Device, reagent and kit for detecting B19V infection and method for identifying B19V multilineage cell infection

Abstract

The invention discloses a device, a reagent and a kit for detecting B19V infection and a method for identifying B19V multilineage cell infection, and belongs to the field of virus detection. The technical problem to be solved by the invention is to evaluate B19V infection conditions of different cell lineages in the same sample. The reagent for detecting B19V infection disclosed by the invention contains a B19V probe and an antibody for marking a cell lineage, the sequence of the B19V probe is as shown in SEQ ID No.1, and the antibody for marking the cell lineage is a CD34 antibody, a CD38 antibody, a CD4 antibody, a CD8 antibody and a CD56 antibody. The reagent and the kit can be used for simultaneously detecting the B19V infection condition of multi-lineage cells in the same sample, distinguishing the B19V infection conditions of different cell lineages in the same sample, and realizing accurate positioning of B19V positive cells.

Description

Technical Field

[0001] This invention belongs to the field of virus detection in medical diagnostics, specifically relating to devices, reagents, kits for detecting B19V infection and methods for identifying B19V multilineage cell infections. Background Technology

[0002] Human parvovirus B19 (B19V) is a single-stranded DNA virus whose genome primarily encodes two capsid proteins (VP1 and VP2) and three non-structural proteins (NS1, an 11kDa protein, and a 7.5kDa protein). B19V is mainly transmitted through the respiratory tract and blood, infecting 50% to 85% of the adult population. While B19V infection is usually asymptomatic and self-limiting in healthy individuals, in immunocompromised patients, infection can persist for months to years, infecting multiple immune cells, causing multi-lineage hematopoietic dysfunction, and even leading to serious systemic complications such as hemophagocytic lymphohistiocytosis (HLH) and multiple organ failure. Currently, PCR testing is the gold standard for diagnosing B19V infection.

[0003] Direct PCR detection of the B19V DNA sequence is currently the gold standard for diagnosing B19V infection. Commercially available B19V test kits primarily perform qualitative or quantitative analysis of B19V viral DNA. While they offer high sensitivity and specificity for viral genome detection, they still have limitations: firstly, these methods cannot detect B19V viral RNA transcripts, thus failing to determine whether the virus is latent or replicating; secondly, they cannot simultaneously determine the relationship between the virus and various cell subpopulations, nor can they simultaneously identify the B19V infection status of multiple cell lineages within the same sample. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to simultaneously detect the B19V infection status of multiple cell lineages in the same sample, distinguish the B19V infection status of different cell lineages in the same sample, and achieve rapid and accurate localization of B19V positive cells.

[0005] To address the aforementioned technical problems, the present invention first provides an apparatus for detecting B19V-infected cell lineages, the apparatus comprising a pretreatment module, a cell sorting module, a B19V detection module, and an analysis module; The preprocessing module is used to obtain bone marrow and / or peripheral blood mononuclear cells from the subject's ex vivo samples; The cell sorting module is used to label bone marrow and / or peripheral blood mononuclear cells with markers of different cell lineages; The B19V detection module is used to detect B19V in bone marrow and / or peripheral blood mononuclear cells; the B19V detection is performed using a reagent for detecting B19V infection, the reagent for detecting B19V infection contains a B19V probe, the B19V probe being a double Z-shaped oligonucleotide chain as shown in SEQ ID No. 1; The analysis module determines the cell lineage infected with B19V based on the results of the B19V detection module and the cell sorting module.

[0006] Specifically, the cell lineage refers to different subsets of lymphocytes, such as cell subpopulations that are positive for a single antibody or a combination of multiple antibodies, including CD34 antibody, CD38 antibody, CD4 antibody, CD8 antibody, CD56 antibody, CD14 antibody, and CD19 antibody.

[0007] Furthermore, the reagent also contains antibodies for labeling cell lineages (such as CD34 antibody, CD38 antibody, CD4 antibody, CD8 antibody, CD56 antibody, CD14 antibody and / or CD19 antibody, etc.).

[0008] The reagents used to detect B19V infection may also contain reagents other than antibodies for cell sorting by flow cytometry and / or reagents other than probes for in situ hybridization.

[0009] Specifically, the reagent for detecting B19V infection may consist solely of the B19V probe, or it may consist of the B19V probe and the antibody used to label cell lineages, or it may consist of the B19V probe, the antibody used to label cell lineages, the reagent used for cell sorting by flow cytometry excluding the antibody, and the reagent used for in situ hybridization excluding the probe.

[0010] In one embodiment of the present invention, the reagents used for in situ hybridization, excluding the probe, are the reagents in the PrimeFlow RNA detection kit.

[0011] The reagent used to detect B19V infection is also within the scope of protection of this invention.

[0012] The present invention also provides a kit for detecting B19V infection, the kit containing reagents for detecting B19V infection.

[0013] The following applications of the reagent for detecting B19V infection or the kit for detecting B19V infection are also within the scope of protection of this invention: X1) Preparation and identification of B19V-infected cell lineages; X2) Prepare products that identify therapeutic targets for B19V infection; X3) Guide the preparation of drugs for treating B19V infection; X4) Products for preparing and detecting B19V infection samples; X5) Prepare products for detecting B19V infection in multiple cell lineages in the same sample; X6) Prepare products that can distinguish different B19V infection statuses in the same sample.

[0014] X7) Prepare B19V positive cell localization products from ex vivo samples.

[0015] The present invention also provides a method for identifying B19V multilineage cell infection, the method comprising: (a) Extracting bone marrow and / or peripheral blood mononuclear cells from the subject's ex vivo samples; (b) Marking bone marrow and / or peripheral blood mononuclear cells using markers of different cell lineages; (c) Use the B19V probe to perform hybridization to determine B19V-infected cells; (d) Flow cytometry was used to detect B19V-infected cell lineages to obtain information on B19V multi-lineage cell infection.

[0016] Specifically, the cell lineage refers to different subsets of lymphocytes, such as cell subpopulations that are positive for a single antibody or a combination of multiple antibodies, including CD34 antibody, CD38 antibody, CD4 antibody, CD8 antibody, CD56 antibody, CD14 antibody and / or CD19 antibody.

[0017] Labeling bone marrow mononuclear cells using markers of different cell lineages includes: adding antibodies (such as CD34 antibody, CD38 antibody, CD4 antibody, CD8 antibody, CD56 antibody, CD14 antibody and / or CD19 antibody, etc.) to the bone marrow and / or peripheral blood mononuclear cells for incubation and labeling.

[0018] The method for identifying B19V multilineage cell infection described herein, when applied to determining therapeutic targets for B19V infection, is also within the scope of protection of this invention.

[0019] The method for identifying B19V multilineage cell infections, when applied to guide the preparation of drugs for treating B19V infection diseases, is also within the scope of protection of this invention.

[0020] In this invention, the sample is a cell sample.

[0021] The reagents and kits for detecting B19V infection of the present invention can be used to simultaneously detect the B19V infection status of multiple cell lineages in the same sample, achieving precise localization of B19V-positive cells. The reagents and kits for detecting B19V infection of the present invention have the following advantages: they can determine the transcriptional activity of B19V in the target cell population, thus determining viral activity; they can simultaneously detect the B19V infection status of multiple cell lineages in the same sample; after obtaining cells, detection results can be obtained in as little as 12 hours; and they can be combined with flow cytometry to obtain the target cell subpopulation infected with B19V.

[0022] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0023] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0024] Figure 1 The test results are for healthy donor 1. A. NK cell sorting and detection results of NK cells infected with B19V; B. CD34+CD38- HSC cell sorting and detection results of CD34+CD38- HSC cells infected with B19V; C. CD4+ T cells, CD8+ T cells sorting and detection results of CD4+ T cells and CD8+ T cells infected with B19V.

[0025] Figure 2 The results are for Patient 1 infected with B19V. A. NK cell sorting and detection results of NK cells infected with B19V; B. CD34+CD38- HSC cell sorting and detection results of CD34+CD38- HSC cells infected with B19V; C. CD4+ T cells and CD8+ T cells sorting and detection results of CD4+ T cells and CD8+ T cells infected with B19V.

[0026] Figure 3The test results for healthy donor 2 are as follows: A. NK cell sorting and detection results of NK cells infected with B19V; B. CD34+CD38- HSC cell sorting and detection results of CD34+CD38- HSC cells infected with B19V; C. CD4+ T cells, CD8+ T cells sorting and detection results of CD4+ T cells and CD8+ T cells infected with B19V.

[0027] Figure 4 The results are for Patient 2 infected with B19V. A. NK cell sorting and detection results of NK cells infected with B19V; B. CD34+CD38- HSC cell sorting and detection results of CD34+CD38- HSC cells infected with B19V; C. CD4+ T cells and CD8+ T cells sorting and detection results of CD4+ T cells and CD8+ T cells infected with B19V.

[0028] Figure 5 The test results for healthy donor 3 are as follows: A. NK cell sorting and detection results of NK cells infected with B19V; B. CD34+CD38- HSC cell sorting and detection results of CD34+CD38- HSC cells infected with B19V; C. CD4+ T cells, CD8+ T cells sorting and detection results of CD4+ T cells and CD8+ T cells infected with B19V.

[0029] Figure 6 The results are for patient 3 infected with B19V. A. NK cell sorting and detection results of NK cells infected with B19V; B. CD34+CD38- HSC cell sorting and detection results of CD34+CD38- HSC cells infected with B19V; C. CD4+ T cells and CD8+ T cells sorting and detection results of CD4+ T cells and CD8+ T cells infected with B19V.

[0030] Figure 7 The test results for healthy donor 4 are as follows: A. NK cell sorting and detection results of NK cells infected with B19V; B. CD34+CD38- HSC cell sorting and detection results of CD34+CD38- HSC cells infected with B19V; C. CD4+ T cells, CD8+ T cells sorting and detection results of CD4+ T cells and CD8+ T cells infected with B19V.

[0031] Figure 8The results are for patient 4 infected with B19V. A. NK cell sorting and detection results of NK cells infected with B19V; B. CD34+CD38- HSC cell sorting and detection results of CD34+CD38- HSC cells infected with B19V; C. CD4+ T cells and CD8+ T cells sorting and detection results of CD4+ T cells and CD8+ T cells infected with B19V. Detailed Implementation

[0032] In this document, unless otherwise defined herein, terms should be understood according to their common usage by those skilled in the art. Examples of resources describing many of the molecular biology-related terms used herein can be found in the following references: Alberts et al., Molecular Biology of The Cell, 5th ed., Garland Science Publishing, Inc.: New York, 2007; Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed., Springer-Verlag: New York, 1991; King et al., A Dictionary of Genetics, 6th ed., Oxford University Press: New York, 2002; and Lewin, GenesIX, Oxford University Press: New York, 2007.

[0033] Unless otherwise stated, the terms “nucleic acid,” “nucleotide,” and “polynucleotide” cover both DNA and RNA.

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are commercially available.

[0035] BD Horizon™ Brilliant Stain Buffer Plus (Flow Cytometry Staining Buffer): BD Biosciences product, catalog number 566385; PrimeFlow RNA Assay Kit: A Thermo Fisher product, catalog number 88-18005; This kit contains PrimeFlow® RNA Fixation Buffer 1A and 1B, PrimeFlow® RNA Wash Buffer, PrimeFlow® RNA Permeabilization Buffer, RNase Inhibitors, PrimeFlow® RNA Fixation Buffer 2, PrimeFlow® RNA Target Probe Diluent, PrimeFlow® RNAPreAmp Mix, PrimeFlow® RNA Amp Mix, and PrimeFlow® RNA Label Probes.

[0036] Recombinant Anti-CD34 antibody: BD Biosciences product, catalog number 740081; Recombinant Anti-CD38 antibody: Biolegend product, catalog number 303531; Recombinant Anti-CD4 antibody: Biolegend product, catalog number 357417; Recombinant Anti-CD8 antibody: BD Biosciences product, catalog number 563919; Recombinant Anti-CD56 antibody: BD Biosciences product, catalog number 612766.

[0037] In the following examples, the clinical diagnostic methods for B19V infection in each subject were as follows: A B19V-DNA detection kit (Liferiver) was used. TM (#OD-0026-02) Detects peripheral blood Ct values ​​less than 38, indicating B19V infection; Ct values ​​greater than or equal to 38 indicate no B19V infection.

[0038] Example 1: Preparation of a kit for detecting B19V infection in multiple cell lineages in the same sample. This embodiment provides a kit for detecting B19V infection in multiple cell lineages in the same sample, which contains a probe for recognizing B19V, named B19V-P.

[0039] B19V-P is a double-Z strand probe. SEQ ID No. 1 shows the target sequence, where the bolded portion is the Label (ZZ) oligonucleotide sequence, adjacent sites are closely spaced, and the underlined portion is the blocking oligonucleotide sequence to prevent non-specific binding or interference. The specific sequence is as follows: atgagtaaagaaagtggcaaatggtgggaaagtgatgatgaatttgctaaagctgtgtatcagcaatttgtggaattttatgaaaaggttactggaac agacttagagcttattcaaatattaaaaga tcattataatatttctttagataatcccctagaaaacccatcctctctgtttgacttagttgctcgcattaaaaataaccttaaaaattctccagacttatatagtc atcattttcaaagtcatggacagttatctgaccacccccatgcc ttatcatccagtagcagtcatgcagaacctagaggagaagatgcagtattatctagtgaagacttacacaagcctgggcaagttagcgtacaactacccggtactaactatgttgggc ctggcaatgagctacaagctgggcccccgcaaagtgctgttgacagtgctgcaaggattcatgactttaggtatagccaactggctaagttgggaataaatccatatactcattggac tgtagcaga tgaagagcttttaaaa aatataaaaaatgaaactgggtttca agcacaagtagtaaaagactactttacttt aaaaggtgcagctgcccctgtggcccattttcaaggaagtttgccggaagttcccgcttacaacgcctcagaaaaatacccaagcatgacttca (SEQ ID No. 1).

[0040] Example 2: Establishment of a method for detecting B19V infection using the kit from Example 1 The steps for detecting B19V infection using the kit from Example 1 are as follows: 1. Sample Preparation: Bone marrow mononuclear cells (BMMCs) were extracted from the subjects, and the cell concentration was adjusted to 1×10⁻⁶ using flow cytometry staining buffer (BD Horizon™ Brilliant Stain Buffer Plus). 6 Up to 5×10 6 Cells / mL, surface antibody staining was performed using recombinant Anti-CD34 antibody, recombinant Anti-CD38 antibody, recombinant Anti-CD4 antibody, recombinant Anti-CD8 antibody, and recombinant Anti-CD56 antibody, and incubated at 2-8℃ for 30 minutes; 2. Cell fixation: Mix PrimeFlow® RNA Fixation Buffer 1A and 1B in a 1:1 ratio to prepare 1 mL of fixative. Add the fixative to each sample, mix gently, and incubate at 2-8°C for 30 minutes. 3. Washing: Remove fixative by centrifugation and wash cells with PrimeFlow® RNA Wash Buffer to ensure removal of impurities; 4. Permeabilize the cell membrane: After centrifugation, remove the supernatant, then add 1 mL of PrimeFlow® RNA Permeabilization Buffer and RNase Inhibitors, mix gently, and centrifuge twice. This is to allow the probe to penetrate the cell membrane. 5. If it is necessary to detect intracellular proteins (such as cytokines, transcription factors, etc.), antibody staining can be performed on permeabilized cells. In this case, use fluorescently labeled antibodies that specifically bind to the target protein and incubate at 2-8℃ for 30 minutes. 6. Wash cells twice with PrimeFlow® RNA Permeabilization Buffer (containing RNase inhibitors) to remove excess antibodies and impurities; 7. Add PrimeFlow® RNA Fixation Buffer 2 to the cells and incubate at room temperature for 60 minutes; 8. Wash the cells with PrimeFlow® RNA Wash Buffer to remove unnecessary reagents, and suspend the cells in 100 μL PrimeFlow® RNA Target Probe Diluent to obtain a cell suspension; 9. Dilute the target probe B19V-P to 2μM to obtain B19V-P stock solution, and ensure that 100 nM of B19V-P probe is added to each sample in the end; 10. Add 5 µL of B19V-P stock solution to the cell suspension obtained in step 8, mix gently, and incubate at 40°C for 2 hours for hybridization; 11. After hybridization, add 1 mL of PrimeFlow® RNA Wash Buffer, centrifuge for 5 minutes at 800 g, remove the supernatant, and resuspend the cells in the remaining liquid. Repeat this step once to ensure that the hybridization reaction completely removes unbound probes; 12. Add PrimeFlow® RNA PreAmp Mix, mix gently, and incubate at 40°C for 1.5 hours. The pre-amplification step lays the foundation for signal amplification; repeat step 11 three times to ensure complete removal of PrimeFlow® RNA PreAmp Mix components, and retain 50 μL of wash buffer (i.e., PrimeFlow® RNA Wash Buffer) after the final wash and centrifugation. 13. Add PrimeFlow® RNA Amp Mix to the sample, mix gently, and incubate at 40°C for 1.5 hours. This step will greatly enhance the signal of the target RNA; repeat step 11 twice to ensure complete removal of PrimeFlow® RNA Amp Mix components, and retain 50 μL of wash buffer (i.e., PrimeFlow® RNA Wash Buffer) after the final wash and centrifugation. 14. Add the diluted PrimeFlow® RNA Label Probes to the sample and incubate at 40°C for 1 hour. The fluorescently labeled probes will bind to the amplified target RNA, generating a detectable fluorescent signal; 15. Wash cells with PrimeFlow® RNA Wash Buffer to remove excess labeled probes and ensure that the signal in the sample comes only from the target RNA; 16. After sample preparation, transfer to a flow cytometer and analyze using a suitable laser (488 nm, 561 nm, 633-640 nm) to detect different RNA targets in the cells. Use appropriate filters (such as 530 / 30, 610 / 20, 660 / 20, etc.) for data collection.

[0041] Example 3: Detection of B19V infection in patient 1 using the method of Example 2 One clinically diagnosed B19V emia patient (referred to as B19V infected patient 1) and one uninfected healthy donor (referred to as healthy donor 1) were selected as subjects. The method in Example 2 was used to simultaneously detect CD34+CD38- HSC cells, CD4+ T cells, CD8+ T cells, NK cells (using CD56 as a marker) and B19V.

[0042] Results of healthy donor 1 and B19V-infected patient 1 are shown in Figure 1 and Figure 2Flow cytometry analysis determined infection rates to be ≥1% and non-infection rates to be <1%. No B19V was detected in CD34+CD38- HSC cells, CD4+ T cells, CD8+ T cells, or NK cells of healthy donor 1. B19V was detected in all CD34+CD38- HSC cells, CD4+ T cells, and NK cells of B19V-infected patient 1, while CD8+ T cells were uninfected.

[0043] Example 4: Detection of B19V-infected patients using the method of Example 2 One B19V-infected patient (referred to as B19V-infected patient 2) and one uninfected healthy donor (referred to as healthy donor 2) were used as subjects. The method in Example 2 was used to simultaneously detect CD34+CD38- HSC, CD4+ T, CD8+ T, NK and B19V.

[0044] Results of healthy donor 2 and B19V-infected patient 2 are shown in Figure 3 and Figure 4 Flow cytometry analysis determined infection rates to be ≥1% and non-infection rates to be <1%. No B19V was detected in CD34+CD38- HSC cells, CD4+ T cells, CD8+ T cells, or NK cells of healthy donor 2. B19V was detected in CD34+CD38- HSC cells, CD4+ T cells, and NK cells of B19V-infected patient 2, but not in CD8+ T cells.

[0045] Example 5: Detection of B19V-infected patients using the method of Example 2 (3) One B19V-infected patient (referred to as B19V-infected patient 3) and one uninfected healthy donor (referred to as healthy donor 3) were used as subjects. The method in Example 2 was used to simultaneously detect CD34+CD38- HSC, CD4+ T, CD8+ T, NK and B19V.

[0046] Results of healthy donor 3 and B19V-infected patient 3 are shown in Figure 5 and Figure 6 Flow cytometry analysis determined infection rates to be ≥1% and non-infection rates to be <1%. No B19V was detected in CD34+CD38- HSC cells, CD4+ T cells, CD8+ T cells, or NK cells of healthy donor 3. B19V was detected in CD34+CD38- HSC cells and CD4+ T cells of B19V-infected patient 3, while NK cells and CD8+ T cells were not infected with B19V.

[0047] Example 6: Detection of B19V-infected patients using the method of Example 2 (4 patients) One B19V-infected patient (referred to as B19V-infected patient 4) and one uninfected healthy donor (referred to as healthy donor 4) were used as subjects. The method in Example 2 was used to simultaneously detect CD34+CD38- HSC, CD4+ T, CD8+ T, NK and B19V.

[0048] Results of healthy donor 4 and B19V-infected patient 4 are shown in Figure 7 and Figure 8 Flow cytometry analysis determined infection rates to be ≥1% and non-infection rates to be <1%. No B19V was detected in CD34+CD38- HSC cells, CD4+ T cells, CD8+ T cells, or NK cells of healthy donor 3. B19V was detected in CD34+CD38- HSC cells and CD4+ T cells of B19V-infected patient 3, while NK cells and CD8+ T cells were not infected with B19V.

[0049] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A device for detecting B19V-infected cell lineages, characterized in that: The device includes a pretreatment module, a cell sorting module, a B19V detection module, and an analysis module. The preprocessing module is used to obtain bone marrow and / or peripheral blood mononuclear cells from the subject's ex vivo samples; The cell sorting module is used to label bone marrow and / or peripheral blood mononuclear cells with markers of different cell lineages; The B19V detection module is used to detect B19V in bone marrow and / or peripheral blood mononuclear cells; the B19V detection is performed using a reagent for detecting B19V infection, the reagent for detecting B19V infection contains a B19V probe, the B19V probe being the single-stranded DNA shown in SEQ ID No. 1; The analysis module determines the cell lineage infected with B19V based on the results of the B19V detection module and the cell sorting module.

2. The apparatus according to claim 1, characterized in that: The cell lineage is a subpopulation of cells that are positive for a single antibody or a combination of multiple antibodies, including CD34 antibody, CD38 antibody, CD4 antibody, CD8 antibody, and CD56 antibody.

3. The apparatus according to claim 1 or 2, characterized in that: The reagent used to detect B19V infection also contains CD34 antibody, CD38 antibody, CD4 antibody, CD8 antibody and / or CD56 antibody.

4. The reagent for detecting B19V infection as described in any one of claims 1-3.

5. A kit for detecting B19V infection, characterized in that: The kit contains the reagent of claim 4.

6. Any of the following applications of the reagent of claim 4 or the kit of claim 5: X1) Preparation and identification of B19V-infected cell lineages; X2) Prepare products that identify therapeutic targets for B19V infection; X3) Guide the preparation of drugs for treating B19V infection; X4) Products for preparing and detecting B19V infection samples; X5) Prepare products for detecting B19V infection in multiple cell lineages in the same sample; X6) Prepare products that can distinguish different B19V infection statuses in the same sample; X7) Prepare B19V positive cell localization products from ex vivo samples.

7. A method for identifying B19V multilineage cell infection, characterized in that: The method includes: (a) Extracting bone marrow and / or peripheral blood mononuclear cells from the subject's ex vivo samples; (b) Marking bone marrow and / or peripheral blood mononuclear cells using markers of different cell lineages; (c) Using the B19V probe described in claim 1, hybridization is performed to determine B19V-infected cells; (d) Flow cytometry was used to detect B19V-infected cell lineages to obtain information on B19V multi-lineage cell infection.

8. The method according to claim 7, characterized in that: The cell lineage is a subpopulation of cells that are positive for a single antibody or a combination of multiple antibodies, including CD34 antibody, CD38 antibody, CD4 antibody, CD8 antibody, and CD56 antibody.

9. The use of the method of claim 7 or 8 in identifying therapeutic targets for B19V infection.

10. Use of the method of claim 7 or 8 in guiding the preparation of a medicament for treating B19V infection.

Images