Application of QTL (Quantitative Trait Loci) qCsr12 in identifying chilo suppressalis resistance character of rice
By identifying the QTL site qCsr12 and its InDel marker on rice chromosome 12, the problem of identifying rice resistance to rice stem borer was solved, enabling rapid and accurate molecular marker-assisted selection, and improving breeding efficiency and environmental friendliness.
Patent Information
- Application Number
- CN202512005728.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-29
- Publication Date
- 2026-02-10
AI Technical Summary
The lack of effective molecular markers in existing technologies for identifying rice resistance to rice stem borer leads to long breeding cycles, low efficiency, and susceptibility to environmental interference. Chemical pesticide control also poses environmental pollution and health risks.
By identifying the QTL site qCsr12 on rice chromosome 12 and its related InDel markers, PCR amplification was performed using a specific primer set to rapidly detect the rice variety's resistance to stem borer and achieve marker-assisted selection.
It improves the selection efficiency of rice resistant to stem borer, shortens the breeding cycle, reduces pesticide use, and enhances breeding accuracy and environmental friendliness.
Smart Images

Figure CN121496093A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of molecular biology and plant genetics and breeding technology, and in particular to the application of the QTL locus qCsr12 in identifying rice resistance to rice stem borer. Background Technology
[0002] Rice is an important food crop, and ensuring its yield and quality is crucial. Insect pests are a key factor restricting rice production, among which the rice stem borer (Chilodonella spp.) is a major pest of the Lepidoptera family Pyralidae, occurring year-round in various rice-growing areas and causing increasingly severe damage. The rice stem borer mainly damages rice in the middle and late stages of growth, leading to symptoms such as dead heart, dead sheath, and whiteheads, seriously affecting grain filling and grain development. In the field, its damage is concentrated, with strong reproductive capacity but weak migratory ability, and the number of generations varies depending on the region.
[0003] Currently, the control of rice stem borer still relies mainly on chemical pesticides, which lead to environmental pollution, pesticide residues, and health risks due to long-term and extensive use. Therefore, exploring endogenous insect-resistant germplasm resources in rice, locating and cloning rice stem borer-resistant genes, and breeding insect-resistant varieties have become a consensus on an economical, effective, and environmentally friendly control strategy.
[0004] In the research of insect-resistant genes, many genes for resistance to brown planthoppers have been located and cloned in rice, such as Bph14, Bph3, and Bph9. However, research on resistance genes against rice stem borers is still relatively scarce. Currently, there are no reports of forward-cloned stem borer-resistant genes. Most studies have used reverse genetics to clone some insect-related genes involved in defense signaling pathways such as jasmonic acid and salicylic acid, providing important references for elucidating the insect resistance mechanism of rice and subsequent gene cloning.
[0005] Traditional breeding relies on phenotypic selection, which is time-consuming, inefficient, and susceptible to environmental interference. QTL technology, by analyzing genomic regions controlling complex traits, enables marker-assisted selection, offering advantages such as: early selection (genotype screening at the seedling stage, significantly shortening the breeding cycle); environmental stability (direct selection of target genotypes, reducing phenotypic misjudgments); and precise gene aggregation (simultaneous aggregation of multiple resistance or superior genes, leading to breakthrough varieties). However, molecular markers targeting endogenous rice stem borer resistance remain scarce. Developing relevant endogenous molecular markers is crucial for improving breeding efficiency and accuracy, mitigating pest losses, and promoting green agriculture.
[0006] In view of this, the present invention is hereby proposed. Summary of the Invention
[0007] To address the aforementioned technical problems, this invention provides the application of the QTL site qCsr12 in identifying rice resistance to rice stem borer.
[0008] Specifically, the technical solution of the present invention is as follows:
[0009] In a first aspect, the present invention provides the application of rice stem borer resistance QTL loci in identifying rice stem borer resistance traits. The QTL loci are located on rice chromosome 12, and their physical location is in the genomic region from 14,622,560 bp to 15,227,648 bp in the MH63 reference genome.
[0010] Preferably, the QTL site is identified by at least one InDel marker from the following (a) to (f):
[0011] (a) The marker INDEL12-1462 is located at 14,622,560 bp in the MH63 reference genome;
[0012] (b) The marker INDEL12-1522 is located at position 15,227,648 bp in the MH63 reference genome;
[0013] (c) The marker INDEL12-1429 is located at position 14,291,540 bp in the MH63 reference genome;
[0014] (d) The marker INDEL12-1437 is located at position 14,375,199 bp in the MH63 reference genome;
[0015] (e) The marker INDEL12-1459 is located at 14,599,203 bp in the MH63 reference genome;
[0016] (f) The marker INDEL12-1510 is located at 15,106,953 bp in the MH63 reference genome.
[0017] Preferably, the indel variant of INDEL1462 is A / AGTACACCCACTAATGTTAATCTTTTTGGC; the indel variant of INDEL1522 is TAAGTAAACGGAAGCTA / T; the indel variant of INDEL12-1429 is G / GACAAGGAGCCCACCGGCCTCCA; the indel variant of INDEL12-1437 is TTATAAACTTGTAATGCATACATGAATACTGTTA / T; the indel variant of INDEL12-1459 is TACCGGGTCAA / T; and the indel variant of INDEL12-1510 is GCACGTGGACTCCTAGTGACAGGCGTCCAGCAGCACC / G.
[0018] Preferably, the amplification primer pair sequences labeled INDEL12-1462 are shown in SEQ ID NO.7 and SEQ ID NO.8; the amplification primer pair sequences labeled INDEL12-1522 are shown in SEQ ID NO.11 and SEQ ID NO.12; the amplification primer pair sequences labeled INDEL12-1429 are shown in SEQ ID NO.1 and SEQ ID NO.2; the amplification primer pair sequences labeled INDEL12-1437 are shown in SEQ ID NO.3 and SEQ ID NO.4; the amplification primer pair sequences labeled INDEL12-1459 are shown in SEQ ID NO.5 and SEQ ID NO.6; and the amplification primer pair sequences labeled INDEL12-1510 are shown in SEQ ID NO.9 and SEQ ID NO.10.
[0019] Preferably, the amplification product size labeled INDEL12-1462 is 139 bp; the amplification product size labeled INDEL12-1522 is 134 bp; the amplification product size labeled INDEL12-1429 is 114 bp; the amplification product size labeled INDEL12-1437 is 108 bp; the amplification product size labeled INDEL12-1459 is 125 bp; and the amplification product size labeled INDEL12-1510 is 146 bp.
[0020] In a second aspect, the present invention provides InDel molecular markers for identifying rice stem borer resistance, including at least one of the following (a) to (f):
[0021] (a) The marker INDEL12-1462 is located at 14,622,560 bp in the MH63 reference genome;
[0022] (b) The marker INDEL12-1522 is located at position 15,227,648 bp in the MH63 reference genome;
[0023] (c) The marker INDEL12-1429 is located at position 14,291,540 bp in the MH63 reference genome;
[0024] (d) The marker INDEL12-1437 is located at position 14,375,199 bp in the MH63 reference genome;
[0025] (e) The marker INDEL12-1459 is located at 14,599,203 bp in the MH63 reference genome;
[0026] (f) The marker INDEL12-1510 is located at 15,106,953 bp in the MH63 reference genome.
[0027] Thirdly, the present invention provides a primer set for identifying rice stem borer resistance, comprising at least one set of the following (a) to (f):
[0028] (a) Sequence SEQ ID NO.7 and sequence SEQ ID NO.8;
[0029] (b) Sequences SEQ ID NO.11 and SEQ ID NO.12;
[0030] (c) Sequence SEQ ID NO.1 and sequence SEQ ID NO.2;
[0031] (d) Sequences SEQ ID NO.3 and SEQ ID NO.4;
[0032] (e) Sequences SEQ ID NO.5 and SEQ ID NO.6;
[0033] (f) Sequence SEQ ID NO.9 and sequence SEQ ID NO.10.
[0034] Fourthly, the present invention provides a kit containing the aforementioned primer set.
[0035] Fifthly, this invention provides the application of the aforementioned InDel molecular markers, primer sets, and kits in identifying rice stem borer resistance traits.
[0036] In a sixth aspect, the present invention provides the application of the aforementioned InDel molecular markers, primer sets, and kits in screening rice varieties with stem borer resistance and in stem borer resistant rice breeding.
[0037] Beneficial effects:
[0038] This invention provides the application of the QTL locus qCsr12 in identifying rice resistance to the rice stem borer. The invention utilizes the genotype of a high-generation recombinant inbred line constructed by crossing the rice stem borer-resistant variety WFS with the susceptible variety 923, combined with genetic linkage analysis of stem-infested insect weight, to identify the stem borer resistance QTL locus qCsr12 on chromosome 12 of WFS, located between indel1462 and indel1522. Using specific molecular markers, the major resistance QTL locus qCsr12 in the stem borer-resistant variety WFS and its derivatives can be effectively detected, greatly improving the selection efficiency of stem borer-resistant rice and obtaining rice lines containing the major resistance locus of WFS. Attached Figure Description
[0039] To more clearly illustrate the technical solutions in this invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be described below.
[0040] Figure 1 This invention is based on a high-density genetic linkage map constructed from parental WFS, 923, and 222 offspring families.
[0041] Figure 2 Correlation analysis and frequency distribution diagram of 222 RIL populations in this invention on the resistance to rice stem borer.
[0042] Figure 3 This is the location result of the rice WFS in the rice, specifically the major site qCsr12 for resistance to rice stem borer, on chromosome 12.
[0043] Figure 4 This describes the differential banding patterns of the six indel markers in the parent plants according to the present invention.
[0044] Figure 5 This is a phenotypic diagram of the BC4F5 recombinant single plant of the present invention.
[0045] Figure 6 This is a genotype diagram of the molecular marker of the BC4F5 recombinant single plant of the present invention. Detailed Implementation
[0046] This invention provides a method for identifying the rice stem borer resistance QTL site qCsr12, its indel marker, and its application. The indel marker can detect rice resistance to stem borers, thereby improving rice resistance to rice stem borers in the field, increasing rice yield, and reducing the need for pesticide spraying.
[0047] First, this invention provides the QTL locus qCsr12 for rice resistance to the rice stem borer. Its mapping is based on an F2:3 segregating population or a backcross population. This population is constructed by multiple generations of self-pollination after crossing parent WFS (resistant to stem borer) with parent 923 (susceptible to stem borer), with a population size of 222 lines. This invention uses testcrosses to screen recombinant single-plant lines, including but not limited to line Re-12-3. These recombinant single plants co-segregate in the target phenotypic and genotype, all carry the qCsr12 region, and also exhibit resistance to stem borer.
[0048] This invention further provides molecular markers for detecting the major QTL site qCsr12 for resistance to rice stem borer, namely INDEL12-1462 and INDEL12-1522. These two molecular markers were obtained by PCR amplification using the following two primer pairs:
[0049] INDEL1462F: 5'-AGTGTCCTGATCAATCTGCTA-3' (SEQ ID NO. 7);
[0050] INDEL1462R: 5'-GTTGATCGAGCCAACATCTC-3' (SEQ ID NO. 8);
[0051] INDEL1522F: 5'-GCTTTGCATTGCATGTTGGC-3' (SEQ ID NO. 11);
[0052] INDEL1522R: 5'-TCATATTTCAGTGCACAAGCTG-3' (SEQ ID NO. 12).
[0053] Among them, INDEL1462 is located at 14622560 on chromosome 12 of the rice MH63 reference genome, and the indel variant is A / AGTACACCCACTAATGTTAATCTTTTTGGC.
[0054] INDEL1522 is located at 15227648bp on chromosome 12 of the rice MH63 reference genome, with the indel variant being TAAGTAAACGGAAGCTA / T.
[0055] The PCR amplification products described above were separated using 4% agarose gel, and the amplified DNA bands were then recorded by UV light color development.
[0056] The present invention also provides four indel molecular markers within qCsr12 to assist in the detection of qCsr12 genotypes, namely INDEL12-1429, INDEL12-1437, INDEL12-1459, and INDEL12-1510.
[0057] The above four molecular markers were obtained by PCR amplification using the following seven pairs of primers:
[0058] INDEL1429F: 5'-TCTAGAACTAAGGGGGTGGAG-3' (SEQ ID NO. 1);
[0059] INDEL1429R: 5'- CAAGCATCAGTCAGGGAGAG-3' (SEQ ID NO. 2);
[0060] INDEL1437F: 5'- CAGTGTTCCTGCACATAACAG -3' (SEQ ID NO.3);
[0061] INDEL1437R: 5'-TGGGTTACAGAGTTCAGTGC-3' (SEQ ID NO. 4);
[0062] INDEL1459F: 5'-AATCAACACTTCAGCAGGGAG-3' (SEQ ID NO. 5);
[0063] INDEL1459R: 5'-GACAGTTTGCAACAATGTGAGG T-3' (SEQ ID NO. 6);
[0064] INDEL1510F: 5'-ACTAATGCCGAGTCATCCTA-3' (SEQ ID NO.9);
[0065] INDEL1510R: 5'-GACGGTAGCAATGATAGATGT-3' (SEQ ID NO. 10).
[0066] Among them, INDEL12-1429 is located at 14291540bp on chromosome 12 of the rice MH63 reference genome, and the indel variant is G / GACAAGGAGCCCACCGGCCTCCA.
[0067] INDEL12-1437 is located at 14375199bp on chromosome 12 of the rice MH63 reference genome, with the indel variant being TTATAAACTTGTAATGCATACATGAATACTGTTA / T.
[0068] INDEL12-1459 is located at 14599203bp on chromosome 12 of the rice MH63 reference genome, with the indel variant being TACCGGGTCAA / T.
[0069] INDEL12-1510 is located at 15106953bp on chromosome 12 of the rice MH63 reference genome, with the indel variant being GCACGTGGACTCCTAGTGACAGGCGTCCAGCAGCACC / G.
[0070] The PCR amplification products described above were separated using 4% agarose gel, and the amplified DNA bands were then recorded by UV light color development.
[0071] This invention screens an indel marker closely related to rice resistance to stem borer. This marker can specifically detect the stem borer-resistant parental QTL locus qCsr12, enabling rapid detection of stem borer resistance in rice varieties. By detecting this indel molecular marker, it can be applied to marker-assisted breeding. Introducing the qCsr12 stem borer resistance locus into other susceptible materials can rapidly screen for hybrids carrying the resistance locus, significantly shortening the breeding cycle. The detection method provided by this invention is accurate, reliable, and easy to operate, suitable for high-throughput genotyping equipment, and can be efficiently applied to the selection of stem borer-resistant varieties in commercial rice breeding.
[0072] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.
[0073] The endpoints and any values of the ranges disclosed in this specification are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.
[0074] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "specific implementation," or "some specific implementations," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.
[0075] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.
[0076] Example 1
[0077] This embodiment describes the initial localization process of qCsr12.
[0078] (1) Construction of high-generation recombination inbred lines.
[0079] High-generation recombinant inbred lines were constructed by crossing the stem borer-resistant wild rice variety WFS with the susceptible material 923. The stem borer resistance of WFS and 923 was assessed using an indoor stem-insect inoculation method; WFS was found to be highly resistant, while 923 was susceptible. Crossbreeding was performed using WFS as the male parent and 923 as the female parent, and F1 seeds were harvested. In the F2 generation, each plant was bagged with 1-2 panicles. From the F3 generation onwards, recombinant inbred lines were constructed using the single-seed transfer method, yielding 222 lines up to the F9 generation.
[0080] (2) Construction of high-density genetic linkage map based on WGS.
[0081] Next-generation resequencing was performed on the parental WFS, 923, and 222 progeny families to develop high-density SNPs, construct binmaps, and build genetic maps. The bioinformatics analysis workflow for the resequencing genetic maps included: data quality control (removal of adapters and low-quality data), alignment with a reference genome, variant detection and annotation, marker genotyping and screening, binmap construction, genetic map construction, map quality assessment, recombination hotspot analysis, QTL localization, primer design, and candidate gene annotation. A total of 9.92 Gbp of clean data was obtained from the parental WFS, and 9.45 Gbp from the parental 923. The total data volume of the 222 progeny families was 759.05 Gbp. FastQC results showed that the average percentages of bases with quality numbers greater than 20 and 30 were 97.93% and 93.36%, respectively, meeting the quality requirements for further analysis. A total of 369,463 SNPs and 67,971 InDels were detected among the parents as usable markers. Bin was divided into 12 linkage groups based on known information. Using HighMap software as the unit of analysis, the linear arrangement of markers within each linkage group was obtained, and the genetic distance between adjacent markers was estimated. The total map distance across the 12 linkage groups was 1363.437 cM, with an average map distance of 0.878 cM. The high-density genetic map is shown below. Figure 1 As shown, large gap regions exist on chromosomes 1, 6, 7, 8, and 12. This is mainly because, during the construction of the RIL population, after the F1 generation was backcrossed with 923, some chromosome segments were homozygous for 923, leading to a loss of diversity. In non-gap regions, the markers are relatively evenly distributed.
[0082] (3) Identification of the phenotypic resistance of recombinant inbred lines.
[0083] Indoor resistance testing for rice stem borer was performed using the detached stem method.
[0084] Materials needed: egg masses, rooting tubes, filter paper, sterile water, syringe, tweezers, scissors, brush, absorbent cotton, rubber bands, black cloth, marker.
[0085] Hatching egg masses: Place the rice stem borer egg masses in an insect rearing room with a temperature of about 28 ℃ and a humidity of about 70% for incubation. Observe closely, and when the egg masses turn black in about 2-3 days, they are ready for the inoculation experiment.
[0086] Stem cutting: Take the main tillers of rice from the experimental and control groups that are in the same heading and jointing stage, peel off the rice leaf sheaths, and cut the stems 7-10 cm above the base, so that the nodular part is in the middle and lower part of the rooting tube.
[0087] Inoculation identification: Two sterile, round filter papers moistened with ddH2O (no standing water) were placed at the bottom of the rooting tubes. Trimmed rice stems were placed into the rooting tubes according to their numbers, with at least three replicates per number. Three stems were placed in each replicate, and 30 newly hatched larvae were inoculated. The tube openings were sealed with absorbent cotton. The top of the test tubes was covered with a black cloth and placed in a constant temperature and humidity incubator (temperature 28 ℃ ± 2 ℃, humidity 65%-75%, light:dark = 16 h: 8 h). After 7 days, the number of surviving larvae and the average weight of the live larvae were counted. An indoor stem inoculation experiment was conducted on 222 progeny families. The 7-day average weight (AW) was used as the analytical index to detect the QTL (CSR) of resistance to rice stem borer within the population. The results showed that the three replicates had a good correlation ( Figure 2 (Figure A), and the average insect weight of the population shows a normal distribution ( Figure 2 The B-chart (in Chinese) can be used for correlation analysis.
[0088] (4) Association analysis.
[0089] Core extinction index phenotypic data from 222 progeny families were collected in two batches and correlated with Bin Map genetic maps. Composite Interval Mapping (CIM) analysis was performed using WinQTLcart software, and the 15.24 cM-18.12 cM interval on chromosome 12 was analyzed. Figure 3 The LOD values were 5.22 and 2.96, respectively, explaining 6.54%-9.00% of the phenotypic variation. The additive effect of the average insect weight came from the parent 923, which had the effect of increasing the insect weight.
[0090] Example 2
[0091] This embodiment illustrates the fine localization results and effect verification of qCsr12.
[0092] (1) Genotypes of 222 RIL families within qCsr12 were obtained.
[0093] Using high-depth parental resequencing data and reference genome information, several primer pairs were designed based on the indel differences between the two parents within the aforementioned preliminary localization interval to detect the genotype of RIL families within the preliminary localization interval.
[0094] Leaves were collected from the two parental rice varieties, WFS and 923, and rice DNA was extracted using the CTAB method. PCR was then performed using the designed indel primers.
[0095] The PCR amplification reaction system (20 μL) includes: 0.1 μL rTaq enzyme, 2 μL 10× Loading Buffer, 0.4 μL 10 mM dNTP, 0.2 μL forward primer, 0.2 μL reverse primer, 100-200 ng rice genomic DNA, and ddH2O to bring the total to 20 μL.
[0096] The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 20 s, 35 cycles; 72℃ extension for 5 min; storage temperature 4℃.
[0097] PCR products were subjected to 4% agarose gel electrophoresis with 5% GoldView nucleic acid dye added to the agarose gel. Electrophoresis was performed at a constant voltage of 200V for 40 min, followed by UV irradiation of the gel. Six indel markers showing differences between the parental PCR products were selected: indel466 was the marker to the left of qCsr12, indel522 was the marker to the right of qCsr12, and other indel markers were located inside qCsr12. A represents the WFS band pattern of the resistant parent, and B represents the 923 band pattern of the susceptible parent. The primer sets used to identify the indel markers are shown in Table 1. A represents the size of the product from the resistant parent, and B represents the size of the product from the susceptible parent.
[0098] Table 1 List of indel-labeled primers and products
[0099]
[0100] DNA was extracted from 222 RIL families using the CTAB method, and the genotypes of the 222 families within qCsr12 were detected using 6 pairs of indel markers.
[0101] (2) Fine localization and effect verification of qCsr12.
[0102] To verify the resistance effect of the exchange fragments and perform fine mapping, a backcross population was constructed using a highly resistant family from the RIL family as the male parent and 923 as the recurrent female parent. After two backcrosses and one self-cross, a BC4F5 population was obtained. Using the indel429 and indel522 markers, 58 individual plants exhibiting internal recombination within qCsr12 were screened from the 6327 BC4F5 plants. The exchange type of these recombinant plants was detected using four indel markers, yielding three recombination types. Homozygous progeny of the three recombination types were then subjected to indoor stem-insect inoculation identification. Table 2 shows the comparison between the recombinant plant lines' resistance phenotype and genotype, where W represents the genotype of the resistant parent WFS, 9 represents the genotype of the susceptible parent 923, and H represents the heterozygous type.
[0103] The results of the identification are as follows Figure 4 As shown, the numbers represent marker names. The 0.37 Mb region at the left end of the qCsr12 locus has no resistance to rice stem borer. Genetically, the initial mapping region was shortened by 0.37 Mb using a secondary segregating population of three qCsr12 recombinant single plants in the F2 generation. This further located the target region between markers 1462 and 1522. The target resistance gene is located within 0.63 Mb at the right end.
[0104] Table 2. Comparison of recombinant single-plant genotypes and stem borer resistance phenotypes
[0105]
[0106] As shown in Table 2, qCsr12 is an effective locus for resistance to stem borers. The recombinant single-strain Re-12-3 carrying qCsr12 showed that InDel1459, InDel1462, InDel1510, and InDel1522 were stem borer resistant genotypes and exhibited resistance to stem borers.
[0107] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. The application of rice stem borer resistance QTL loci in identifying rice stem borer resistance traits, characterized in that, The QTL site is located on rice chromosome 12, specifically in the genomic region from 14,622,560 bp to 15,227,648 bp in the MH63 reference genome.
2. The application according to claim 1, characterized in that, The QTL sites are identified by at least one InDel marker from (a) to (f) below: (a) The marker INDEL12-1462 is located at 14,622,560 bp in the MH63 reference genome; (b) The marker INDEL12-1522 is located at position 15,227,648 bp in the MH63 reference genome; (c) The marker INDEL12-1429 is located at position 14,291,540 bp in the MH63 reference genome; (d) The marker INDEL12-1437 is located at position 14,375,199 bp in the MH63 reference genome; (e) The marker INDEL12-1459 is located at 14,599,203 bp in the MH63 reference genome; (f) The marker INDEL12-1510 is located at 15,106,953 bp in the MH63 reference genome.
3. The application according to claim 2, characterized in that, The indel variant of INDEL1462 is A / AGTACACCCACTAATGTTAATCTTTTTGGC; the indel variant of INDEL1522 is TAAGTAAACGGAAGCTA / T; the indel variant of INDEL12-1429 is G / GACAAGGAGCCCACCGGCCTCCA; the indel variant of INDEL12-1437 is TTATAAACTTGTAATGCATACATGAATACTGTTA / T; the indel variant of INDEL12-1459 is TACCGGGTCAA / T; and the indel variant of INDEL12-1510 is GCACGTGGACTCCTAGTGACAGGCGTCCAGCAGCACC / G.
4. The application according to claim 3, characterized in that, The amplification primer pair sequences labeled INDEL12-1462 are shown in SEQ ID NO.7 and SEQ ID NO.8; the amplification primer pair sequences labeled INDEL12-1522 are shown in SEQ ID NO.11 and SEQ ID NO.12; the amplification primer pair sequences labeled INDEL12-1429 are shown in SEQ ID NO.1 and SEQ ID NO.2; the amplification primer pair sequences labeled INDEL12-1437 are shown in SEQ ID NO.3 and SEQ ID NO.4; the amplification primer pair sequences labeled INDEL12-1459 are shown in SEQ ID NO.5 and SEQ ID NO.6; and the amplification primer pair sequences labeled INDEL12-1510 are shown in SEQ ID NO.9 and SEQ ID NO.
10.
5. The application according to claim 4, characterized in that, The amplification product size labeled INDEL12-1462 was 139 bp; the amplification product size labeled INDEL12-1522 was 134 bp; the amplification product size labeled INDEL12-1429 was 114 bp; the amplification product size labeled INDEL12-1437 was 108 bp; the amplification product size labeled INDEL12-1459 was 125 bp; and the amplification product size labeled INDEL12-1510 was 146 bp.
6. An InDel molecular marker for identifying rice stem borer resistance, characterized in that, Includes at least one of the following (a) to (f): (a) The marker INDEL12-1462 is located at 14,622,560 bp in the MH63 reference genome; (b) The marker INDEL12-1522 is located at position 15,227,648 bp in the MH63 reference genome; (c) The marker INDEL12-1429 is located at position 14,291,540 bp in the MH63 reference genome; (d) The marker INDEL12-1437 is located at position 14,375,199 bp in the MH63 reference genome; (e) The marker INDEL12-1459 is located at 14,599,203 bp in the MH63 reference genome; (f) The marker INDEL12-1510 is located at 15,106,953 bp in the MH63 reference genome.
7. A primer set for identifying rice resistance to stem borer, characterized in that, Includes at least one of the following (a) to (f): (a) Sequence SEQ ID NO.7 and sequence SEQ ID NO.8; (b) Sequences SEQ ID NO.11 and SEQ ID NO.12; (c) Sequence SEQ ID NO.1 and sequence SEQ ID NO.2; (d) Sequences SEQ ID NO.3 and SEQ ID NO.4; (e) Sequences SEQ ID NO.5 and SEQ ID NO.6; (f) Sequence SEQ ID NO.9 and sequence SEQ ID NO.
10.
8. A kit containing the primer set of claim 7.
9. The application of the InDel molecular marker of claim 6, the primer set of claim 7, and the kit of claim 8 in identifying rice stem borer resistance traits.
10. The application of the InDel molecular marker of claim 6, the primer set of claim 7, and the kit of claim 8 in screening rice varieties with stem borer resistance and in stem borer resistant rice breeding.