CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated 9) technology-based myocardial cell construction of propionemia stem cell differentiation

Abstract

The invention discloses construction of myocardial cells differentiated from propionemia stem cells based on a CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated 9) technology. The model constructed by the invention has the metabolic phenotype of propionemia and can also be differentiated into myocardial cells. A reliable and effective experimental model is provided for research of propionemia disease related targets and screening of drugs for preventing / treating propionemia, and the method has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to the construction of cardiomyocytes differentiated from propionic acid stem cells based on CRISPR-Cas9 technology. Background Technology

[0002] Propionic acidemia is an autosomal recessive genetic disorder with a low incidence but high neonatal mortality and disability rates. Clinical manifestations affect multiple organ systems, such as the nervous, cardiovascular, hematopoietic, and urinary systems, and may include cerebral edema, epilepsy, respiratory failure, and heart failure. It has poor specificity. Obtaining human specimens is difficult, making it impossible to conduct studies targeting multiple organ systems. Currently used animal models of propionic acidemia are not effective and cannot fully simulate human propionic acidemia.

[0003] Therefore, providing a model that simulates human propionic acidemia is crucial for the research of the disease and the development of treatment options. Summary of the Invention

[0004] To overcome the shortcomings of existing technologies, this invention provides a method for constructing cardiomyocytes differentiated from propionic acid stem cells based on CRISPR-Cas9 technology.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: A first aspect of the present invention provides an sgRNA for PCCA gene editing, the sequence of which is shown in SEQ ID NO:2.

[0006] Furthermore, the sgRNA also includes biological materials associated with the sgRNA.

[0007] Furthermore, the biomaterial is selected from any of the following: (1) The nucleic acid molecule encoding the sgRNA; (2) A carrier containing the nucleic acid molecule described in (1).

[0008] A second aspect of the present invention provides a system for PCCA gene editing, the system comprising the sgRNA described in the first aspect of the present invention.

[0009] A third aspect of the present invention provides a method for constructing a propionic acidemia model, the method comprising mutating glycine at position 668 of the PCCA gene to arginine.

[0010] Furthermore, CRISPR-Cas9 gene editing technology was used to mutate glycine at position 668 of the PCCA gene to arginine.

[0011] Furthermore, the sgRNA used in the CRISPR-Cas9 gene editing technology is the sgRNA described in the first aspect of this invention.

[0012] Furthermore, the models include cell models and animal models.

[0013] Furthermore, the model is a cell model.

[0014] Furthermore, the cells are iPSC cells.

[0015] A fourth aspect of the present invention provides a propionic acidemia model, which is constructed by the method described in the third aspect of the present invention.

[0016] Furthermore, the models include cell models and animal models.

[0017] Furthermore, the model is a cell model.

[0018] The fifth aspect of the present invention provides the application of the sgRNA described in the first aspect of the present invention or the system described in the second aspect of the present invention in the construction of a propionic acidemia model.

[0019] Furthermore, the models include cell models and animal models.

[0020] The sixth aspect of the present invention provides the application of the propionic acidemia model constructed by the method described in the third aspect of the present invention or the propionic acidemia model described in the fourth aspect of the present invention in screening drugs for the prevention / treatment of propionic acidemia.

[0021] The seventh aspect of the present invention provides the application of the propionic acidemia model constructed by the method described in the third aspect of the present invention or the propionic acidemia model described in the fourth aspect of the present invention in the study of the disease mechanism / disease target of propionic acidemia.

[0022] The eighth aspect of the present invention provides a method for screening drugs for the prevention / treatment of propionic acidemia, the method comprising applying a test drug to a propionic acidemia model constructed by the method described in the third aspect of the present invention or the propionic acidemia model described in the fourth aspect of the present invention, and selecting a test drug capable of improving the symptoms of propionic acidemia.

[0023] Advantages and beneficial effects of the present invention: The model constructed in this application exhibits the metabolic phenotype of propionic acidemia and can differentiate into cardiomyocytes. It provides a reliable and effective experimental model for the study of disease-related targets in propionic acidemia and the screening of drugs for the prevention / treatment of propionic acidemia, and has broad application prospects. Attached Figure Description

[0024] Figure 1 This is a sequence diagram of the cleavage sequencing peaks of gRNA-A1 and gRNA-B1; Figure 2 This is a Synthego-HDR image of gRNA-A1; Figure 3 This is a TIDE diagram of gRNA-A1; Figure 4 This is a Synthego-HDR image of gRNA-B1; Figure 5 This is a TIDE diagram of gRNA-B1; Figure 6 This is a PCR image of a single clone, 1H10. Figure 7 This is the sequencing data of monoclonal 1H10; Figure 8 This is an immunofluorescence image of three stem marker genes: Nanog, Oct-4, and Sox2. Figure 9 This is a graph showing the effect of propionic acid on the damage rate of iPSCs; Figure 10 This is a graph of PCC enzyme activity in cells; Figure 11 It is a diagram of cardiomyocyte differentiation; Figure 12 This is a graph showing the metabolite analysis of the culture medium for iPSCs differentiated myocardium (iPSCs-CM). In the graph, 12A is the relative abundance of acetylcarnitine, 12B is the relative abundance of propionylcarnitine, and 12C is the ratio of acetylcarnitine to propionylcarnitine. Figure 13 These are cell contractility graphs, where 13A is the contractility graph of WT-iPSCs-CM, 13B is the contractility graph of Mut-iPSCs-CM, and 13C is a statistical graph of contractility. Detailed Implementation

[0025] The following provides definitions for some of the terms used in this specification. Unless otherwise stated, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0026] This invention provides an sgRNA for PCCA gene editing, the sequence of which is shown in SEQ ID NO:2.

[0027] The sgRNA also includes biological materials associated with the sgRNA.

[0028] The biomaterial is selected from any one of the following: (1) The nucleic acid molecule encoding the sgRNA; (2) A carrier containing the nucleic acid molecule described in (1).

[0029] In some implementations, nucleic acid molecules and nucleic acids are used interchangeably. Nucleic acid molecules refer to polynucleotides such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). As equivalents, the term also includes DNA or RNA analogs derived from nucleotide analogs and, where applicable, single-stranded (sense or antisense) and double-stranded polynucleotides. Isolated nucleic acid molecules refer to nucleic acid molecules that are identified and separated from / from at least one contaminating nucleic acid molecule normally associated with the natural source of that nucleic acid. Isolated nucleic acid molecules differ in form and context from when they are found in nature. Therefore, isolated nucleic acid molecules are distinct from nucleic acid molecules present in natural cells. However, isolated nucleic acid molecules include nucleic acid molecules contained in cells that normally express the encoded protein, wherein, for example, the nucleic acid molecule is located at a chromosomal location different from that of the natural cell.

[0030] In some implementations, nucleic acid molecules can be integrated into a vector, a broad term that includes any specific DNA segment designed to move from a carrier into target DNA. A vector can be called an expression vector or a vector system, which is a set of components required to induce DNA insertion into the genome or other targeted DNA sequences, such as episomes, plasmids, or even viral / phage DNA segments.

[0031] This invention provides a method for constructing a propionic acidemia model, the method comprising mutating glycine at position 668 of the PCCA gene to arginine.

[0032] The glycine at position 668 of the PCCA gene was mutated to arginine using CRISPR-Cas9 gene editing technology.

[0033] In some implementations, a mutation refers to a physical or structural change in the sequence of bases produced on a gene or chromosome.

[0034] In a specific implementation, the mutation is to change glycine at position 668 of the PCCA gene to arginine (G668R), specifically Exon 22 p.G668R (GGA to AGA).

[0035] In some implementations, CRISPR or the CRISPR system is collectively referred to as transcripts or synthetically produced transcripts and other elements that participate in the expression of or direct the activation of CRISPR-associated (Cas) genes, including sequences encoding Cas genes, tracr (trans-activating CRISPR) sequences (e.g., tracrRNA or active portion of tracrRNA), tracr pairing sequences (in the context of an endogenous CRISPR system, encompassing both direct repeats and partial direct repeats processed by tracrRNA), directing sequences (also referred to as spacer sequences, gRNA, in the context of an endogenous CRISPR system), or other sequences and transcripts derived from CRISPR loci.

[0036] In some implementations, in addition to CRISPR-Cas9 gene editing technology, CRISPR-Cas13, CRISPR-Cpf1 (Cas12a), TALEN, ZFN, base editing (BE), and leader editing (PE) technologies can also be used to mutate glycine at position 668 of the PCCA gene to arginine.

[0037] This invention provides a method for screening drugs for the prevention / treatment of propionic acidemia, the method comprising applying a test drug to a propionic acidemia model constructed by the above method or the above propionic acidemia model, and selecting a test drug that can improve the symptoms of propionic acidemia.

[0038] In some implementations, the specific methods include: (1) applying the test drug to the above propionic acidemia model; (2) detecting whether there are changes in propionic acidemia-related abnormal symptoms in the propionic acidemia model after the application of the test drug; and (3) when the test drug improves the symptoms of propionic acidemia / has a therapeutic effect, the test drug is identified as a candidate drug that can treat / prevent propionic acidemia.

[0039] In some embodiments, the test drug may be a low-molecular-weight compound, a protein (e.g., an antibody), DNA, RNA, low-molecular-weight interfering RNA, or an antisense oligonucleotide. The test drug may also be an agent used to treat diseases other than propionic acidemia. The test drug may be one or a mixture of two or more substances. Preferably, the test drug is a single substance.

[0040] In some embodiments, prevention / treatment includes both prevention and treatment, wherein prevention refers to completely or partially preventing or suppressing symptoms of the disease or the frequency of such symptoms, or reducing the risk of acquiring a given symptom of the disease. In this application, the disease is propionic acidemia. Prevention includes suppressing and / or preventing symptoms associated with propionic acidemia, reducing the severity of propionic acidemia-related symptoms, or improving signs and symptoms related to propionic acidemia. Prevention includes suppressing, preventing, or reducing the severity of propionic acidemia-related symptoms; this term includes such effects occurring before a patient begins to have propionic acidemia or a related condition, i.e., delaying the onset of propionic acidemia-related symptoms, and / or suppressing or reducing the severity of propionic acidemia-related symptoms. Treatment refers to reducing or eliminating the severity of propionic acidemia symptoms, the frequency of such symptoms, or both; this term includes such effects occurring when a patient has propionic acidemia or a related condition, i.e., reducing the severity of one or more symptoms or effects of propionic acidemia-related symptoms.

[0041] The invention is further illustrated below with reference to specific embodiments. It should be understood that the specific embodiments described herein are by way of example and are not intended to limit the invention. The main features of the invention can be used in various embodiments without departing from the scope of the invention.

[0042] Example 1 1. Experimental materials Genome sequence: AAATTTATGCTGGAAAAAGTGACTGAGGACACAAGCAGTGTTCTGCGTTCCCCGATGCCCGGAGTGGTGGTGGCCGTCTCTGTCAAGCCTGGAGACGCGGTAAGGGCTGTGTGTGTCTCTCTG (SEQ ID NO: 1) gRNA sequence: gRNA-A1: CCACCACCACTCCGGGCATC-GGG (SEQ ID NO:2) gRNA-B1: GCCACCACCACTCCGGGCAT-CGG (SEQ ID NO:3) Oligo sequence: AAATTTATGCTGGAAAAAGTGACTGAGGACACAAGCAGTGTTCTGCGTTCCCCGATGCCCAGAGTGGTGGTGGCCGTCTCTGTCAAGCCTGGAGACGCGGTAAGGGCTGTGTGTGTCTCTCTG (SEQ ID NO: 4) 2. Experimental Methods Cas9 protein and sgRNA were incubated to assemble an RNP complex, which was then introduced into cells via electroporation after the addition of oligos. Cell pools were selected based on the HDR efficiency after electroporation for single-clone preparation to construct a Human PCCA (p.G668R) point mutation Exon 22 p.G668R (GGA to AGA) project for induced pluripotent stem cells (iPSCs). Single clones were selected after electroporation, and homozygous cells with the Human PCCA (p.G668R) gene mutation were successfully obtained by PCR and Sanger sequencing verification.

[0043] Among them, the homozygous clone number is 1H10; the human PCCA gene (GenBank accession number: NM000282.4, EnsembI:ENSG00000175198) is located on human chromosome 13.

[0044] 3. Experimental Results gRNA-A1 has higher cleavage efficiency and HDR efficiency compared to gRNA-B1. Figures 1-5 The single clone 1H10 was confirmed to be homozygous by PCR and sequencing. Figure 6 , Figure 7 ).

[0045] Sequencing results Oligo sequence: AAATTTATGCTGGAAAAAGTGACTGAGGACACAAGCAGTGTTCTGCGTTCCCCGATGCCCAGAGTGGTGGTGGCCGTCTCTGTCAAGCCTGGAGACGCGGTAAGGGCTGTGTGTGTCTCTCTG (SEQ ID NO: 4) Wild type allele: AAATTTATGCTGGAAAAAGTGACTGAGGACACAAGCAGTGTTCTGCGTTCCCCGATGCCCGGAGTGGTGGTGGCCGTCTCTGTCAAGCCTGGAGACGCGGTAAGGGCTGTGTGTGTCTCTCTG (SEQ ID NO: 1) Example 2 1. Experimental materials The specific experimental materials used are shown in Table 1.

[0046] Table 1 Experimental Materials

[0047] 2. Experimental Methods (1) Cell seeding: Digest cells and seed them in 24-well plates and culture at 37°C and 5% CO2.

[0048] (2) When the cell confluence is above 80%, remove the culture medium, add 500 µL of pre-cooled paraformaldehyde fixative, and fix for 30 min.

[0049] (3) Remove the fixative and wash the cells three times with PBS for 2 min each time.

[0050] (4) Remove the PBS, add 500 µL of permeation buffer to each well, and permeate at room temperature for 30 min.

[0051] (5) Remove the permeation fluid, add 500 µL of serum blocking solution to each well, and block at room temperature for 60 min.

[0052] (6) After the blocking is completed, remove the blocking solution as much as possible, add the diluted primary antibody, shake gently, and incubate overnight at 4°C.

[0053] (7) After equilibration at room temperature for 30 min the next day, remove the liquid and wash the cells with PBS 3 times, 10 min each time.

[0054] (8) Remove the PBS, add the diluted secondary antibody, and incubate at 37°C for 1 h in the dark.

[0055] (9) After incubation, remove the secondary antibody in the dark, wash with PBS 3 times, 10 min each time.

[0056] (10) Remove the PBS, add the diluted nuclear dye, and incubate at room temperature in the dark for 10 min.

[0057] (11) Remove the staining solution, wash once with PBS, 10 min, and then remove the PBS.

[0058] (12) Add 1 mL of PBS and examine with a fluorescence microscope.

[0059] 3. Experimental Results Immunofluorescence staining was performed to detect three stem cell marker genes: Nanog, Oct-4, and Sox2. Positive signals were detected in all three, indicating that the cell line had not lost its stemness. Figure 8 ).

[0060] Example 3 1. Experimental materials Wild-type (WT) and mutant (Mut) iPSC cells (DYR0100, Cell Bank / Stem Cell Bank, Chinese Academy of Sciences), CCK8 kit (CT0001, Cisco, Jinan).

[0061] 2. Experimental Methods The CCK8 cell viability assay was used to determine the effect of different concentrations of propionic acid (0, 0.1 mM, 0.5 mM) on the cell viability of WT and Mut cells. Loss rate = (OD value of control group CCK8 - OD value of test sample) / OD value of control group CCK8.

[0062] 3. Experimental Results The results showed that propionic acid (0.5 mM) could reduce the activity of Mut-iPSCs. Figure 9 ).

[0063] Example 4 1. Experimental materials Cell homogenate, propionyl-CoA (P5397, Sigma), enzyme reaction solution [100 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 1 mM DTT, 10 mM KCl, 40 mM NaHCO3, 1 mM Biotin, and 6 mM ATP].

[0064] 2. Experimental Methods Mass spectrometry analysis was performed using a 5500 QTRAP mass spectrometer (AB SCIEX) in positive ion mode. The source conditions for the 5500 QTRAP mass spectrometer were as follows: source temperature 500℃; ion source gas 1 (GS1): 50; ion source gas 2 (GS2): 50; curtain gas (CUR): 35; ion spray voltage (IS): 5500 V; detection was performed in MRM mode, and the measured ion pairs are shown in Table 2.

[0065] Table 2 Ion pairs measured

[0066] 3. Experimental Results The results showed that PCC enzyme activity was significantly reduced in Mut cells. Figure 10 ).

[0067] Example 5 1. Experimental materials Wild-type (WT) and mutant (Mut) iPSC cells, cardiac differentiation kit (Saibei).

[0068] 2. Experimental Methods Using a commercially available myocardial differentiation kit and following the experimental procedures, well-differentiated myocardial cells can be obtained.

[0069] 3. Experimental Results The results showed that Mut-iPSCs can differentiate into cardiomyocytes and can serve as a platform for drug screening in patients with propionic acidemia and in drug development. Figure 11 ).

[0070] Example 6 1. Experimental materials The culture medium for cardiomyocytes differentiated from wild-type (WT) and mutant (Mut) iPSC cells was divided into WT group and Mut group.

[0071] 2. Experimental Methods LC-MS / MS non-target metabolomics analysis 3. Experimental Results The results showed that Mut-iPSCs-CM exhibited a metabolic phenotype of propionic acidemia. Figure 12 ).

[0072] Example 7 1. Experimental materials Cardiomyocytes differentiated from wild-type (WT) and mutant (Mut) iPSC cells: WT-iPSCs-CM and Mut-iPSCs-CM.

[0073] 2. Experimental Methods After iPSCs-CM differentiated to Day 12, and the myocardial beating stabilized as a "synchronously beating iPSC-cardiomyocyte monolayer," a baseline video was first recorded. Then, the cells were placed in an incubator for equilibration for 10 minutes, followed by the addition of propionic acid (2.5 mM) for 10 minutes, and video was recorded again to analyze whether propionic acid would affect myocardial cell beating. After recording, the medium was changed and the cells were promptly placed back in the incubator.

[0074] 3. Experimental Results The results showed that propionic acid could significantly reduce the shrinkage capacity of Mut-iPSCs-CM, while increasing the shrinkage capacity of WT-iPSCs-CM. Figure 13 ).

[0075] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. An sgRNA for PCCA gene editing, characterized in that, The sequence of the sgRNA is shown in SEQ ID NO:

2.

2. The sgRNA according to claim 1, characterized in that, The sgRNA also includes sgRNA-related biological materials; Preferably, the biomaterial is selected from any one of the following: (1) The nucleic acid molecule encoding the sgRNA; (2) A carrier containing the nucleic acid molecule described in (1).

3. A system for PCCA gene editing, characterized in that, The system comprises the sgRNA according to any one of claims 1-2.

4. A method for constructing a propionic acidemia model, characterized in that, The method involves mutating glycine at position 668 of the PCCA gene to arginine.

5. The method according to claim 4, characterized in that, The glycine at position 668 of the PCCA gene was mutated to arginine using CRISPR-Cas9 gene editing technology. Preferably, the sgRNA used in the CRISPR-Cas9 gene editing technology is the sgRNA described in any one of claims 1-2; Preferably, the model includes a cell model and an animal model; Preferably, the model is a cell model; Preferably, the cells are iPSC cells.

6. A propionic acidemia model, characterized in that, The model is constructed by the method described in any one of claims 4-5; Preferably, the model includes a cell model and an animal model; Preferably, the model is a cell model.

7. The use of the sgRNA according to any one of claims 1-2 or the system according to claim 3 in constructing a propionic acidemia model; Preferably, the model includes a cell model or an animal model.

8. The use of the propionic acidemia model constructed by the method of any one of claims 4-5 or the propionic acidemia model of claim 6 in screening drugs for the prevention / treatment of propionic acidemia.

9. The application of the propionic acidemia model constructed by the method of any one of claims 4-5 or the propionic acidemia model of claim 6 in the study of the disease mechanism / disease target of propionic acidemia.

10. A method for screening drugs for the prevention / treatment of propionic acidemia, characterized in that, The method includes applying the test drug to a propionic acidemia model constructed by the method of any one of claims 4-5 or the propionic acidemia model of claim 6, and selecting the test drug that can improve the symptoms of propionic acidemia.

Images