed with insect gel bait, and aliquoted into bioassay plates. Each well of the culture plate was inoculated with... Sugarcane weevil The larvae (neonate) were incubated for 7 days at 25±1℃, relative humidity 60±10%, and photoperiod 12:12h (light:dark). At the end of the incubation period, the larval mortality rate was assessed.
[0325] result
[0326] SCW112 The generated constructs are as follows Figure 9 As shown, its sequence is SEQ ID NO: 25. According to the... SCW112 and nptII The conversion events performed selected one or two. SCW112 and nptII Gene copying events are tested in vitro.
[0327] After 7 days of bioassays, the modified plants ( SCW112 The average mortality rate of expression plants was 70%. Figure 10 ).
[0328] Example 7. Variants of SCW112
[0329] This example demonstrates the generation of a variant of the protein SCW112 that exhibits the same insect pest resistance function as SCW112, including resistance to... Sugarcane weevil Toxicity.
[0330] As is well known, the 3D structure of a protein mainly determines its functionality. Therefore, a variant protein sequence that can fold into the SCW112 3D structure was identified.
[0331] Materials and methods
[0332] Predicting the 3D trimeric structure of SCW112 using the cutting-edge deep learning algorithm AlphaFold 2 (AF2) (Jumper J et al. (2021) Highly accurate protein structure prediction with AlphaFold. Nature. 596:583–589; Evans, R. et al. (2021) Protein complex prediction with AlphaFold-Multimer. BioRxiv www.biorxiv.org / content / 101101 / 20211004463034v2). Generating sequence variants that may fold into the 3D structure of SCW112 using ProteinMPNN (Dauparas, J. et al. (2022) Robust deep learning-based protein sequence design using ProteinMPNN. Science 378, 49–56). All sequence alignment maps were performed using ENDscriptserver (Xavier Robert and Patrice Gouet (2014) Deciphering key features in protein structures with the new ENDscript server). Nucleic Acids Research (Volume 42, Issue W1, 1 July) was created.
[0333] result
[0334] Computer evaluation predicted 16 new variants that share 45% to at least 65% identity with SEQ ID NO: 2 (the initial protein sequence of SCW112), presented in SEQ ID NO: 7-22 and Tables 6 and 7 below.
[0335] Table 6. Variant sequences of protein SCW112 with at least 65% identity
[0336] Table 7. Variant sequences of protein SCW112 with 45% to 65% identity
Claims
1. A chimeric polypeptide comprising: a) a sequence containing domain I and domain II of a Cry8Ba1 protein; and b) a domain III sequence of a Cry1A protein or a domain III sequence derived from a Cry1Ad protein.
2. The chimeric polypeptide of claim 1, wherein the polypeptide comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, or SEQ ID NO: 22, and / or a variant or fragment thereof.
3. The recombinant polypeptide according to claim 1 or claim 2, wherein the sequences comprising domain I and domain II of the Cry8Ba1 protein contain sequences having at least 80%, at least 83%, at least 85%, at least 87%, at least 90%, at least 93%, at least 95%, or at least 97% sequence identity with SEQ ID NO: 1, and wherein the sequence comprising domain III of the Cry1A protein contains sequences having at least 80%, at least 83%, at least 85%, at least 87%, at least 90%, at least 93%, at least 95%, or at least 97% sequence identity with SEQ ID NO:
3.
4. A chimeric polypeptide comprising: at least one amino acid substitution, deletion, and / or insertion compared to at least one of SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22; and at least one amino acid substitution, deletion, and / or insertion compared to at least one of SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO:
22. Compared to at least one of SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22, at least one addition at the N-terminus or C-terminus; compared to at least one of SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22, at least one domain swap;At least one truncated compared to at least one of SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22; and / or truncated compared to at least one of SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 22; and / or truncated compared to at least one of SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO:
22. At least one of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22 is modified compared to at least one other modification.
5. The chimeric polypeptide according to any one of claims 1-4, wherein the polypeptide has insecticidal activity against at least one agricultural insect pest, wherein the at least one insect pest is a coleopteran pest, and optionally wherein the coleopteran pest is Sugarcane weevil ( Sphenophorus levis ).
6. A polynucleotide encoding a polypeptide of any one of claims 1-5.
7. The polynucleotide of claim 6, wherein the polynucleotide comprises SEQ ID NO:
4.
8. The polynucleotide of claim 6, wherein the polynucleotide has a codon optimized for expression in an agriculturally important crop, optionally wherein the agriculturally important crop is sugarcane, and wherein the polynucleotide comprises SEQ ID NO:
5.
9. The polynucleotide of claim 6, wherein the polynucleotide is a non-genomic polynucleotide; optionally, wherein the polynucleotide is a synthetic polynucleotide, and / or wherein the polynucleotide is cDNA.
10. An isolated construct or expression cassette comprising a nucleotide encoding a polypeptide of any one of claims 1-5 or a polynucleotide of any one of claims 6-9, wherein the nucleotide or polynucleotide is operatively linked to a promoter and optionally operatively linked to a heterologous regulatory element.
11. The isolated construct or expression cassette according to claim 10, wherein the polypeptide comprises at least one of SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22, and / or wherein the polynucleotide comprises SEQ ID NO: 4 or SEQ ID NO:
5.
12. The isolated construct or expression cassette according to claim 10 or claim 11, wherein the promoter is selected from constitutive promoters, inducible promoters, and tissue-specific promoters.
13. A transgenic plant, plant part, propagule, seed, tissue, organ, embryo or plant cell comprising a polypeptide of any one of claims 1-5, a polynucleotide of any one of claims 6-9, or an isolated construct or expression cassette of any one of claims 10-12.
14. An insecticide composition comprising: (i) One or more polypeptides of any one of claims 1-4, wherein the concentration of said one or more polypeptides is sufficient to control at least one agricultural insect pest. (ii) one or more polynucleotides of any one of claims 6-9, wherein said polynucleotide has a codon optimized for expression in agriculturally important crops; and / or (iii) One or more separate constructs or expression boxes according to any one of claims 10-12; Optionally, the one or more polypeptides comprise SEQ ID NO: 2; and / or Optionally, the one or more polynucleotides comprise SEQ ID NO: 4 or SEQ ID NO:
5.
15. The insecticidal composition of claim 14, wherein the at least one insect pest is a coleopteran pest, and wherein when the composition is applied to plants or plantations, the concentration of the one or more polypeptides present is sufficient to control at least one agricultural insect pest in or on the plant.
16. The insecticidal composition according to claim 14 or claim 15, further comprising one or more inert components and / or an acceptable carrier; (i) The composition is formulated as a suspension, solution, emulsion, spreader, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granules, adjuvant, paste, gel, culture medium, artificial feed, or encapsulated in an agriculturally acceptable carrier; (ii) wherein the composition is formulated as an orally acceptable, orally administerable or orally ingestible bait for consumption by insect pests; (iii) The composition is formulated for direct soil application and / or direct potting substrate application; and / or (iv) The composition is formulated as a controlled-release formulation.
17. The insecticidal composition according to any one of claims 14-16, wherein, Control of Coleoptera pests includes: a) Reduces pest infestation by 40%, 50%, 60%, 70%, 80%, 90%, or 100%; or b) Increases pest mortality by 40%, 50%, 60%, 70%, 80%, 90%, or 100%.
18. The insecticidal composition according to any one of claims 15-17, wherein the coleopteran pest is Sugarcane Elephant First .
19. A method for controlling insect pest populations, comprising: a) Provide a composition comprising at least one polypeptide of any one of claims 1-5 or provide a composition of any one of claims 14-18; and b) Contact the insect pest population with an effective amount of the composition; Optionally, the at least one polypeptide comprises SEQ ID NO:
2.
20. The method of claim 19, wherein: (i) The contact in step (b) includes one or more of the following: providing the pest with a composition formulated as an insect bait; feeding the pest with the composition; applying the composition to the outer surface of the pest; applying the composition to a plant; applying the composition to a plant part fed by the pest; applying the composition to a soil area where the pest may be present; applying the composition to an area where the pest population may be present; providing the composition formulated as a controlled-release formulation to an area where the pest is expected to appear; applying the composition to an insect pest trap; injecting the composition into a plant; or injecting the composition into a pest; or (ii) wherein the contact in step (b) comprises applying the composition to a plant or an area to be planted, optionally wherein the composition is applied to the plant in at least one of the following manner: foliar treatment, seed coating, injection treatment, pre-emergence treatment and / or post-emergence treatment.
21. The method according to claim 19 or claim 20, wherein the composition is formulated as a suspension, solution, emulsion, spreader, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granules, adjuvant, paste, gel, culture medium, artificial feed, or encapsulated in an agriculturally acceptable carrier; and / or wherein the composition is prepared by drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, cryopreservation, or concentration.
22. The method according to any one of claims 19-21, wherein feeding, spraying, dusting, coating, or wetting with the composition, or any combination thereof, brings the pest into contact with an effective amount of the composition.
23. The method according to any one of claims 19-22, wherein the insect pest population is reduced by 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to an insect pest population that has not been exposed to the composition; optionally wherein the insect pest or insect pest population is resistant to at least one Bt toxin.
24. The method according to any one of claims 19-23, further comprising providing a chemical mixture, an insecticidal protein, and / or a biocontrol agent, and contacting an insect pest population with an effective amount of the chemical mixture, the insecticidal protein, and / or the biocontrol agent before, during, or after step (b).
25. The method according to any one of claims 19-24, wherein the insect pest is a coleopteran pest, and optionally wherein the coleopteran pest is Sugarcane weevil .
26. A method for controlling insect pest populations, comprising: a) Providing an insecticidal composition comprising at least one of the polypeptides of any one of claims 1-5; b) Introducing the insecticidal composition into an insect pest population, wherein the introduction is achieved by providing the composition in or on a food source of the insect pest; and The population of the aforementioned insect pests has decreased.
27. Use of the chimeric polypeptide of any one of claims 1-5 for inhibiting insect growth, controlling or killing insects and / or controlling or killing insect populations.
28. A kit for detecting peptides and / or polynucleotides, comprising tools for detecting the presence of one or more peptides according to any one of claims 1-5 and / or one or more polynucleotides according to any one of claims 6-8, wherein the tools comprise primer pairs designed for binding to the polynucleotides, or wherein the tools comprise primer pairs and probes designed for binding to the polynucleotides, and / or wherein the tools comprise antibodies for detecting the peptides.
Citation Information
Patent Citations
Insecticidal proteins
US20160304569A1
Process for amplifying, detecting, and / or-cloning nucleic acid sequences
US4683195A
Process for amplifying nucleic acid sequences
US4683202A
Process for amplifying, detecting, and / or cloning nucleic acid sequences
US4800159A
Bacillus thuringiensis toxins active against scarab pests
US5554534A