A pullulanum and its application
By screening and optimizing high-yield β-glucosidase-producing *Diplostomum tumefaciens* strains, the generation of flavor compounds during fermentation has been enhanced, solving the problem of low carbon source utilization efficiency in traditional fermentation systems. This technology can be applied in the food, brewing, feed, and pharmaceutical industries.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ANGEL YEAST CO LTD
- Filing Date
- 2026-01-12
- Publication Date
- 2026-06-09
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbiology, specifically relating to a type of yeast called *Cytomyces hygroscopicus* and its applications. Background Technology
[0002] Capsule-coated yeast ( Saccharomycopsis fibuligera *Diplostomum tumefaciens*, also known as *Diplostomum tumefaciens*, secretes essential enzyme systems such as amylase, protease, and β-glucosidase, which are indispensable in the fermentation process. These enzymes play a crucial role in the formation of nutrients and flavor compounds in fermented foods. *Diplostomum tumefaciens*, with its excellent enzyme and aroma production capabilities, has high application value in the fermentation industry. However, in traditional fermentation systems, the inefficient hydrolysis of glycoside-type flavor precursors is a key technical bottleneck restricting the aroma intensity of the product.
[0003] β-Glucosidases, as key enzymes that specifically hydrolyze β-1,4-glycosidic bonds, have extremely broad substrate adaptability, encompassing plant-based glycosides, cellulose derivatives, and non-plant substrates. They have become crucial enzymes in the field of biocatalysis due to their efficient release of free functional molecules, such as flavor compounds, active ingredients, and monosaccharides. They play a central role in industries such as food fermentation, biofuels, pharmaceuticals, and animal feed. However, the generally low activity of these enzymes significantly limits their large-scale, efficient production and application.
[0004] Chinese patent CN119193352A discloses a type of *Saccharomyces cerevisiae* and its application in rice wine. The patent systematically detected the activities of key enzymes such as amylase, saccharifying enzyme, and esterifying enzyme in the *Saccharomyces cerevisiae* strain, providing important evidence for optimizing rice wine fermentation processes. However, since β-glucosidase is a key enzyme affecting the release of flavor substances and aroma formation in fermentation products, its activity directly relates to the decomposition efficiency of glycoside aroma precursors in rice wine. This patent did not detect or analyze β-glucosidase, leading to an inability to comprehensively assess the strain's potential in flavor substance synthesis, or the risk of missing key flavor control indicators, thus affecting the complete evaluation of the strain's fermentation performance and in-depth optimization of the process.
[0005] Chinese patent CN106498018A discloses a method for preparing rare ginseng anticancer saponin Compound K using compound bacteria. However, this patent does not provide a detailed discussion of the β-glucosidase activity level of the sacchariformis yeast strain and its specific mechanism of action in the compound bacteria system. As a result, the contribution of this strain to the beneficial effects described in the patent (such as increased CK yield and improved flavor) cannot be clearly defined, which affects the in-depth analysis of the synergistic mechanism of compound bacteria and the targeted design of process optimization. Summary of the Invention
[0006] The problem with the existing technology is that there is a lack of a high-yield β-glucosidase-producing *Diospyros koraiensis* strain. This results in limited utilization of carbon sources containing β-glucosidic bonds and low hydrolysis efficiency of glycosides by *Diospyros koraiensis* in traditional fermentation systems, leading to insufficient release of flavor compounds in the fermentation system.
[0007] To address the aforementioned problems in the existing technology, this invention provides a high-yield β-glucosidase-producing *Diplostomum tumefaciens* yeast. This *Diplostomum tumefaciens* yeast has the ability to efficiently utilize carbon sources containing β-glucosidic bonds during fermentation, exhibits high hydrolysis efficiency of glycosides, and effectively increases the content of flavor substances, thereby endowing the product with a unique taste and flavor. This lays an important foundation for promoting product quality upgrades in the food, brewing, and feed industries.
[0008] The specific technical solution is as follows:
[0009] Technical Solution 1: A type of *Saccharomyces cladosporium*, characterized in that the *Saccharomyces cladosporium* is: *Saccharomyces cladosporium* (… Saccharomycopsis fibuligera AMCC 32248, accession number CCTCC NO: M20251908.
[0010] Technical Solution 2: The *Saccharomyces cladosporium* according to Technical Solution 1, characterized in that the ITS sequence of the *Saccharomyces cladosporium* is as shown in SEQ ID NO.3.
[0011] Technical Solution 3: The *Saccharomyces cladosporium* according to Technical Solution 1 or 2, characterized in that the *Saccharomyces cladosporium* carries... BGL1 Genes, the ones mentioned BGL1 The gene sequence is shown in SEQ ID NO.6, wherein, the BGL1 The gene is the β-glucosidase synthesis gene.
[0012] Technical Solution 4: The *Saccharomyces cerevisiae* according to any one of Technical Solutions 1-3 is characterized in that it has enzyme-producing characteristics, wherein the enzyme is selected from one or more of the group consisting of amylase, protease, esterase and β-glucosidase.
[0013] Technical Solution 5: The *Saccharomyces cerevisiae* strain according to Technical Solution 4 is characterized in that the β-glucosidase activity is 249.2 ± 8.7 U / L, wherein U / L represents the amount of enzyme released per minute by a liter of *Saccharomyces cerevisiae* suspension at pH 5.0 and temperature 40°C, which is 1 µmol pNP.
[0014] Technical Solution 6: The *Saccharomyces cerevisiae* according to Technical Solution 4 or 5, characterized in that the β-glucosidase is a broad-spectrum β-D-glucosidase with enzyme classification number EC3.2.1.21.
[0015] Technical Solution 7: The *Saccharomyces cerevisiae* according to any one of Technical Solutions 1-6, characterized in that it has the ability to specifically hydrolyze carbon sources containing β-glucosidic bonds, preferably, the carbon source containing β-glucosidic bonds includes cellobiose.
[0016] Technical Solution 8: The *Saccharomyces cerevisiae* according to Technical Solution 7 is characterized in that it also has the ability to utilize other carbon sources, wherein the other carbon sources include glucose, sucrose, xylose, melibiose, sucralose, inulin, stachyose, trehalose, maltose, or fructose.
[0017] Technical Solution 9: A β-glucosidase enzyme solution, characterized in that it is prepared by a method comprising the following steps: fermenting and culturing *Diplostomum tumefaciens* as described in any one of Technical Solutions 1-8.
[0018] Technical Solution 10: The β-glucosidase enzyme solution according to Technical Solution 9 is characterized in that the enzyme activity in each L of β-glucosidase enzyme solution is 345.6-371.00 U.
[0019] Technical Solution 11: The β-glucosidase enzyme solution according to Technical Solution 9 or 10 is characterized in that the fermentation temperature is 25-30℃, and / or the fermentation time is 48-60h, and / or the fermentation pH is 5-6.
[0020] Technical Solution 12: A method for preparing β-glucosidase enzyme solution according to any one of technical solutions 9-11, characterized in that it includes the following steps: fermenting and culturing *Saccharomyces cerevisiae* according to any one of technical solutions 1-8.
[0021] Technical Solution 13: The preparation method according to Technical Solution 12 is characterized in that the fermentation culture medium includes yeast extract, glucose, cellobiose and tryptone, preferably, each L of the fermentation culture medium includes 9-11g of yeast extract, 18-22g of glucose, 18-22g of cellobiose and 18-22g of tryptone.
[0022] Technical Solution 14: A β-glucosidase, characterized in that it is prepared by any one of the β-glucosidase enzyme solutions in technical solutions 9-11, preferably, the β-glucosidase is a broad-spectrum β-D-glucosidase, more preferably, the enzyme activity in each L of the β-glucosidase enzyme solution is 345.6-371.00 U.
[0023] Technical Solution 15: A fermentation product, characterized in that it is prepared by a method comprising the following steps: fermenting *Diplostomum tumefaciens* as described in any one of Technical Solutions 1-8 in a culture medium containing a β-glucosidic carbon source.
[0024] Technical Solution 16: The fermentation product according to Technical Solution 15, characterized in that the culture medium containing the β-glucosidic carbon source is a culture medium containing cellobiose.
[0025] Preferably, each L of the culture medium containing cellobiose comprises 90-110 g of cellobiose.
[0026] More preferably, each L of the cellobiose-containing culture medium further includes 9-11 g of yeast extract, 18-22 g of glucose, and 18-22 g of tryptone.
[0027] Technical Solution 17: The fermentation product according to Technical Solution 15 or 16 is characterized in that the volatile aroma substances in the fermentation product include alcohols and aldehydes.
[0028] Technical Solution 18: The fermentation product according to Technical Solution 17, characterized in that the aldehydes include n-octanal, 10-undecenal, and phenylacetaldehyde; preferably, the aroma activity value of the n-octanal is 1.08-2.00, and / or the aroma activity value of the 10-undecenal is 10.31-15.00, and / or the aroma activity value of the phenylacetaldehyde is 7.24-10.00, and / or the aroma activity value of the perillol is 1.09-1.60;
[0029] The alcohols include perillyl alcohol, preferably, the aroma activity value of the perillyl alcohol is 1.09-1.60.
[0030] Technical Solution 19: The fermentation product according to Technical Solution 17, characterized in that the aldehydes further include (Z)-4-decenal, preferably, the aroma activity value of (Z)-4-decenal is 1.01-1.50.
[0031] And / or the alcohols may further include isoamyl alcohol and phenethyl alcohol, preferably, the aroma activity value of the isoamyl alcohol is 1.18-2.00; and the aroma activity value of the phenethyl alcohol is 12.27-12.50.
[0032] Technical Solution 20: The fermentation product according to any one of Technical Solutions 15-19, characterized in that the volatile aroma substances further include esters and acids.
[0033] Preferably, the esters include isoamyl acetate and propyldecyl lactone; more preferably, the aroma activity value of isoamyl acetate is 195.47-230.00, and the aroma activity value of propyldecyl lactone is 286.42-300.00.
[0034] Preferably, the acidic substance includes isovaleric acid; more preferably, the aroma activity value of the isovaleric acid is 2.31-2.35.
[0035] Technical Solution 21: The application of the *Saccharomyces cerevisiae* strain described in any one of Technical Solutions 1-8, or the β-glucosidase enzyme solution described in any one of Technical Solutions 9-11, or the β-glucosidase described in Technical Solution 14, or the fermentation product described in any one of Technical Solutions 15-20, in food, feed, or medicine.
[0036] The beneficial effects of this invention are as follows: Through a multi-dimensional evaluation system including hydrolysis zone phenotypic screening, broad-spectrum substrate utilization analysis, and enzyme activity detection, this invention demonstrates that the *Diplostomum tumefaciens* AMCC 32248 provided by this invention possesses highly efficient β-glucosidase synthesis capacity and broad-spectrum substrate adaptability. After optimization of enzyme production conditions, enzyme activity was significantly improved, reaching 358.3±12.7 U / L, achieving highly efficient expression; gene-level analysis further revealed key sequence characteristics. In a simulated fermentation system, *Diplostomum tumefaciens* AMCC32248 can effectively increase the content of acid and ester flavor compounds, simultaneously solving the core bottleneck problems of low carbon source utilization efficiency and insufficient flavor release. Attached Figure Description
[0037] Figure 1 The colony morphology of *Saccharomyces cerevisiae* AMCC 32248.
[0038] Figure 2 Microscopic morphology of *Saccharomyces cerevisiae* AMCC 32248.
[0039] Figure 3 Growth curves of *Diplostomum cladosporum* AMCC 32248 and *Saccharomyces cerevisiae* AMCC 31194 in cellobiose assimilation screening medium.
[0040] Figure 4 This is the standard curve for p-nitrophenol (pNP).
[0041] Figure 5 The result of response surface methodology optimization for enzyme production process is shown in the figure.
[0042] Figure 6 The result of response surface methodology optimization for enzyme production process is shown in the figure.
[0043] Microbial strain preservation information
[0044] The present invention provides *Saccharomyces cerevisiae* (Saccharomyces cerevisiae). Saccharomycopsis fibuligera AMCC 32248 was deposited at the China Center for Type Culture Collection on August 27, 2025, with accession number CCTCC NO: M 20251908. The depository address is: Wuhan University, Wuhan, China, Postcode: 430072; Telephone: 027-68754052.
[0045] The brewing yeast used in this invention ( Saccharomyces cerevisiae AMCC 31194 was deposited at the China Center for Type Culture Collection (CCTCC) on December 29, 2021, with accession number CCTCC NO: M 20211684. The depository address is: Wuhan University, Wuhan, China, Postcode: 430072; Telephone: 027-68754052. This strain has been described in international application PCT / CN2023 / 079576 (publication number WO2023 / 226508A1) and Chinese patent application CN117165456A. Detailed Implementation
[0046] The *Saccharomyces cerevisiae* AMCC 32248 provided by this invention, through enzyme activity phenotypic screening, carbon source utilization analysis, and quantitative enzyme activity detection, showed that this strain possesses highly efficient β-glucosidase activity; further analysis of key genes related to β-glucosidase... BGL1 Specific functional sequences were extracted and identified. Enzyme production conditions were optimized using response surface methodology, resulting in a significant increase in enzyme activity compared to before optimization. In a simulated fermentation system, this strain significantly promoted the production of specific acids, esters, aldehydes, alcohols, and other volatile flavor compounds. Its enzyme production characteristics and flavor regulation capabilities provide a new technical solution for addressing issues such as low hydrolysis efficiency of glycosides and insufficient flavor release in fermentation systems, showing potential applications in the food, brewing, feed, and pharmaceutical industries.
[0047] To better understand the above technical solutions, the technical solutions of the present invention will be clearly and completely explained below in conjunction with specific embodiments. It should be noted that the content of the specific embodiments is only a specific implementation and explanation of the technical solutions of the present invention, and should not be construed as a limitation on the scope of protection of the present invention.
[0048] In some specific embodiments, the present invention provides a *Saccharomyces clavatum* species, characterized in that the *Saccharomyces clavatum* species is: *Saccharomyces clavatum* (… Saccharomycopsis fibuligera AMCC 32248, accession number CCTCC NO: M 20251908, wherein the *Saccharomyces cerevisiae* has the characteristic of producing β-glucosidase.
[0049] It should be noted that the *Saccharomyces cerevisiae* has the ability to specifically hydrolyze carbon sources containing β-glucosidic bonds, and can hydrolyze a variety of β-glucosidic substrates (such as aromatic substrates, cellobiose, etc.). Therefore, the β-glucosidase produced by *Saccharomyces cerevisiae* has broad substrate specificity, that is, the β-glucosidase belongs to the broad-spectrum β-glucosidase with enzyme classification number EC3.2.1.21.
[0050] In some specific embodiments, the present invention provides a fermentation product prepared by a method comprising the following steps: fermenting the aforementioned *Diplostomum tumefaciens* in a culture medium containing a β-glucosidic carbon source.
[0051] Preferably, in some specific embodiments, the volatile flavor substances in the fermentation product include alcohols and aldehydes. Preferably, each L of the fermentation broth contains 6132.4-6200.0 μg of alcohols and / or 96.2-100.0 μg of aldehydes.
[0052] Preferably, in some specific embodiments, the volatile flavor substances in the fermentation product further include esters and acids. Preferably, each L of the fermentation broth contains 792.9-800.0 μg of esters and / or 3003.8-3010.0 μg of acids.
[0053] Preferably, in some specific embodiments, the aldehydes include n-octanal, 10-undecenal, and phenylacetaldehyde; wherein each L of the fermentation broth contains 7.45-13.8 μg of n-octanal, and / or 14.44-21.00 μg of 10-undecenal, and / or an aroma activity value of 12.31-17.00 μg of phenylacetaldehyde; the alcohols include perillyl alcohol, wherein each L of the fermentation broth contains 32.7-48.0 μg of perillyl alcohol.
[0054] The aldehydes also include (Z)-4-decenal, wherein each L of the fermentation broth contains 22.2-33.0 μg of (Z)-4-decenal.
[0055] And / or the alcohols also include isoamyl alcohol and phenylethanol, wherein each L of the fermentation broth contains 1154-1225 μg of isoamyl alcohol and / or 4785-4875 μg of phenylethanol.
[0056] Preferably, the esters include isoamyl acetate and gamma-decyl lactone, wherein each L of the fermentation broth contains 29.32-34.50 μg of isoamyl acetate and / or 744.7-780.0 μg of gamma-decyl lactone.
[0057] Preferably, the acidic substance includes isovaleric acid, wherein each L of the fermentation broth contains 2777-2820 μg of isovaleric acid.
[0058] In some specific embodiments, when preparing fermentation culture media or culture media containing β-glucosidic carbon sources, the raw materials used in this invention include tryptone and yeast extract. Tryptone and yeast extract primarily exist as organic nitrogen sources in the culture medium, providing the necessary nitrogen for microbial growth during fermentation. Common organic nitrogen sources such as yeast extract and tryptone decompose in the culture medium, releasing amino acids and small peptides, which then become nitrogen sources required for microbial growth. In other words, when using tryptone and yeast extract as common organic nitrogen sources to prepare the culture medium, this invention does not particularly limit their source; they can be commercially available or prepared using conventional methods. Preferably, as long as the commercially available yeast extract has a total nitrogen content of ≥10.0 wt% and an amino nitrogen content of ≥5.0 wt%, it can be used in this invention.
[0059] Preferably, in some specific embodiments, the yeast extract powder, by weight, further comprises: 2-2.5 ppm of vitamin B1, 37-40 ppm of vitamin B2, 113-116 ppm of vitamin B5, 15-20 ppm of vitamin B6, 6-10 ppm of vitamin B7, 25-28 ppm of vitamin B9, 3205-3210 ppm of choline, 1575-1580 ppm of inositol, 325-330 ppm of niacin, and 0.2-0.4 ug of vitamin B12 per 100g of yeast extract powder.
[0060] And / or, by weight of the yeast extract, the content of potassium is 31910-31912 mg / kg, sodium is 5735-5740 mg / kg, calcium is 354-357 mg / kg, magnesium is 2670-2675 mg / kg, zinc is 77-83 mg / kg and iron is 77-83 mg / kg.
[0061] And / or, based on the weight of the yeast extract, the yeast extract comprises: 30.3-40.85% free amino acids and 51-70.5% hydrolyzed amino acids.
[0062] The free amino acid content includes, based on the weight of the yeast extract, 1-2% free aspartic acid, 2-3% free threonine, 1.5-2% free serine, 6.5-7% free glutamic acid, 1-1.5% free glycine, 4-5% free alanine, 0.1-0.15% free cysteine, 2-3% free valine, 0.5-1% free methionine, 2-2.5% free isoleucine, 3.3-3.7% free leucine, 0.5-1% free tyrosine, 1.5-2% free phenylalanine, 2-2.5% free lysine, 0.1-1% free histidine, 1.5-2.5% free arginine, and 0.5-1% free proline.
[0063] The hydrolyzed amino acid content includes, based on the weight of the yeast extract, 6-6.5% hydrolyzed aspartic acid, 2-3% hydrolyzed threonine, 2-3% hydrolyzed serine, 10-15% hydrolyzed glutamic acid, 2-3% hydrolyzed glycine, 5-6% hydrolyzed alanine, 0.5-1% hydrolyzed cysteine, 3-4% hydrolyzed valine, 0.5-1% hydrolyzed methionine, 3-4% hydrolyzed isoleucine, 4-5% hydrolyzed leucine, 1-2% hydrolyzed tyrosine, 2-3% hydrolyzed phenylalanine, 4-5% hydrolyzed lysine, 1-2% hydrolyzed histidine, 3-4% hydrolyzed arginine, and 2-3% hydrolyzed proline.
[0064] Preferably, in some specific embodiments, the tryptone comprises, by weight, 12.89-19.60% free amino acids and 74.1-99.5% hydrolyzed amino acids.
[0065] The free amino acid content, based on the weight of the tryptone, specifically includes: 0.05-0.10% free aspartic acid, 0.05-0.10% free threonine, 0.01-0.50% free serine, 0.05-0.10% free glutamic acid, 0.05-0.10% free glycine, 0.01-0.50% free alanine, 0.01-0.05% free cysteine, and 0.05-0.05% free valine. 10%, free methionine 0.50-1.00%, free isoleucine 0.50-1.00%, free leucine 3.00-3.50%, free tyrosine 0.50-1.00%, free phenylalanine 2.00-3.00%, free lysine 4.00-5.00%, free histidine 0.10-0.50%, free arginine 2.00-3.00%, free proline 0.01-0.05%.
[0066] The hydrolyzed amino acid content, based on the weight of the tryptone, specifically includes: hydrolyzed aspartic acid 6.00-7.00%, hydrolyzed threonine 2.00-3.00%, hydrolyzed serine 1.00-2.00%, hydrolyzed glutamic acid 20.00-25.00%, hydrolyzed glycine 1.00-2.00%, hydrolyzed alanine 1.00-5.00%, hydrolyzed cysteine 0.10-0.50%, and hydrolyzed valine 5.00- 7.00%, hydrolyzed methionine 1.00-2.00%, hydrolyzed isoleucine 4.00-5.00%, hydrolyzed leucine 8.00-9.00%, hydrolyzed tyrosine 1.00-2.00%, hydrolyzed phenylalanine 4.00-5.00%, hydrolyzed lysine 6.00-8.00%, hydrolyzed histidine 2.00-3.00%, hydrolyzed arginine 2.00-3.00%, hydrolyzed proline 10.00-11.00%.
[0067] To better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments. Unless otherwise stated, all raw materials / reagents / instruments used in the embodiments of the present invention are conventional commercially available products.
[0068] The sources of information for the experimental reagents used in this invention are shown in Table 1 below:
[0069]
[0070] The information on the experimental instruments used in this invention is shown in Table 2 below:
[0071]
[0072] The trace elements contained in the yeast extract powder (model: FM888) used in the examples, based on the weight of the yeast extract powder, specifically include: vitamin B1 2.3 ppm, vitamin B2 38.8 ppm, vitamin B5 115.0 ppm, vitamin B6 18.0 ppm, vitamin B7 7.9 ppm, vitamin B9 26.7 ppm, vitamin B12 0.23 (ug / 100g), choline 3206.0 ppm, inositol 1577.7 ppm, and niacin 328.0 ppm.
[0073] The trace elements contained in the yeast extract powder (model: FM888) used in the examples, based on the weight of the yeast extract powder, specifically include: potassium 31911.66 mg / kg, sodium 5738.91 mg / kg, calcium 355.25 mg / kg, magnesium 2673.59 mg / kg, zinc 80.94 mg / kg, and iron 80.21 mg / kg.
[0074] The yeast extract (model: FM888) used in the examples contained 35.1% free amino acids and 61.21% hydrolyzed amino acids.
[0075] The free amino acid content, based on the weight of the yeast extract, specifically includes: 1.6% free aspartic acid, 2.1% free threonine, 1.7% free serine, 6.7% free glutamic acid, 1.2% free glycine, 4.2% free alanine, 0.1% free cysteine, 2.7% free valine, 0.8% free methionine, 2.2% free isoleucine, 3.5% free leucine, 0.9% free tyrosine, 1.8% free phenylalanine, 2.3% free lysine, 0.5% free histidine, 2.0% free arginine, and 0.8% free proline.
[0076] The hydrolyzed amino acid content, based on the weight of the yeast extract, specifically includes: hydrolyzed aspartic acid 6.23%, hydrolyzed threonine 2.71%, hydrolyzed serine 2.73%, hydrolyzed glutamic acid 12.33%, hydrolyzed glycine 2.74%, hydrolyzed alanine 5.17%, hydrolyzed cysteine 0.61%, hydrolyzed valine 3.84%, hydrolyzed methionine 0.84%, hydrolyzed isoleucine 3.65%, hydrolyzed leucine 4.72%, hydrolyzed tyrosine 1.65%, hydrolyzed phenylalanine 2.68%, hydrolyzed lysine 4.63%, hydrolyzed histidine 1.19%, hydrolyzed arginine 3.30%, and hydrolyzed proline 2.19%.
[0077] The tryptone (model: FP318) used in the examples contained 18.4% free amino acids and 85.7% hydrolyzed amino acids.
[0078] The free amino acid content, based on the weight of the tryptone, specifically includes: 0.08% free aspartic acid, 0.60% free threonine, 0.50% free serine, 0.55% free glutamic acid, 0.07% free glycine, 0.45% free alanine, 0.05% free cysteine, 0.95% free valine, 0.70% free methionine, 0.55% free isoleucine, 3.10% free leucine, 0.75% free tyrosine, 2.20% free phenylalanine, 4.70% free lysine, 0.30% free histidine, 2.80% free arginine, and 0.05% free proline.
[0079] The hydrolyzed amino acid content, based on the weight of the tryptone, specifically includes: 6.50% hydrolyzed aspartic acid, 2.20% hydrolyzed threonine, 1.30% hydrolyzed serine, 20.50% hydrolyzed glutamic acid, 1.80% hydrolyzed glycine, 3.00% hydrolyzed alanine, 0.10% hydrolyzed cysteine, 6.60% hydrolyzed valine, 2.00% hydrolyzed methionine, 4.80% hydrolyzed isoleucine, 8.20% hydrolyzed leucine, 1.10% hydrolyzed tyrosine, 4.60% hydrolyzed phenylalanine, 7.20% hydrolyzed lysine, 2.60% hydrolyzed histidine, 3.00% hydrolyzed arginine, and 10.20% hydrolyzed proline.
[0080] The specific method for preparing the culture medium used in this embodiment of the invention is as follows:
[0081] 1. YPD solid medium: Mix 10g of yeast extract FM888, 20g of glucose, 20g of tryptone FP318, 20g of agar and distilled water to a final volume of 1000 mL, and sterilize at 115℃ for 20 min.
[0082] 2. YPD liquid culture medium: Mix 10g of yeast extract FM888, 20g of glucose, 20g of tryptone FP318 and distilled water to a final volume of 1000mL, and sterilize at 115℃ for 20 min.
[0083] 3. Cellulose two-carbon utilization screening medium: Mix 20g cellobiose, 6.7g YNB medium and distilled water to a final volume of 1000 mL, and sterilize by passing through a 0.22μm filter membrane.
[0084] 4. Amylase screening plates: Mix 10 g of soluble starch, 5 g of tryptone FP318, 5 g of sodium chloride, 15 g of agar, and distilled water to a final volume of 1000 mL. Sterilize at 121°C for 15 min. After incubation, evenly spray or invert 1% I2-KI solution onto the plate surface.
[0085] 5. Protease screening plates: Mix 100 g of skim milk powder, 10 g of tryptone FP318, 5 g of sodium chloride, 15 g of agar and distilled water to a final volume of 1000 mL. Sterilize at 121°C for 15 min. Skim milk powder should be dissolved and sterilized separately. After sterilization, mix with other ingredients and pour the mixture onto a plate.
[0086] 6. β-glucosidase screening plate: Mix 3g of aescin, 0.5g of ferric citrate, 2g of sodium chloride, 0.5g of magnesium sulfate heptahydrate, 1g of potassium dihydrogen phosphate, 20g of agar and distilled water, and bring the volume to 1000 mL. Sterilize at 115°C for 20 min.
[0087] 7. Enzyme induction medium: Mix 10g of yeast extract FM888, 20g of glucose, 20g of cellobiose, 20g of tryptone FP318 and distilled water to a final volume of 1000 mL, and sterilize at 115℃ for 20 min.
[0088] 8. Simulated culture medium (POS medium): Mix 10g of yeast extract FM888, 20g of glucose, 100g of cellobiose, 20g of tryptone FP318 and distilled water to a final volume of 1000 mL, pH 5.8, and sterilize at 115℃ for 20 min.
[0089] 9. Carbon source assimilation screening medium: Mix 10g of yeast extract FM888, 20g of carbon source (which is one of glucose, sucrose, xylose, melibiose, maltodextrin, cellobiose, inulin, stachyose, trehalose, galactose, rhamnose, maltose, lactose, or fructose), 20g of tryptone, and 1000mL of distilled water. Sterilize at 115℃ for 20min to obtain 14 carbon source assimilation screening media, namely glucose assimilation screening culture, sucrose assimilation screening culture, xylose assimilation screening culture, melibiose assimilation screening culture, maltodextrin assimilation screening culture, cellobiose assimilation screening culture, inulin assimilation screening culture, stachyose assimilation screening culture, trehalose assimilation screening culture, galactose assimilation screening culture, rhamnose assimilation screening culture, maltose assimilation screening culture, lactose assimilation screening culture, or fructose assimilation screening culture.
[0090] The strains used in the embodiments of this invention are described in detail below:
[0091] The strain isolated and identified in Example 1 of this invention is *Saccharomyces cerevisiae* (…). Saccharomycopsis fibuligera It is named AMCC 32248, with accession number CCTCC NO: M20251908;
[0092] The strains used in Examples 2, 5, and 6 of this invention are *Saccharomyces cerevisiae* (…). Saccharomycopsis fibuligera AMCC 32248, accession number: CCTCC NO: M 20251908;
[0093] The strains used in Examples 3 and 4 of this invention are *Saccharomyces cerevisiae* and *Saccharomyces cerevisiae*, wherein *Saccharomyces cerevisiae* is *Saccharomyces cerevisiae* (… Saccharomycopsis fibuligera AMCC 32248, preservation number: CCTCC NO: M 20251908; brewing yeast is brewing yeast ( Saccharomyces cerevisiaeAMCC31194, accession number: CCTCC NO: M 20211684.
[0094] Example 1: Isolation and Identification of Strains
[0095] One mL of rice wine sample (collected from a farmer in Heping Village, Geputan Town, Yunmeng County, Xiaogan City, Hubei Province) was dissolved in 9 mL of sterile physiological saline to obtain a concentration of 10. -1 Diluent, prepared according to this procedure, has a concentration of 10. -2 10 -3 10 -4 10 -5 10 -6 The diluted solution was spread onto YPD solid medium and incubated at 30°C for 48 hours. Colony morphology was observed on agar plates. Colonies exhibiting typical yeast colony characteristics were selected and streaked onto YPD solid medium. After purification twice, single colonies were inoculated into YPD liquid medium and cultured at 30℃ for 24 h. Yeast genome was extracted. Using ITS1 (5'-TCCGTAGGTGAACCTGCGG-3', SEQ ID NO:1) and ITS4 (5'-TCCTCCGCTTATTGATATGC-3', SEQ ID NO:2) as primers, the PCR program was as follows: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 55℃ annealing for 45 s, 72℃ extension for 60 s, 30 cycles, and a final extension at 72℃ for 10 min. This was used to amplify the ITS gene sequence. After 1% gel electrophoresis and sequencing, the sequence was compared with sequences in GenBank using BLAST analysis. The sequence similarity was greater than 99%, indicating the same species. The ITS gene sequence of this strain, SEQ ID NO:3, is shown below:
[0096] SEQ ID NO:3:
[0097] GAAGGATCATTAATGTTATTTGTTTTTAGACCTGCGCTTAACTGCGCGGTTTAATAAACTCTTATACACAGTGTTTTTGTTTGCGAATTTGGTTTAGTTTGTTGGTTTTCATTCGAAAGGATGAAGATTGATTGCTAAATCTTATTCAGCTTTTT AAACTCAGATCTCTTTTTAAGAGAAATGTATTTTTTTAATTACAACTAGTCGATTTTACAAACTAAAAGTTTAAAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTT TCGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTATAGTATTCTATAGAGCATGCCTGTTTGAGCGTCATTTCTCTCTTAAACCTTTGGGTTTAGTATTGAAGGTTGTGTTAGCTTCTGCTAACTCCTTTGAAATGACTTGGCAATTGATT GAGTTTTCCATATATTTGCTTAAGGATTTAATATTAGGTTCTACCAACTTATTAAATACCCTTTTGCGAAGGACTTACTCGTGTATCAAGGCCTTATAACTTTGTCATTAATTTTGACCTCAAATCAGGTAAGGATACCCGCTGAACTTAAGCATA
[0098] Based on morphological analysis and molecular identification, this strain is *Saccharomyces cerevisiae* (…). Saccharomycopsis fibuligera It was named AMCC 32248 and was deposited at the China Center for Type Culture Collection on August 27, 2025, with accession number CCTCC NO: M 20251908.
[0099] like Figure 1 As shown, Figure 1 The colony morphology of *Saccharomyces cerevisiae* AMCC 32248 was analyzed. The results showed that the colonies of *Saccharomyces cerevisiae* AMCC 32248 were milky white and cheese-like, with a smooth surface, a slightly raised center, and serrated edges accompanied by radial filamentous projections. Typical colonies were picked and slides were prepared for observation under a 40x objective lens. Figure 2 As shown, Figure 2The microscopic morphology of Saccharomycopsis fibuligera AMCC 32248 is shown. The results indicate that the microscopic morphology of Saccharomycopsis fibuligera AMCC 32248 is short columnar, with a size of approximately 3-8 µm × 2-6 µm, showing multipolar budding. A large number of cells are connected end to end to form a pseudohyphal network structure with indistinct septa.
[0100] Example 2: Enzyme activity phenotype screening
[0101] Pick a single colony of Saccharomycopsis fibuligera AMCC 32248 and inoculate it into YPD liquid medium. Incubate it with shaking at 30 °C and 180 r / min for 24 h; after continuous subculture twice, obtain the logarithmic-phase bacterial liquid. Take 2 µL of the activated bacterial liquid and spot inoculate it at the center of the enzyme production screening plates: amylase screening plate, protease screening plate, and β-glucosidase screening plate. Incubate it at a constant temperature of 28 °C for 72 h; judge the corresponding enzyme activity according to the clear zone or color development. Taking the ratio (HC) of the diameter of the clear zone or color development zone to the diameter of the colony as an index, the semi-quantitative classification method is defined as: weak activity (HC < 1.2, +), normal activity (1.2 < HC < 1.5, ++), high activity (HC > 1.5, +++). The results are shown in Table 3 below.
[0102]
[0103] As shown in Table 3, from the phenotypic results, it can be seen that the ratio of the diameter of the amylase clear zone of Saccharomycopsis fibuligera AMCC 32248 is 1.21 ± 0.03, and the ratio of the diameter of the protease hydrolysis zone is 1.29 ± 0.07, both at the normal enzyme activity level; the color development zone of β-glucosidase is 1.68 ± 0.09, at the high enzyme activity level, indicating that this strain has multiple enzyme activity characteristics and shows differential catabolic functional characteristics.
[0104] Example 3: Substrate utilization analysis
[0105] Pick a single colony of Saccharomycopsis fibuligera AMCC 32248 and inoculate it into YPD liquid medium. Incubate it with shaking at 30 °C and 180 r / min for 24 h; after continuous subculture twice, obtain the logarithmic-phase bacterial liquid; take 1 mL of the bacterial liquid and place it in a 2 mL EP centrifuge tube, centrifuge at 8000 r / min for 3 min, and discard the supernatant; add 1 mL of sterile water to resuspend, centrifuge at 8000 r / min for 3 min, and discard the supernatant; repeat the above operations, and then adjust to OD with sterile water 600≈1.0, to obtain a standardized bacterial suspension. Take 2 μL of the bacterial suspension and inoculate 200 μL into each well of an ELISA plate containing one of the 14 carbon source assimilation screening media. Incubate at 30℃ and 180 r / min for 72 h, then observe the turbidity in the wells. Turbidity is used to determine carbon source utilization capacity: strong positive "+++", positive "++", weak positive "+", negative "-". The results are shown in Table 4.
[0106]
[0107] Table 4 shows that *Diplostomum tumefaciens* AMCC 32248 can effectively utilize a variety of carbon sources, including glucose, sucrose, xylose, melibiose, melotriose, cellobiose, inulin, stachyose, trehalose, maltose, and fructose, demonstrating broad-spectrum substrate utilization. In addition to exhibiting high utilization efficiency on conventional carbon sources (glucose, sucrose, fructose, etc.), this strain also shows an advantage in cellobiose metabolism, which preliminarily proves that *Diplostomum tumefaciens* AMCC 32248 has the ability to hydrolyze β-glycosidic bonds.
[0108] To further verify the ability of *Saccharomyces cerevisiae* AMCC 32248 to hydrolyze β-glycosidic bonds, growth characteristics were analyzed using cellobiose as a substrate. Single colonies of *Saccharomyces cerevisiae* AMCC 32248 were picked and inoculated into sterile test tubes containing 5 mL of YPD liquid medium, and cultured at 30℃ and 180 rpm for 24 h with shaking. The bacterial suspension was collected, diluted with sterile water, and the viable cell concentration was adjusted to 10-1. 8 CFU / mL; after centrifugation at 8000 r / min for 3 min, the supernatant was discarded, and the cells were resuspended in sterile water and washed once more by centrifugation to thoroughly remove residual culture medium. Finally, the cells were resuspended in sterile water and aliquoted at a 3% (v / v) inoculum into 100-well microplates containing 300 μL of cellobiose assimilation and selection medium. The culture plates were placed in a Bioscreen C online growth monitoring system with the following parameters set: temperature 30℃, detection time 72 h, wavelength 600 nm, sampling interval 60 min. Sterile medium was used as a blank, and *Saccharomyces cerevisiae* AMCC 31194 was used as a control strain. OD600 data were recorded, and growth curves were plotted. The results are as follows: Figure 3 As shown in Table 5.
[0109]
[0110] like Figure 3 And Table 5, Figure 3The growth curves of *Saccharomyces cerevisiae* AMCC 32248 and *Saccharomyces cerevisiae* AMCC 31194 in cellobiose assimilation screening medium are shown. The results indicate that *Saccharomyces cerevisiae* AMCC 32248 has a significantly higher capacity for cellobiose utilization than *Saccharomyces cerevisiae*. Its growth curve shows a near-linear increase without a significant stagnation period. After 72 hours of cultivation, its OD600 was 1.399, an increase of 82% compared to the control strain. Its specific growth rate was significantly higher than the control strain, and its doubling time was significantly shorter. This fully demonstrates that the *Saccharomyces cerevisiae* AMCC 32248 provided by this invention has a higher utilization efficiency of cellobiose, meaning that the *Saccharomyces cerevisiae* AMCC 32248 provided by this invention can effectively decompose and utilize various glycoside compounds composed of β-glucosidic bonds.
[0111] Example 4: Determination of enzyme activity
[0112] Crude enzyme extraction: Single colonies of *Saccharomyces cerevisiae* AMCC 32248 were picked and inoculated into a test tube containing 5 mL of enzyme induction medium. The culture was incubated at 30℃ and 180 rpm with shaking for 24 h, and subcultured twice to ensure a stable logarithmic growth phase. Then, 5 mL of fermentation broth was centrifuged at 4℃ and 8000 rpm for 10 min to remove the supernatant. The broth was washed twice with 50 mmol / L citrate-phosphate buffer (pH 5.0), and the bacterial suspension was resuspended at a wet weight to buffer ratio of 1:5. 200 μL of this suspension was used as the crude enzyme solution. *Saccharomyces cerevisiae* AMCC 31194 was used as a control strain.
[0113] Standard curve preparation: 0–80 µmol / L p-nitrophenol (pNP) standard curves. Accurately prepare p-nitrophenol (pNP) standard solutions of 0, 20, 40, 50, 60, and 80 µmol / L. Take 1 mL of each solution, add 1 mL of 1 mol / L Na₂CO₃ solution, and measure the OD₄0⁵ nm value. The p-nitrophenol (pNP) standard curves are shown below. Figure 4 As shown:
[0114] Method for β-glucosidase activity assay (Principle: β-glucosidase hydrolyzes pNPG (colorless) to produce glucose and p-nitrophenol (pNP), the latter being yellow under alkaline conditions and exhibiting a strong absorption peak at 405 nm. Enzyme activity can be calculated by measuring the rate of change in absorbance): Using p-nitrophenyl-β-D-glucosidase (pNPG) as the substrate, a 100 mmol / L pNPG stock solution was first diluted to 5 mmol / L with buffer. The total reaction volume was 1 mL, containing 900 μL of pNPG solution and 100 μL of crude enzyme solution. The reaction was incubated at 40 ℃ for 30 min, and immediately 1 mL of 1 mol / L Na2CO3 was added to terminate the reaction and the mixture was stirred. A blank was prepared by replacing the enzyme solution with buffer, and each sample was tested in triplicate. After termination, the mixture was centrifuged at 4000 r / min for 2 min, and the OD405 nm value of the supernatant was measured. The pNP content was calculated according to the standard curve. The enzyme activity formula is as follows:
[0115] β-glucosidase activity (U / L) = released pNP (µmol) ÷ reaction time (min) ÷ enzyme volume (L), where 1 U is defined as the amount of enzyme that catalyzes the release of 1 µmol of pNP per minute at 40 ℃ and pH 5.0. The results are shown in Table 6.
[0116]
[0117] As shown in Table 6, the enzyme activity test results showed that the β-glucosidase activity of AMCC 32248 was 249.2 U / L, which was 10 times higher than that of Saccharomyces cerevisiae AMCC 31194. This means that this strain can rapidly decompose different substrates containing β-glucosidic bonds during fermentation, such as glycoside aroma precursors, polyphenolic glycosides and cello-oligosaccharides, continuously releasing free aromatic molecules to enhance the flavor complexity of the product. At the same time, it generates carbon sources that can be utilized by itself or symbiotic microorganisms, providing key enzymatic hydrolysis power for improving the efficiency and expanding the function of the fermentation process.
[0118] Example 5: Key genes for β-glucosidase synthesis BGL1 Amplification
[0119] Genomic DNA was extracted from *Saccharomyces cerevisiae* AMCC 32248 (genome DNA was extracted from *Saccharomyces cerevisiae* AMCC 32248 according to the instructions in the TIANGEN® Yeast Genomic DNA Extraction Kit). The β-glucosidase encoding gene was then targeted using self-designed primers BGL1-F (5′-TGATGATAGTACAGCTTTTGGTCT-3′, SEQ ID NO:4) and BGL1-R (5′-TCTTGATATCATTAACAGCAACACC-3′, SEQ ID NO:5). BGL1 PCR amplification was performed. The 25 μL reaction system was as follows: 50 ng template DNA, 2.5 μL 10×PCR Buffer, 0.4 μmol / L primers each, 1.0 U Taq DNA polymerase, and ddH2O to a final volume of 25 μL. The amplification program was: 94℃ pre-denaturation for 5 min; followed by 32 cycles (94℃ denaturation for 30 s, 55℃ annealing for 45 s, 72℃ extension for 90 s); and a final extension at 72℃ for 10 min. After the reaction, 5 μL of the product was electrophoresed on a 1.0% (w / v) agarose gel (containing GelRed). Clear bands were visible at 120 V, with a theoretical fragment length of approximately 1.5 kb. After gel purification, the PCR product was sequenced, yielding *Saccharomyces cerevisiae* AMCC 32248. BGL1 The gene sequence is shown in SEQ ID NO:6 below:
[0120] SEQ ID NO:6:
[0121]
[0122] The reference strain KPH12 (GCA_001936155.1) of *Saccharomyces cerevisiae* listed in the NCBI database is compared with that of the reference strain. BGL1 Gene sequence alignment showed that *Diplostomum tumefaciens* AMCC 32248... BGL1 Multiple key base substitutions occurred in the gene sequence, resulting in amino acid variations such as Ser89Arg, Ile243Thr, Met278Ile, Gly380Glu, Lys738Glu, and Leu739Val. Therefore, this specific sequence may be a key sequence feature of its highly active β-glucosidase.
[0123] Example 6: Optimization of enzyme production process
[0124] To investigate the effects of fermentation temperature, fermentation time, and pH on β-glucosidase activity, a three-factor, three-level response surface methodology was conducted based on the Box-Behnken central composite design principle. Fermentation temperature, fermentation time, and pH were used as independent variables, and β-glucosidase activity was used as the response value. A total of 15 experimental sites were set up, including 12 interactive experimental sites for estimating main effects and interactions, and 3 central experimental sites for estimating pure errors and verifying the reproducibility and accuracy of the model. The experimental factors and levels are shown in Table 7. β-glucosidase activity (U / L) was used as the evaluation index. Following the crude enzyme extraction method, standard curve plotting method, and β-glucosidase activity determination method described in Example 4, β-glucosidase activity was measured (i.e., the culture medium used in this example was the enzyme induction medium described). All experimental groups were activated by single-colony inoculation under the same conditions. The response surface methodology and results are shown in Table 8.
[0125]
[0126]
[0127] The variance results are shown in Table 9. The significance of each factor was determined by the p-value: p < 0.05 indicates a significant factor effect; p > 0.05 indicates an insignificant factor effect. The results show that the main effects of factors A (fermentation time), B (pH), and C (fermentation temperature) are all significant, indicating that they independently have a statistically significant impact on the response. Regarding interaction effects, A×B and B×C both have significant effects on the results, while the effect of A×C is not significant. The adjusted sum of squares (ADjSS) was used to measure the degree of influence or importance of each factor. The proportion of each factor's AdjSS to the total AdjSS was calculated; a larger proportion indicates a greater contribution and higher importance to the total variation. The results show that the influencing factors, ranked from highest to lowest importance, are: A×B > A > C > B > B×C. Among them, the interaction A×B is the most significant.
[0128]
[0129] Through data processing and analysis, the results are as follows: Figure 5 and Figure 6 As shown, Figure 5 and Figure 6 The response surface methodology (RSM) optimization results for the enzyme production process were plotted, yielding a maximum predicted value of 360 U / L for the RSM at a fermentation temperature of 28℃, a fermentation time of 60 h, and a pH of 5.8. To verify the model's accuracy, fermentation experiments were conducted using the optimized conditions (28℃, 60 h, and pH 5.8). Three experiments yielded an average β-glucosidase activity of (358.3 ± 12.7) U / L, representing a 43.7% increase compared to the unoptimized activity. The close match between the predicted and actual values indicates the effectiveness of the optimized process based on the regression model. The β-glucosidase process optimized using RSM can significantly improve the β-glucosidase activity of *Diplostomum tumefaciens* AMCC 32248 and can be used to guide actual production.
[0130] Example 7: Detection of Volatile Flavor Compounds
[0131] Single colonies of *Saccharomyces cerevisiae* AMCC 32248 were picked and inoculated into sterile test tubes containing 5 mL of YPD liquid medium. After activation, the culture was activated by shaking at 30℃ and 180 rpm for 24 h. Then, at a 3% inoculum, the culture was transferred to 5 mL of YPD liquid medium and 5 mL of POS medium, respectively, and cultured at 28℃ for 60 h. YPD liquid medium was used to establish a growth baseline; POS medium simulated a glycoside-rich environment to investigate the flavor release potential of *Saccharomyces cerevisiae* AMCC 32248 under these conditions. Flavor detection was performed using headspace solid-phase microextraction (HS-SPME) coupled with gas chromatography-mass spectrometry (GC-MS). Sample pretreatment: 5 mL of fermentation broth supernatant was taken and 1.5 g of sodium chloride was added and mixed well. Pipette 1 mL of sample into a headspace vial, add 1 μL of internal standard solution (o-dichlorobenzene, 221 μg / mL), immediately seal with a cap with a silicone rubber gasket, and incubate at 50 °C with oscillation for 30 min. Extract using a DVB / CAR / PDMS composite extraction head at 50 °C for 30 min, then elute at 250 °C for 5 min and inject. Chromatographic conditions: DB HeavyWAX capillary column (30 m × 0.25 mm × 0.25 μm); column temperature program: initial temperature 40 °C, hold for 3 min, increase to 200 °C at 5 °C / min, then increase to 250 °C at 10 °C / min and hold for 3 min; carrier gas: helium, flow rate 1.66 mL / min; injection temperature 250 °C, splitless injection. Mass spectrometry conditions: EI ion source, ion source temperature 230 ℃, quadrupole temperature 150 ℃, transfer line temperature 250 ℃, full scan mode (m / z 40–500). Qualitative and quantitative analysis: Aroma components were acquired in full scan mode and qualitative analysis was performed by searching the NIST 17 standard library using retention time and mass spectra. Quantitative analysis was performed using the internal standard method, calculating the concentration of volatile substances based on the peak area ratio. The sample density was approximated as 1 g / mL, with 1 g of sample considered as 1 mL. The concentration (μg / L) was calculated as: (target peak area / internal standard peak area) × (internal standard concentration (μg / mL) × internal standard volume (mL) / sample volume (mL)) × 1000 (mL / L). The results are shown in Table 10.
[0132]
[0133] Thirty-nine flavor compounds were detected in *Saccharomyces cerevisiae* AMCC 32248 on POS medium and 31 on YPD medium. As shown in Table 10, the flavor results indicate that in POS medium supplemented with 10% cellobiose (100 g cellobiose per L of POS medium), the strain efficiently releases bound flavor precursors through β-glucosidase hydrolysis of glycosidic bonds. The concentration of acids was 3003.8 μg / L, approximately 200-fold higher than in YPD medium; the concentration of esters was 792.9 μg / L, an increase of 82.4%; the concentration of aldehydes was 96.2 μg / L, an increase of 68.8%; and the concentration of alcohols was 6132.4 μg / L, an increase of 13.2%. This demonstrates a significant increase in acids, a synergistic enhancement of esters and aldehydes, and stable accumulation of alcohols, fully unlocking the flavor synthesis potential of the strain.
[0134] The contribution of various substances to the overall flavor can be rapidly quantified and compared using Odor Activity Value (OAV), thereby accurately identifying key flavor compounds. OAV is the ratio of a compound's concentration to its olfactory threshold. An OAV > 1 indicates that the compound makes a significant contribution to the aroma value (thresholds are derived from the 2nd edition of "Compilation of Compound Olfactory Thresholds"; flavor compound descriptions are from https: / / www.flavornet.org / flavornet.html). The calculation formula is shown in Formula 1 below, and the calculation results are shown in Table 11 below.
[0135]
[0136]
[0137] According to OAV value analysis, isovaleric acid is the most significant contributor among acids, with a concentration of 2777 ug / L. Compared to the YPD system, it has become a newly added characteristic acid, presenting a sweet fruity aroma and cheese flavor. Among esters, gamma-decalactone has a concentration of 744.7 ug / L in the POS system, with an OAV value of 286.42, which is 5 times higher than that in the YPD system. It has become the key component that dominates the fruity aroma and contributes peach flavor. The OAV value of isoamyl acetate has also increased by 2.4 times, contributing banana, pear and other flavors, further enhancing the layering of ester fruity aroma flavors. Among aldehydes, octanal, 10-undecenal, (Z)-4-decenal, and phenylacetaldehyde were not detected in the YPD system, but their OAV values were all greater than 1 in the POS system. They collectively constructed a complex floral and fruity flavor network of citrus-coconut-hyacinth, becoming newly added characteristic aldehydes. Among alcohols, isoamyl alcohol and phenethyl alcohol maintained stable concentrations in the POS system, with OAV values of 1.18 and 12.27, respectively, continuously contributing to the floral and fruity flavor. The concentration of perillol in the POS system reached 32.7 μg / L, which was 4.7 times higher than that in the YPD system, exceeding its threshold and exhibiting a citrus-amber aroma effect for the first time, becoming a newly added characteristic alcohol in the fermentation system.
[0138] In summary, *Diplostomum tumefaciens* significantly promotes the hydrolysis of glycosides and the release of flavor compounds, and drives the generation of specific acids, esters, aldehydes, and alcohols. This overcomes the bottlenecks in traditional fermentation systems, such as limited carbon source utilization, low glycoside hydrolysis efficiency, and insufficient flavor compound release. It provides key technical support for improving the complexity and characteristic recognition of fermentation products and can be widely applied in food, brewing, and feed industries.
[0139] The above embodiments are only for further explanation and understanding of the technical solution of the present invention, and are not intended to limit the present invention. Any improvements made by those skilled in the art on this basis that do not highlight substantive features or make significant progress should fall within the protection scope of the present invention.
Claims
1. A type of *Saccharomyces cerevisiae*, characterized in that, The *Saccharomyces cladosporium* species is: *Saccharomyces cladosporium* (… Saccharomycopsis fibuligera AMCC 32248, accession number CCTCC NO: M 20251908.
2. The *Saccharomyces cerevisiae* according to claim 1, characterized in that, The ITS sequence of the *Saccharomyces cladosporium* is shown in SEQ ID NO.
3.
3. The *Saccharomyces cerevisiae* according to claim 1, characterized in that, The *Saccharomyces cuspidatum* carries BGL1 Genes, the ones mentioned BGL1 The gene sequence is shown in SEQ ID NO.6, wherein, the BGL1 The gene is the β-glucosidase synthesis gene.
4. The *Saccharomyces cerevisiae* according to any one of claims 1-3, characterized in that, It has enzyme-producing properties, wherein the enzyme is selected from one or more of the group consisting of amylase, protease, esterase and β-glucosidase.
5. The *Saccharomyces cerevisiae* according to claim 4, characterized in that, The β-glucosidase activity is 249.2 ± 8.7 U / L, where U / L represents the amount of enzyme released per minute by each L of *Streptomyces hygroscopicus* suspension at pH 5.0 and temperature 40°C, which is 1 µmol pNP.
6. The *Saccharomyces cerevisiae* according to claim 5, characterized in that, The β-glucosidase is a broad-spectrum β-D-glucosidase with enzyme classification number EC3.2.1.
21.
7. The *Saccharomyces cerevisiae* according to any one of claims 1-3, characterized in that, It has the ability to specifically hydrolyze carbon sources containing β-glucosidic bonds.
8. The *Saccharomyces cerevisiae* according to claim 7, characterized in that, The carbon source containing β-glucosidic bonds includes cellobiose.
9. The *Saccharomyces cerevisiae* according to claim 7, characterized in that, It also has the ability to utilize other carbon sources, including glucose, sucrose, xylose, melibiose, maltodextrose, inulin, stachyose, trehalose, maltose, or fructose.
10. The *Saccharomyces cerevisiae* according to claim 8, characterized in that, The volatile substances produced by the fermentation of *Streptomyces hygroscopicus* in a culture medium containing a β-glucosidic carbon source include alcohols and aldehydes, wherein each L of the culture medium containing a β-glucosidic carbon source contains 90-110 g of cellobiose.
11. The *Saccharomyces cerevisiae* according to claim 10, characterized in that, The aldehydes include n-octanal, 10-undecenal, and phenylacetaldehyde, and / or the alcohols include perillyl alcohol.
12. The *Saccharomyces cerevisiae* according to claim 11, characterized in that, The aroma activity value of the n-octanal is 1.08-2.00, and / or the aroma activity value of the 10-undecenal is 10.31-15.00, and / or the aroma activity value of the phenylacetaldehyde is 7.24-10.00, and / or the aroma activity value of the perillol is 1.09-1.
60.
13. The *Saccharomyces cerevisiae* according to claim 10, characterized in that, The aldehydes also include (Z)-4-decenal, and / or the alcohols also include isoamyl alcohol and phenylethanol.
14. The *Saccharomyces cerevisiae* according to claim 13, characterized in that, in, The aroma activity value of (Z)-4-decenal is 1.01-1.50, and / or the aroma activity value of isoamyl alcohol is 1.18-2.00, and / or the aroma activity value of phenylethyl alcohol is 12.27-12.
50.
15. The *Saccharomyces cerevisiae* according to claim 10, characterized in that, The volatile flavor compounds also include esters and acids.
16. The *Saccharomyces cerevisiae* according to claim 15, characterized in that, The esters include isoamyl acetate and propyldecyl lactone, and / or the acids include isovaleric acid.
17. The *Saccharomyces cerevisiae* according to claim 16, characterized in that, The aroma activity value of the isoamyl acetate is 195.47-230.00, and / or the aroma activity value of the propyldecyl lactone is 286.42-300.00, and / or the aroma activity value of the isovaleric acid is 2.31-2.
35.
18. The use of *Saccharomyces cerevisiae* as described in any one of claims 1-17 in food or feed.