Hippophae rhamnoides-derived probiotics and application thereof in improving intestinal health

By using Lactobacillus rhamnosus JBS-001 and its composition, the problem of insufficient efficacy of existing Bifidobacteria in the TNBS colitis model was solved, achieving multi-dimensional improvement of intestinal health and comprehensive intervention for inflammatory bowel disease.

CN121495801AInactive Publication Date: 2026-02-10THANKCOME BIOLOGICAL SCI & TECH CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610016162.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-07
Publication Date
2026-02-10
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

Existing Bifidobacterium strains are not effective enough in improving gut health in TNBS colitis models, and are unable to achieve deep mucosal histological repair, systemic inflammatory balance and intestinal barrier integrity, thus failing to meet the clinical need for multi-target intervention for inflammatory bowel disease.

Method used

Using a specific strain of Lactobacillus rhamnosus JBS-001 and its fermentation broth, fermentation broth supernatant, fermentation broth precipitate, lyophilized powder and bacterial suspension, this study comprehensively intervenes in TNBS-induced colitis by regulating intestinal flora, enhancing intestinal epithelial barrier function, and balancing host immune response.

Benefits of technology

It significantly improves intestinal function, inhibits weight loss, increases food intake, reduces inflammatory cells, repairs colon tissue structure, enhances intestinal barrier integrity, regulates inflammatory imbalance, reduces visceral sensitivity, and achieves multi-dimensional intervention effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121495801A_ABST
    Figure CN121495801A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to sea-buckthorn-source probiotics and application thereof in improving intestinal health. In order to solve the problems that in the prior art, a functional microbial strain capable of efficiently intervening TNBS induced colitis in a multi-dimensional mode is lacked, and the improvement effect of existing related microorganisms on key pathological links such as intestinal mucosa repair, inflammation balance adjustment and intestinal barrier recovery is limited, the invention provides the lactobacillus rhamnosus JBS-001 (the preservation number is GDMCC 67127). TNBS model verification shows that the strain can provide high-quality strain resources for development of targeted intestinal inflammatory injury intervention products from multi-dimensional effects of sign improvement, tissue repair, inflammation regulation, barrier protection and sensitivity improvement, and has important application value.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microbial technology, and particularly relates to a sea buckthorn-derived probiotic and its application in improving intestinal health. BACKGROUND

[0002] Inflammatory Bowel Disease (IBD), such as Crohn's disease and ulcerative colitis, is a chronic intestinal inflammatory disease with complex causes and prolonged and unhealed course. Its main pathological features include persistent destruction of intestinal mucosal barrier, imbalance of pro-inflammatory and anti-inflammatory factor network, damage of intestinal epithelial tight junction structure and function, and often accompanied by intestinal flora imbalance and visceral hypersensitivity and other systemic abnormalities, which seriously affects the life quality and health status of millions of patients worldwide. Currently, the clinical treatment strategy of IBD mainly relies on aminosalicylic acid preparations, glucocorticoids, immunosuppressants and biological agents. Although these drugs can control inflammation to some extent, they often focus on single pathological link such as immunosuppression or anti-inflammatory, and long-term use is easy to cause drug resistance, metabolic disorders and secondary infection and other adverse reactions, and has limited effect on the repair and reconstruction of intestinal mucosal barrier. Therefore, exploring alternative or auxiliary treatment options that can intervene in intestinal inflammation in a multi-target and systemic manner with less side effects has become an important direction in the field of intestinal disease research.

[0003] In the process of basic research and drug development, it is a key prerequisite to establish a stable and reliable animal model to evaluate the effectiveness of potential interventions. The method of enema induction with 2,4,6-trinitrobenzenesulfonic acid (TNBS) ethanol solution is one of the internationally recognized classic methods for constructing experimental colitis animal models. Its mechanism is that ethanol, as a mucosal damaging agent, first destroys the physical barrier of the colonic epithelium, allowing the haptenic substance TNBS to penetrate the mucosal layer and bind to tissue proteins, thereby triggering a delayed-type hypersensitivity reaction in the body, ultimately leading to acute and chronic intestinal inflammation dominated by Th1-type immune response. This model can stably simulate many core pathological features of human IBD, including but not limited to: significant inflammatory cell infiltration, mucosal and submucosal edema, crypt structure destruction, and a large number of reduced and disordered arranged goblet cells; in terms of clinical manifestations, model animals exhibit a series of typical symptoms such as sustained weight loss, significantly reduced food intake and activity, abnormal stool consistency, and increased disease activity index. The high repeatability of the TNBS model and its similarity to the pathophysiology of human IBD make it an ideal in vivo experimental platform for screening and evaluating probiotic strains with anti-inflammatory, repair, and immune regulation functions.

[0004] In recent years, with the rapid development of microecology, probiotics have been recognized as an important strategy for adjuvant intervention in colitis due to their multifaceted beneficial potential in regulating gut microbiota structure, enhancing intestinal epithelial barrier function, balancing host immune responses, and inhibiting pathogen colonization. Bifidobacteria, as a dominant probiotic genus in the human gut, has many strains reported to have positive effects on improving gut health. However, most existing commercial or research-grade Bifidobacteria strains, in a rigorous TNBS colitis model evaluation system, often exhibit limited effects, such as only slightly regulating some microbiota composition or single inflammatory factor levels. Their efficacy in achieving deep mucosal histological repair, systemic inflammatory balance, strengthening intestinal barrier integrity, and improving visceral hypersensitivity remains insufficient, failing to fully meet the urgent clinical need for efficient, multi-target intervention in IBD.

[0005] In conclusion, the screening and development of a new high-quality probiotic strain from specific bacterial resources, which has been fully verified in vivo and can specifically and multidimensionally improve key pathological aspects of colitis, has important theoretical significance and broad application prospects for enriching the microecological intervention methods for inflammatory bowel disease and improving the intervention effect and specificity. Summary of the Invention

[0006] To address the aforementioned shortcomings, this invention provides a specific strain of Lactobacillus rhamnosus, which has been rigorously demonstrated through in vivo animal experiments to comprehensively intervene in TNBS-induced colitis from multiple key dimensions, including improvement of physical signs, tissue repair, inflammation regulation, barrier protection, and sensitivity improvement.

[0007] The technical solution of this invention is as follows: On the one hand, the present invention provides a strain of Lactobacillus rhamnosus JBS-001, which was isolated from natural sea buckthorn fruit in Inner Mongolia. The preservation number of Lactobacillus rhamnosus JBS-001 is GDMCC 67127.

[0008] In another aspect, the present invention provides a composition comprising the aforementioned Lactobacillus rhamnosus JBS-001.

[0009] Specifically, the Lactobacillus rhamnosus JBS-001 is its fermentation broth, fermentation broth supernatant, fermentation broth precipitate, lyophilized powder and / or bacterial suspension.

[0010] More specifically, the fermentation broth refers to the liquid in which the microbial strain is inoculated into a culture medium and cultured for a period of time.

[0011] More specifically, the supernatant of the fermentation broth refers to the clear liquid at the top after centrifugation of the fermentation broth; it contains abundant metabolic products from the bacterial growth and reproduction process, as well as some bacterial cell fragments. The acidic substances and bacteriocins secreted by the bacteria have antagonistic and killing effects on harmful bacteria. The amino acids and vitamins synthesized by the bacteria after decomposing food are also in the culture medium, as well as enzymes secreted by the bacteria that are useful to the human body. Some of the bacterial cell components also have an immune-boosting effect on the human body.

[0012] More specifically, the fermentation broth sediment refers to the liquid sediment obtained after centrifugation, which includes free protein, residual bacterial cells, broken cells, and culture medium residue, mainly protein and intracellular matrix.

[0013] More specifically, the lyophilized powder is obtained by freeze-drying culture medium; the lyophilized powder generally also includes a lyophilization protectant. The lyophilization protectant includes, but is not limited to: pH buffers, fillers, sugars, nonionic surfactants, ligands, etc. The pH buffers include, but are not limited to, any one or more of Tris, amino acids or their salts, citric acid or its salts, acetic acid or its salts. The fillers include, but are not limited to, any one or more of mannitol, glycine, and bovine serum albumin. The sugars can be disaccharides, such as sucrose or trehalose, any one or more. The nonionic surfactants include, but are not limited to, Tween, and Tween can be selected from Tween-20, Tween-60, Tween-80, etc. The lyophilization protectant may also include antioxidants, etc. Specifically, the lyophilization protectant may also include albumin, polyethylene glycol, etc.

[0014] More specifically, the bacterial suspension is a homogeneous suspension formed by discarding the supernatant after centrifuging the culture medium, adding water, culture medium or buffer solution, and suspending the lower layer of bacteria by shaking or blowing.

[0015] Specifically, the composition further includes an acceptable carrier.

[0016] More specifically, the acceptable carriers include, but are not limited to, one or more of the following: prebiotics, freeze-drying protectants, or excipients.

[0017] Preferably, the prebiotics include, but are not limited to, at least one of: fructooligosaccharides, galactooligosaccharides, inulin, resistant dextrin, and lactulose.

[0018] Preferably, the freeze-drying protectant includes, but is not limited to, at least one of: trehalose, skim milk powder, glycerin, sucrose, and maltodextrin.

[0019] Preferably, the excipient includes, but is not limited to, at least one of: diluent, binder, lubricant or flavoring agent.

[0020] More preferably, the diluent includes, but is not limited to, at least one of: starch, pregelatinized starch, microcrystalline cellulose, and mannitol; The adhesive includes, but is not limited to, at least one of: hydroxypropyl methylcellulose and polyvinylpyrrolidone; The lubricant includes, but is not limited to, at least one of magnesium stearate and micronized silica gel. The flavoring agents include, but are not limited to, at least one of the following: fruit flavoring and yogurt flavoring.

[0021] In another aspect, the present invention provides the use of the aforementioned Lactobacillus rhamnosus JBS-001 or its composition in the preparation of products for the prevention and / or treatment of inflammatory bowel disease.

[0022] Specifically, the product may be a drug.

[0023] Specifically, the inflammatory bowel disease can be colitis.

[0024] Specifically, the dosage form of the drug is powder, granules, capsules, tablets, or oral liquid.

[0025] Specifically, the bacterial count of *Lactobacillus rhamnosus* JBS-001 in the drug can be 1 × 10⁻⁶. 6 CFU / g-1×10 12 CFU / g.

[0026] The beneficial effects of this invention are as follows: (1) The strain provided by the present invention can regulate intestinal function, inhibit weight loss, increase food intake to near normal levels, increase fecal water content, improve defecation characteristics, and reverse the negative effects of TNBS on animal physiological state as a whole.

[0027] (2) The strains provided by this invention can reduce the number of inflammatory cells, alleviate mucosal edema, promote the orderly arrangement of goblet cells, repair the hierarchical structure of colonic tissue, and protect the physical barrier of the intestine.

[0028] (3) The strain provided by the present invention corrects the inflammatory imbalance and reduces the stimulation of the intestinal mucosa by inflammation through a dual mechanism of downregulating pro-inflammatory factors and upregulating anti-inflammatory factors, thereby blocking the vicious cycle of "inflammation-damage".

[0029] (4) The strains provided by this invention can increase the level of tight junction proteins, enhance the integrity and permeability regulation of the intestinal epithelial barrier, reduce the transport of harmful substances, and consolidate the homeostasis of the intestinal microecology.

[0030] (5) The strains provided by this invention can regulate the levels of key substances related to visceral sensitivity, inhibit abnormal signaling pathways, reduce the excessive response of viscera to stimuli, and improve the comprehensiveness of intervention.

[0031] Preservation instructions: Biomaterials: Lacticaseibacillus rhamnosus JBS-001; Category Naming: Lacticaseibacillus rhamnosus ; Accession number: GDMCC No: 67127; Preservation period: October 17, 2025; Preservation institution: Guangdong Provincial Center for Microbial Culture Collection; Abbreviation of depositary institution: GDMCC; Address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. Attached Figure Description

[0032] Figure 1 Changes in mouse body weight and food intake: (A) Body weight of female mice; (B) Body weight of male mice.

[0033] Figure 2 Changes in fecal water content in mice: (A) Fecal water content of female mice; (B) Fecal water content of male mice.

[0034] Figure 3 Staining of mouse colon tissue sections (A) Female mouse colon tissue (B) Male mouse colon tissue.

[0035] Figure 4 To measure the levels of inflammatory factors in mice (female: IL-10).

[0036] Figure 5 To measure the levels of inflammatory factors in mice (male: IL-10).

[0037] Figure 6 To measure the levels of inflammatory factors in mice (female: IL-1β).

[0038] Figure 7 To measure the levels of inflammatory factors in mice (male: IL-1β).

[0039] Figure 8 To measure the levels of inflammatory factors in mice (female: TNF-α).

[0040] Figure 9 To measure the levels of inflammatory factors in mice (male: TNF-α).

[0041] Figure 10 To measure the levels of inflammatory factors in mice (female: IL-6).

[0042] Figure 11 To measure the levels of inflammatory factors in mice (male: IL-6).

[0043] Figure 12To measure the levels of inflammatory factors in mice (female: OCC).

[0044] Figure 13 For the determination of inflammatory factor levels in mice (male: OCC).

[0045] Figure 14 To measure the levels of inflammatory factors in mice (female: PAR-2).

[0046] Figure 15 To measure the levels of inflammatory factors in mice (male: PAR-2).

[0047] Figure 16 To measure the levels of inflammatory factors in mice (female: CORT).

[0048] Figure 17 For the determination of inflammatory factor levels in mice (male: CORT).

[0049] Figure 18 To measure the levels of inflammatory factors in mice (female: MCT).

[0050] Figure 19 For the determination of inflammatory factor levels in mice (male: MCT).

[0051] Figure 20 To determine gene expression levels in the colon of mice (female: PAR-2).

[0052] Figure 21 To determine gene expression levels in the colon of mice (male: PAR-2).

[0053] Figure 22 To determine gene expression levels in the colon of mice (female: OCC).

[0054] Figure 23 To determine gene expression levels in the colon of mice (male: OCC). Detailed Implementation

[0055] The present invention will be further clearly and completely illustrated below through embodiments. These embodiments are only some examples of the present invention and are not intended to limit the present invention, but are only for illustrating the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are all conventional experiments, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0056] Example 1 1.1 Materials and Reagents Table 1 Experimental Materials and Reagents

[0057] 2. Instruments and Equipment Table 2 Instruments and Equipment

[0058] 1.3 Experimental methods 1.3.1 Animal models After 25 male (20±2g) and female (17±2g) 5-week-old C57BL / 6J mice (Hunan Slack Jingda Experimental Animal Co., Ltd., SCXK(Xiang)2021-0002) were adaptively fed for 6 days, they were randomly divided into 5 groups according to gender: normal group, model group, positive group, JBS-001 high-dose group (JBS-001-H), and JBS-001 low-dose group (JBS-001-L), with 5 male and female mice in each group. From 1 to 7 days after the experiment started, except for the normal group (given normal saline as a control), the other groups were fasted for 12 h every day, and then 0.1 mL of TNBS enema solution (prepared by mixing 0.1 mL of trinitrobenzenesulfonic acid with 38.5 mL of 30% ethanol) was used for enema (insert a polyethylene catheter through the anus to 3-4 cm, keep the enema tube in place for 1 minute and then remove it, invert the mouse for 30 seconds to prevent liquid leakage. At the same time, select polyethylene catheters of the same specification and mark them to ensure the same insertion depth each time) to establish the model. The JBS-001-H group and the JBS-001-L group were respectively gavaged with 0.2 mL of bacterial solution (1×10 9 CFU / kg, 1×10 7 CFU / kg) once a day; after the model establishment was completed, the positive group was gavaged with the drug linaclotide (100 μg / g) once a day. The experimental period was 29 days. The body weight of the mice was recorded every other day, and the feces were collected every three days for determination of water content.

[0059] 1.3.2 Determination of cytokine levels in mouse serum and colon After the experimental period ended, whole blood was collected by orbital blood collection. The blood was allowed to stand at 4 °C for half an hour and then centrifuged (4 °C, 14000 r / min, 15 min). After centrifugation, the upper-layer serum was collected into a centrifuge tube and stored in a -80 °C refrigerator. The colon tissue of the mouse was weighed and homogenized with sterile normal saline. After homogenization, the supernatant was collected by centrifugation for later use. According to the kit instructions, ELISA reagents were used to determine the content of corticosterone (CORT) in the serum and the levels of interleukin (IL-1β, IL-6, IL-10), tumor necrosis factor (TNF-α), tight junction protein (occludin, OCC), protease-activated receptor 2 (PAR-2), and mast cell tryptase (MCT) in the colon.

[0060] 1.3.3 Staining sections of colon tissue Approximately 1 cm of the proximal colon of mice was removed by laparotomy. The colon was cleaned of any remaining contents with pre-cooled physiological saline at 4°C and cut along the longitudinal axis. The colon was then fixed in 4% polymethanol solution for 48 hours, followed by dehydration, embedding, sectioning, HE staining, and finally observation under a microscope. Images were collected and analyzed.

[0061] 1.3.4 Determination of mRNA in mouse intestinal tissue 50 mg of mouse colon tissue was weighed, washed with sterile saline, and placed into a homogenization tube. Trizol was added to homogenize and extract RNA from the mouse colon tissue. The concentration and purity of the RNA extract were then measured using a spectrophotometer. The RNA extract was reverse transcribed into cDNA according to the reverse transcription kit instructions. After reverse transcription, a cDNA reaction system was prepared in an eight-tube bundle: 10 μL Mastermix, 0.4 μL each of upstream and downstream primers (primer sequences...). Par-2: F: TCTGTCATCTGGTTCCCCCT (SEQ ID NO: 1); R: CGATCACCCAGTACCTCTGC (SEQ ID NO: 2); Occluidn: F: TTGGCTACGGAGGTGGCTATGG (SEQ ID NO: 3); R: CCTTTGGCTGCTCTTGGGTCTG (SEQ ID NO: 4)), 1 μL of template cDNA, and 8.2 μL of sterile, enzyme-free water. After preparation, the reaction system was placed on a real-time quantitative PCR instrument for amplification and detection.

[0062] Table 3 Amplification conditions

[0063] 1.3.5 Data Processing This experiment used statistical software for analysis, and the results are expressed as mean ± standard deviation (x ± S). One-way ANOVA was used for inter-group comparisons. The same lowercase letters a and e indicate no significant difference between the two groups, while different lowercase letters indicate a significant difference between the two groups (P < 0.05).

[0064] 1.4 Results and Analysis 1.4.1 Results of mouse body weight changes Depend on Figure 1It was found that, compared with the normal group, the weight and food intake of mice modeled with TNBS were significantly reduced. During the drug administration period, the weight of mice in the positive group gradually increased after drug treatment, and the growth rate was relatively fast. Compared with the model group, the JBS-001-H group and JBS-001-L group showed a significant increase in weight gain rate after intervention with Lactobacillus rhamnosus JBS-001. This indicates that irritable bowel syndrome can lead to decreased food intake, reduced digestive capacity, and impaired digestion and absorption in animals; and that administration of Lactobacillus rhamnosus JBS-001 can improve these symptoms.

[0065] 1.4.2 Changes in water content of mouse feces Fecal samples collected revealed that the feces of the normal group mice were normal, while the feces of the mice that underwent fecal modeling were dry, hard, and constipated. Figure 2 It can be seen that, except for the normal group, the fecal water content of mice in other groups decreased, and the fecal water content increased after the intervention of drugs and JBS-001.

[0066] 1.4.3 Histopathological observation of mouse colon tissue like Figure 3 As shown in the HE pathological examination of colon tissue, the colonic mucosa, submucosa, and muscularis propria of the normal group animals were intact with clear texture, and the mucosal epithelial cells showed no inflammatory reaction or damage, with goblet cells arranged neatly. In the colon of the mice after modeling, inflammatory cell infiltration was observed, the submucosa was loose and somewhat edematous, and the goblet cells were loosely arranged. Compared with the model group, the positive group and the JBS-001 group showed reduced colonic damage and decreased inflammatory infiltration, indicating that treatment with JBS-001 can alleviate colonic damage caused by IBD to some extent.

[0067] 1.4.4 Measurement of inflammatory factor levels like Figures 4-11 As shown, compared with the normal group, the level of IL-10 in the model group was significantly decreased, while the levels of IL-1β and TNF-α were significantly increased (P < 0.05), indicating that TNBS-induced irritable bowel syndrome can inhibit the level of IL-10 in mouse serum and increase the levels of IL-1β and TNF-α. Compared with the model group, the level of IL-10 was increased in the high and low concentration groups of JBS-001 and the positive group (P < 0.05), while the levels of IL-1β and TNF-α decreased after intervention with JBS-001 and other drugs (P < 0.05). No significant trend was observed in the IL-6 level in this study, and it was not statistically significant (P > 0.05). The results indicate that *Lactobacillus rhamnosus* JBS-001 can reduce the concentrations of IL-1β and TNF-α in mouse serum and increase the level of IL-10.

[0068] 1.4.5 Determination of trypsin-like enzymes, PAR-2, ocludin, and serum corticosterone levels in mouse colonic mast cells like Figures 12-19 As shown, compared with the normal group, the levels of colonic mast cell trypsin, PAR-2, and serum corticosterone in the model group mice were increased, while the OCC level was decreased (P < 0.05). After treatment with JBS-001, the levels of colonic mast cell trypsin, PAR-2, and serum corticosterone decreased, while the OCC level increased (P < 0.05), indicating that JBS-001 has the effect of improving visceral allergic symptoms and alleviating intestinal barrier damage in mice.

[0069] 1.4.6 Determination of PAR-2 ​​and Occludin expression levels in mouse colon like Figures 20-23 As shown, analysis of OCC and PAR-2 ​​expression levels in the mouse colon revealed that, compared to the normal group, OCC expression was significantly decreased and PAR-2 ​​expression was significantly increased in the model group (P < 0.05). Compared to the model group, occludin expression was increased and PAR-2 ​​expression was decreased in the positive group and the JBS-001 group (P < 0.05).

[0070] 1.5 Conclusion In this invention, it was observed that the condition of the model group mice differed significantly from that of the normal group mice. The model group mice exhibited a manic state in the early stages of modeling, transitioning to a sluggish state in the later stages, accompanied by weight loss, reduced food intake, and decreased fecal water content. After intervention with the drug and JBS-001, the overall physical characteristics of the animals improved significantly; their activity level increased, food intake increased markedly, and their weight increased, while fecal water content also rose. This indicates that *Lactobacillus rhamnosus* JBS-001 can improve the condition of mice with irritable bowel syndrome and has a certain therapeutic effect.

[0071] In the colon of IBD model mice, abundant inflammatory cell infiltration was observed, with loosely arranged goblet cells and weak intercellular junctions. After JBS-001 intervention, inflammatory infiltration in the colon tissue of mice was reduced, intercellular junctions were strengthened, and goblet cells were arranged more neatly. This indicates that Lactobacillus rhamnosus JBS-001 can effectively alleviate colonic damage in irritable bowel syndrome mice, reduce inflammatory infiltration, protect the structural integrity of colonic tissue, and thus restore intestinal function.

[0072] In mice, TNBS enema induces autoimmune dysregulation, with significantly increased levels of TNF-α and IL-1β and significantly decreased levels of IL-10 in the colon. This indicates that intestinal immune homeostasis is affected, and the mice exhibit intestinal inflammation. However, treatment with *Lactobacillus rhamnosus* JBS-001 significantly reduces the expression of TNF-α and IL-1β in the colon and significantly increases IL-10 levels. This suggests that *Lactobacillus rhamnosus* JBS-001 can alleviate low-grade intestinal inflammation symptoms in mice with IBD.

[0073] In this invention, the expression level of OCC in the colon of mice was determined by PCR. The results showed that, compared with the normal group, the OCC expression in the model group was significantly decreased. After oral administration of Lactobacillus rhamnosus JBS-001, the OCC level increased, demonstrating that Lactobacillus rhamnosus JBS-001 can restore the intestinal barrier function damage caused by intestinal inflammation.

[0074] In this invention, it was found that compared with the normal group, the levels of PAR-2, MCT and CORT in the model group mice were significantly increased. After treatment with JBS-001, the levels of PAR-2, MCT and CORT in the JBS-001 group were significantly decreased. This suggests that Lactobacillus rhamnosus JBS-001 may have the effect of improving visceral allergic symptoms in mice.

[0075] In summary, JBS-001 can mitigate the weight loss trend in IBD model mice, increase fecal water content, alleviate colonic tissue damage, downregulate IL-1β, TNF-α, colonic mast cell trypsin, PAR-2, and serum corticosterone levels, and increase IL-10 and OCC levels. Therefore, *Lactobacillus rhamnosus* JBS-001 has a certain positive regulatory effect on intestinal function in IBD model mice.

[0076] The above detailed description is a specific illustration of one feasible embodiment of the present invention, and this embodiment is not intended to limit the patent scope of the present invention. It should be noted that all equivalent implementations or modifications made without departing from the present invention should be included within the scope of the technical solution of the present invention. Therefore, the protection scope of the present invention should be determined by the appended claims.

Claims

1. A strain of Lactobacillus rhamnosus ( Lacticaseibacillus rhamnosus JBS-001, characterized in that, The accession number of the Lactobacillus rhamnosus JBS-001 is GDMCC 67127.

2. A composition, characterized in that, It contains Lactobacillus rhamnosus JBS-001 as described in claim 1.

3. The composition according to claim 2, characterized in that, The Lactobacillus rhamnosus JBS-001 is its fermentation broth, fermentation broth supernatant, fermentation broth precipitate, lyophilized powder and / or bacterial suspension.

4. The composition according to claim 2, characterized in that, The composition also includes an acceptable carrier.

5. The composition according to claim 4, characterized in that, The acceptable carriers include one or more of prebiotics, freeze-drying protectants, or excipients.

6. The use of the Lactobacillus rhamnosus JBS-001 of claim 1 or the composition of any one of claims 2-5 in the preparation of products for the prevention and / or treatment of inflammatory bowel disease.

7. The application according to claim 6, characterized in that, The product is a medicine.

8. The application according to claim 6, characterized in that, The inflammatory bowel disease mentioned is colitis.

9. The application according to claim 7, characterized in that, The dosage form of the drug is powder, granules, capsules, tablets, or oral liquid.

10. The application according to claim 7, characterized in that, The number of Lactobacillus rhamnosus JBS-001 bacteria in the drug is 1×10⁻⁶. 6 CFU / g-1×10 12 CFU / g.