Application of CgPEPC gene

Abstract

The invention discloses application of a CgPEPC gene in increasing the protein content of rice grains, and relates to the technical field of gene engineering, and an amino acid sequence coded by the CgPEPC gene is shown as SEQ ID NO.3. According to the invention, a CgPEPC gene overexpression rice plant is created, compared with a wild type, the increase of the single gene expression quantity can cause the increase of the protein content of rice grains, and the synthesis of glutelin and alcohol-soluble protein in the grains is enhanced by adjusting the distribution mode of nutrient substances in the rice grains, so that the yield of the rice grains is improved. And no adverse effect is generated on agronomic characters such as rice grain length, grain width, thousand grain weight and the like. The disclosure of the gene function has huge application potential and prospect for the improvement of rice variety traits, and a new gene resource is provided for improving the protein content and nutritional quality breeding of rice.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically to... CgPEPC Application of genes in increasing the protein content of rice grains. Background Technology

[0002] Rice ( Oryza sativa L. Rice is an important economic crop. While its protein content is only about 8% of the rice grain, it significantly impacts the cooking characteristics, taste, nutritional value, processing quality, and appearance of the rice. Rice grain protein is easily digested and utilized by the human body, has high safety, and can be consumed directly without allergy testing. It also has functions such as improving high blood pressure, lowering cholesterol, and combating diabetes, making it particularly suitable for patients with diabetes and indigestion. Rice grain protein is an ideal protein source that combines nutrition and functionality, meeting the diverse needs of people for a healthy diet.

[0003] The proteins in rice grains are mainly storage proteins, including gluten, prolamins, albumins, and globulins. Gluten and prolamins account for 70%-85% of the total protein in rice. Gluten is the most abundant protein in rice, and its content is positively correlated with the viscoelasticity and nutritional value of cooked rice. Prolamins mainly affect the hardness and chewiness of cooked rice. Therefore, increasing the protein content of rice grains and improving the accumulation levels of gluten and prolamins is crucial. The accumulation of nutrients in grains mainly depends on the carbon skeleton and energy produced by photosynthesis, as well as the nitrogen source provided by nitrogen assimilation. During grain filling, there is competition between carbon metabolism (starch synthesis) and nitrogen metabolism (protein synthesis) for photosynthetic assimilates. Typically, carbon metabolism dominates, which often leads to a bottleneck when increasing protein content through conventional breeding methods: the increase in protein content is often accompanied by a decrease in starch content, resulting in insufficient grain filling, reduced grain weight, decreased yield, or premature aging of the plant and other undesirable agronomic traits. This trade-off between gains and losses severely restricts the breeding of high-protein rice varieties.

[0004] Therefore, it is essential to discover new and effective genetic resources and develop their applications in order to create new rice germplasm that can synergistically increase grain protein content without sacrificing yield, thus providing strong technical support for ensuring food security and nutritional security. Summary of the Invention

[0005] In view of this, the present invention provides a CgPEPC Applications of genes.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: CgPEPC The application of genes, specifically for increasing the protein content of rice grains;CgPEPC The amino acid sequence encoded by the gene is shown in SEQ ID NO.3.

[0007] Preferably, the CgPEPC The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0008] Preferably, the protein is glutenin and / or an alcohol-soluble protein.

[0009] Another object of the present invention is to provide an improvement CgPEPC The application of biomaterials for increasing gene expression levels, wherein the application is to improve the protein content of rice grains, and the biomaterial is one of the following: a. capable of enabling CgPEPC Expression cassettes for gene overexpression; b. A recombinant vector containing the expression cassette described in a; c. Recombinant microorganisms containing the expression cassette described in a or the recombinant vector described in b; The CgPEPC The amino acid sequence encoded by the gene is shown in SEQ ID NO.3.

[0010] Preferably, the CgPEPC The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0011] Another objective of this invention is to provide a breeding method for increasing the protein content of rice grains, wherein the breeding method utilizes transgenic techniques to increase... CgPEPC Gene expression levels; the aforementioned CgPEPC The amino acid sequence encoded by the gene is shown in SEQ ID NO.3.

[0012] Preferably, the nucleotide sequence of the CgPEPC gene is shown in SEQ ID NO.1.

[0013] Beneficial effects: This invention provides CgPEPC Application of the gene. The enhanced expression of its single gene leads to a significant increase in the protein content of rice grains, while traits such as grain length, grain width, and thousand-grain weight do not change significantly. The genetic effect is significant, and it has great application potential and prospects for improving the traits of rice varieties, providing new genetic resources for breeding rice with improved protein content and nutritional quality. Attached Figure Description

[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0015] Figure 1 The attached figure shows the overexpression vector provided by this invention. 1300-pGluB::CgPEPC::tNos Linear diagram of promoter, target gene, and terminator.

[0016] Figure 2 The attached figure is a schematic diagram of the circular structure of the pCambia1300 vector plasmid.

[0017] Figure 3 The attached figure shows the overexpression in the Kitaake background provided by this invention. CgPEPC In transgenic plants CgPEPC The gene expression levels are compared. CgPEPC-1 and CgPEPC-2 represent the numbers of two transgenic plants, and the same interpretation applies to the following figures involving this legend.

[0018] Figure 4 The attached figure shows the overexpression in the Kitaake background provided by this invention. CgPEPC Phenotypic diagram of agronomic traits of transgenic plants; where a is the plant height of rice; b is the grain length of rice; c is the grain phenotype of rice; and d is the grain width of rice.

[0019] Figure 5 The attached figure shows the overexpression in the Kitaake background provided by this invention. CgPEPC Statistical chart of quantitative agronomic traits of transgenic plants; where a is the heading stage; b is the plant height; c is the number of effective tillers; and d is the thousand-grain weight.

[0020] Figure 6 The attached figure shows the overexpression in the Kitaake background provided by this invention. CgPEPC A statistical chart of protein content data for transgenic plants, where a represents grain glutenin content and b represents grain prolyl protein content. Detailed Implementation

[0021] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0022] Example 1 Rice CgPEPC Obtaining and Quantitatively Analyzing Gene Overexpression Plants 1. CgPEPC Construction of gene overexpression vectors According to information published on the National Center for Biotechnology Information (https: / / www.ncbi.nlm.nih.gov / ) CgPEPC The gene sequence (GenBank: X14234.1) (SEQ ID NO.1) was synthesized by Qingke Biotechnology Co., Ltd. after codon optimization, and the CDS sequence fragment (SEQ ID NO.2) was expressed using the rice endosperm-specific promoter GluB (SEQ ID NO.4). CgPEPC The gene was identified, and rice NOS (SEQ ID NO.5) was used as the terminator sequence.

[0023] The promoter was inserted into pCambia1300 using homologous recombination (see attached plasmid map). Figure 2 The terminator was inserted between EcoRI and SacI, and the target gene was inserted between KpnI and BamHI to obtain... 1300-pGluB::CgPEPC::tNos Overexpression vectors (see appendix) Figure 1 Based on the target, PCR-specific primers with restriction endonucleases on the promoter were designed as follows: GluB-F: tatgaccatgattacgaattcACAGATTCTTGCTACCAACAACTTCA, SEQ ID NO.6; GluB-R: ggatccccgggtaccgagctcGCTATTTGTACTTGCTTATGGAAACTT, SEQ ID NO.7. Amplification CgPEPC The specific primers for the optimized CDS sequence are CgPEPC-F: tacgaattcgagctcggtaccATGACGGACTTTCTCCGCG, SEQ ID NO.8; CgPEPC-R: caggtcgactctagaggatccTCAGCCGCTGTTGCGCAC, SEQ ID NO.9.

[0024] CgPEPC The original CDS sequence of the gene:

[0025] CgPEPC Optimized CDS sequence:

[0026] CgPEPC The amino acid sequence of the gene is as follows: MTDFLRDDIRFLGQILGEVIAEQEGQEVYELVEQARLTSFDIAKGNAEMDSLVQVFDGITPAKATPIARAFSHFALLANLAEDLYDEELREQALDAGDTPPDSTLDATWLKLNEGNVGAEAVADVLRNAEVAPVLTAHPTETRRRTVFDAQKWITTHMRERHALQSAEPTARTQSKLDEIEKNIRRRITILWQTALIRVARPRIEDEIEVGLRYYKLSLLEEIPRINRDVAVELRERFGEGVPLKPVVKPGSWIGGDHDGNPYVTAETVEYSTHRAAETVLKYYARQLHSLEHELSLSDRMNKVTPQLLALADAGHNDVPSRVDEPYRRAVHGVRGRILATTAELIGEDAVEGVWFKVFTPYASPEEFLNDALTIDHSLRESKDVLIADDRLSVLISAIESFGFNLYALDLRQNSESYEDVLTELFERAQVTANYRELSEAEKLEVLLKELRSPRPLIPHGSDEYSEVTDRELGIFRTASEAVKKFGPRMVPHCIISMASSVTDVLEPMVLLKEFGLIAANGDNPRGTVDVIPLFETIEDLQAGAGILDELWKIDLYRNYLLQRDNVQEVMLGYSDSNKDGGYFSANWALYDAELQLVELCRSAGVNVRLFHGRGGTVGRGGGPSYDAILAQPRGAVQGSVRITEQGEIISAKYGNPETARRNLEALVSATLEASLLDVSELTDHQRAYDIMSEISELSLKKYASLVHEDQGFIDYFTQSTPLQEIGSLNIGSRPSSRKQTSSVEDLRAIPWVLSWSQSRVMLPGWFGVGTALEQWIGEGEQATQRIAELQTLNESWPFLPSVLDNMAQVMSKAELRLAKLYADLIPDTEVAERVYSVIREEYFLTKKMFCVITGSDDLLDDNPLLARSVQRRYPYLLPLNVIQVEMMRRYRKGDQSEQVSRNIQLTMNGLSTAVRNSG. As shown in SEQ ID NO. 3.

[0027] The GluB promoter sequence is:

[0028] The NOS termination subsequence is: GAATTTCCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCA TGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGGTGTCATCTATGTTACTA, SEQ ID NO..5.

[0029] 2. CgPEPC Obtaining gene overexpression plants The result 1300-pGluB::CgPEPC::tNos The overexpression vector was transformed into rice (Kitaake) using Agrobacterium-mediated transformation. The specific procedure was as follows: Agrobacterium competent cells were thawed on ice at -80℃, and 10 μL of... 1300-pGluB::CgPEPC::tNos The plasmid was added to 100 μL of Agrobacterium competent cells and gently mixed by pipette tip rotation. The cells were then placed on ice and incubated for 20 min, followed by liquid nitrogen flash freezing for 5 min, and then incubated in a 37°C water bath for 5 min. After another 2 min on ice, 1 mL of antibiotic-free LB broth was added, and the cells were incubated at 28°C with shaking for 2–4 h. After centrifugation at 8000 rpm at room temperature for 1 min, the supernatant was discarded, and 100–200 μL was used to resuspend the precipitate. This precipitate was then plated onto LB broth (Kan 100 mg / L, Rif 125 mg / L) solid medium and incubated at 28°C for 2–3 days. Once single colonies had grown, PCR screening was performed to identify positive engineered bacteria. Finally, the T0 generation transgenic plants were obtained by transforming Kitaake callus tissue using Agrobacterium-mediated transformation.

[0030] 3. CgPEPC Gene expression analysis in Kitaake rice seeds Because this invention selects a rice endosperm-specific promoter, fresh rice seed samples from the field are placed in RNase-free centrifuge tubes and then into liquid nitrogen. The mortar and pestle must be sterilized with alcohol and pre-cooled. An appropriate amount of liquid nitrogen is poured into the mortar to pulverize the sample. 1 mL of Trizol is added, vortexed, and allowed to stand at room temperature for 20 mins. 200 μL of chloroform is added, vortexed, and centrifuged at 13000 rpm for 10 mins at 4°C. Approximately 700 μL of supernatant is transferred to a new 1.5 mL RNase-free centrifuge tube, and an equal volume of isopropanol is added to each tube. The tubes are then inverted to mix. The tubes are centrifuged at 13000 rpm for 10 mins at 4°C, the supernatant is discarded, and the precipitate is washed with 75% ethanol solution (treated with DEPC·H2O). The tubes are then centrifuged at 13000 rpm for 5 mins at 4°C. Discard the supernatant, centrifuge briefly for 1 min, aspirate excess liquid, and dry in a fume hood for 1 min (do not overdry). Add 30 μL of DEPC H2O to dissolve the RNA and store at -80℃. Reverse transcription was performed using the Hifair® AdvanceFast 1stStrand Cdna Synthesis Kit from Yisheng Biotechnology. 1 μg of RNA was used for reverse transcription. CgPEPC Gene expression levels were determined using cDNA as a template and qRT-PCR was performed in a 10 μL system of 2×SYBRGreen qPCR hot-start premix. The specific system consisted of: 1 μL cDNA, 0.2 μL 10 µM Primer R (reverse), 0.2 μL 10 µM Primer F (forward), 3.6 μL ddH2O, and 5 μL SYBR Green Master Mix.

[0031] The amplification reaction followed a two-step procedure performed in a real-time PCR instrument: 95°C for 3 minutes, followed by a cycling phase, each cycle consisting of 95°C for 10 seconds and 60°C for 30 seconds, for a total of 39 cycles; after the cycling phase, 65°C for 5 seconds, followed by a temperature increase from 65°C to 95°C at a rate of 0.5°C per second. Ubiquitin (LOC_Os03g13170) Genes are used as internal reference standards, using 2 -ΔΔCt The method calculates the relative expression level of the target gene.

[0032] The results showed that the expression level of this gene in transgenic plants was significantly higher than that in wild-type plants (see appendix). Figure 3 ).

[0033] Example 2 CgPEPC Comparison of agronomic traits of overexpression lines All obtained materials were planted in experimental fields at the Fuyang base of the China National Rice Research Institute, with single-plant planting, row spacing of 19.8 cm, and plant spacing of 16.5 cm. All field trials were managed uniformly according to normal field production methods. During the rice growth period, the heading stage, plant height, and number of effective divisions were observed. Harvesting was conducted after the rice matured. CgPEPC Ten out of twelve individual plants from the overexpression lines had their grains naturally dried and then left at room temperature for a period of time to ensure the grains were dry and that the moisture content was relatively consistent across the lines. Grain length, grain width, and thousand-grain weight were then examined. The results showed that compared to the wild type, CgPEPC The heading date, plant height, number of effective tillers, grain length, grain width, and thousand-grain weight of the overexpressing plants did not change significantly (see Appendix). Figure 4 and attached Figure 5 ).

[0034] Example 3 CgPEPC Identification of protein content in overexpressed plants Glutelin and glutenin account for approximately 65%–85% of the total protein in rice grains. Glutelin and glutenin were extracted from wild-type and transgenic brown rice lines, and their protein content was determined using the Coomassie Brilliant Blue method. The specific procedure was as follows: After dehulling and grinding the seeds, they were dried in a 42℃ oven until constant weight. 0.1 g of the brown rice flour to be tested was accurately weighed and placed in a 2 mL centrifuge tube. A steel ball and 1.6 mL of 0.1 mol / L NaOH solution were added. The tube was placed in a centrifuge and processed at 50 Hz for 60 seconds, then allowed to stand for 30 minutes, shaking frequently to ensure complete reaction. The mixture was centrifuged at 1150 g for 15 minutes, and the supernatant was transferred to a new 2 mL centrifuge tube. 400 μL of 0.1 mol / L NaOH solution was added, and the mixture was thoroughly mixed to obtain glutenin (three replicates per group). Add 1 mL of 70% ethanol to the precipitate obtained after centrifugation, place it in a sample press, and process it at a frequency of 50 Hz for 60 seconds. Subsequent operations are the same as for gluten extraction to obtain an alcohol-soluble protein solution.

[0035] To prepare a Coomassie Brilliant Blue G250 solution, weigh 10 mg of Coomassie Brilliant Blue G250 powder and dissolve it in 5 mL of 90% ethanol. Vortex until completely dissolved. Slowly add 10 mL of 85% (w / v) phosphoric acid solution, dilute to 100 mL with distilled water, filter, and finally store the solution in a brown bottle.

[0036] To prepare a standard curve, 40 mg of bovine serum albumin (BSA) was dissolved in 10 mL of distilled water. In a 200 μL centrifuge tube, 20 μL of a 4000 ug / mL BSA solution and 20 μL of distilled water were added sequentially to obtain a 2000 ug / mL BSA standard solution. The BSA concentration was gradually reduced through serial dilution to obtain a series of BSA standard solutions with concentration gradients of 4000, 2000, 1000, 500, 250, 125, 62.5, 31.25, and 15.625 ug / mL.

[0037] Take 3 μL each of the test sample and standard solution, mix them with 297 μL of Coomassie Brilliant Blue G-250 staining solution, let stand at room temperature for 2 minutes, and then measure their absorbance (OD) at 595 nm using an ELISA reader. 595 ). With standard protein concentration (ug / mL) as the x-axis, OD 595 Plot a standard curve with the OD value on the vertical axis. 595 Using the standard curve as a reference, calculate the concentrations of gluten and alcohol-soluble protein in the unknown sample.

[0038] The results showed that CgPEPC The overexpressing plants showed significantly higher levels of glutenin and prolamins compared to the wild type (see Appendix). Figure 6 ) The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0039] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. CgPEPC The application of genes is characterized by, The application is to increase the protein content of rice grains; The CgPEPC The amino acid sequence encoded by the gene is shown in SEQ ID NO.

3.

2. As described in claim 1 CgPEPC The application of genes is characterized by, The CgPEPC The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. Improve CgPEPC The application of biomaterials for gene expression level is characterized by, The application is to increase the protein content of rice grains; The biomaterial is one of the following: a. capable of enabling CgPEPC Expression cassettes for gene overexpression; b. A recombinant vector containing the expression cassette described in a; c. Recombinant microorganisms containing the expression cassette described in a or the recombinant vector described in b; The CgPEPC The amino acid sequence encoded by the gene is shown in SEQ ID NO.

3.

4. The improvement according to claim 3 CgPEPC The application of biomaterials for gene expression level is characterized by, The CgPEPC The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

5. A breeding method for increasing the protein content of rice grains, characterized in that, Using genetic engineering to improve CgPEPC Gene expression levels; The CgPEPC The amino acid sequence encoded by the gene is shown in SEQ ID NO.

3.

6. The breeding method according to claim 5, characterized in that, The CgPEPC The nucleotide sequence of the gene is shown in SEQ ID NO.1.

Images