Broad-spectrum saline-alkaline tolerant preristeria sp. And application thereof

Abstract

The invention discloses a broad-spectrum saline-alkaline tolerant preristeria sp. Strain and an application of the broad-spectrum saline-alkaline tolerant preristeria sp. The invention provides the P.megaterium or a progeny of the P.megaterium, the P.megaterium is the P.megaterium, the strain number of the P.megaterium is HA22ALE, and the registration number of the P.megaterium in the China General Microbiological Culture Collection Center is CGMCC (China General Microbiological Culture Collection Center) No. 36160. The strain HA22ALE provided by the invention has broad-spectrum salt and alkali tolerance, can normally grow under the conditions of 11.0% of sodium chloride, 7.0% of sodium sulfate and pH of 6.0-11.0, has growth promoting characteristics of indoleacetic acid production, potassium dissolving capacity and the like, and can inhibit the growth of plant pathogenic fungus fusarium oxysporum. Under the stress of salt and alkali, the strain can be effectively colonized in the rhizosphere of a plant, and the germination rate and biomass of soybeans and corns are remarkably improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, in particular to a broad-spectrum salt-tolerant and alkali-tolerant Pristinamycete and application thereof. BACKGROUND

[0002] There are mainly three types of saline-alkali soil, including coastal saline-alkali soil, inland saline-alkali soil and soda saline-alkali soil. The coastal saline-alkali soil mainly contains sodium chloride, the inland saline-alkali soil mainly contains sodium sulfate, and the soda saline-alkali soil has low salt content but high pH, and the salt mainly includes sodium carbonate and sodium bicarbonate. In recent years, with the gradual expansion of the area of land salinization, the growth and development of plants are seriously affected, and therefore, it is currently an urgent task to solve the problem of plant growth and development under salt stress for the treatment of saline-alkali soil.

[0003] Microbial improvement of saline-alkali soil has the advantages of environmental friendliness and simple operation, and has great application and development potential. Among microorganisms, there is a kind of plant growth promoting rhizobacteria (PGPR) which can exist in the rhizosphere soil of plants, inhibit plant diseases and promote plant growth. The plant growth promoting rhizobacteria can directly secrete plant hormones, increase soil nutrients and promote plant growth and development, such as producing ACC deaminase, IAA, nitrogen fixation, phosphorus dissolution, potassium dissolution, iron carrier production, etc., and can also indirectly inhibit pathogenic bacteria and compete with pathogenic bacteria to promote plant growth.

[0004] Although PGPR can promote plant growth by secreting plant hormones, activating soil nutrients and other ways, its activity is often inhibited in high salt-alkali stress environment, and the application effect of the strain is often greatly discounted or even completely disappeared. In addition, in recent years, the research on salt-tolerant and alkali-tolerant PGPR mainly focuses on sodium chloride and sodium sulfate conditions, and there are few studies on sodium carbonate-sodium bicarbonate conditions, the application range of the strain is single, and there is a lack of broad-spectrum salt-tolerant and alkali-tolerant strain which can tolerate three types of salt-alkali including sodium chloride, sodium sulfate and sodium carbonate-sodium bicarbonate. Therefore, screening of broad-spectrum salt-tolerant and alkali-tolerant PGPR is of great significance for promoting plant growth under salt-alkali conditions. SUMMARY

[0005] The purpose of the present application is to provide a broad-spectrum salt-tolerant and alkali-tolerant Pristinamycete and application thereof.

[0006] In a first aspect, the present application claims a Pristinia megaterium or its offspring.

[0007] The Pristinia megaterium claimed in the present application is Pristinia megaterium (P. Priestia megaterium pncA), and its strain number is HA22ALE, and its registration number in China General Microbiological Culture Collection Center is CGMCC No. 36160.

[0008] The colony characteristics and cell morphology of the provided P. megaspora HA22ALE are as follows: the colony is beige, regular round, convex, smooth and viscous.

[0009] The provided P. megaspora HA22ALE is obtained by continuously adapting the starting strain HA22 for 175 times in a culture medium containing sodium sulfate and high pH. It can grow normally under the condition of 110 g / L sodium chloride, 70 g / L sodium sulfate and pH 6.0-11.0. The determination of its physiological and biochemical characteristics shows that the strain can produce indole acetic acid and has the ability to decompose potassium. Through the plate confrontation experiment, it is found that the strain can inhibit the growth of the plant pathogenic fungus Fusarium oxysporum and has the potential to prevent pathogenic fungi.

[0010] The provided P. megaspora HA22ALE is a strain after adaptation, compared with the strain before adaptation, it has nicotine amide enzyme / purine amide enzyme ddpF , dipeptide transport ATP binding protein ddpC , dipeptide transport system permease protein ugpB , sn-glycerol-3-phosphate transport system substrate binding protein Priestia megaterium mutation. The pncA the 163rd methionine M is mutated to isoleucine I, the ddpF the 60th serine S is mutated to proline P, the ddpC the 147th arginine R is mutated to histidine H, and the ugpB the 70th glutamic acid E is mutated to glycine G.

[0011] In a second aspect, the present application claims a composition containing the P. megaspora or its offspring as described in the first aspect above.

[0012] Further, the composition can be a culture, which is a substance obtained by culturing the P. megaspora or its offspring as described in the first aspect above in a microbial culture medium (all substances in the culture container, i.e. fermentation product, such as the P. megaspora or its offspring and the substances secreted into the liquid culture medium, i.e. fermentation broth, or such as the P. megaspora or its offspring and the substances secreted into the solid culture medium, i.e. solid fermentation product).

[0013] The microbial culture medium can be a bacterial culture medium. The bacterial culture medium can be a solid culture medium or a liquid culture medium.

[0014] In the above-mentioned culture, the substance comprises the P. magnus or its progeny (the microorganism itself) and / or its metabolite as described in the first aspect above.

[0015] The term "metabolite" refers to primary metabolites and / or secondary metabolites produced in the process of microbial metabolism. Primary metabolism refers to the process in which microorganisms absorb various nutrients from the outside world, through catabolism and anabolism, to generate substances and energy to maintain life activities. The product of primary metabolism is the primary metabolite, such as monosaccharides or monosaccharide derivatives, nucleotides, vitamins, amino acids, fatty acids, and various macromolecular polymers composed of them, such as proteins, nucleic acids, polysaccharides, and lipids. Secondary metabolism refers to the process in which microorganisms synthesize some substances that have no clear function for life activities of microorganisms using primary metabolites as precursors during a certain growth period. The product of secondary metabolism is the secondary metabolite, which is mostly a compound with a complex molecular structure. According to its function, it can be divided into antibiotics, hormones, alkaloids, and toxins.

[0016] The term "culture" refers to the collective term for liquid or solid culture medium inoculated and cultured by humans and grown with microbial populations. That is, the product obtained by growing and / or amplifying microorganisms, which can be a biologically pure culture of microorganisms, or can contain a certain amount of culture medium, metabolites, or other components produced during the culture process. The term "culture" also includes subcultures obtained by subculturing microorganisms, which can be a culture of a certain generation or a mixture of several generations.

[0017] Further, the composition can be a microbial inoculant or a microecological preparation or a biofertilizer.

[0018] In the above-mentioned microbial inoculant or microecological preparation or biofertilizer, the active ingredient of the microbial inoculant or microecological preparation or biofertilizer can be the P. magnus or its progeny, the metabolite of the P. magnus or its progeny, and / or the culture of the P. magnus or its progeny as described in the first aspect above, and the active ingredient of the microbial inoculant or microecological preparation or biofertilizer can also contain other biological components or / and non-biological components. The other active ingredients of the microbial inoculant or microecological preparation or biofertilizer can be determined by those skilled in the art according to the desired effect.

[0019] The bacterial agent or microecological preparation or bio-fertilizer can further comprise a carrier in addition to the active ingredient. The carrier can be a carrier commonly used in the field of pesticides and biologically inert. The carrier can be a solid carrier or a liquid carrier; the solid carrier can be a mineral material, a plant material or a high molecular compound; the mineral material can be at least one of clay, talc, kaolin, montmorillonite, white carbon, zeolite, silica and diatomite; the plant material can be at least one of wheat flour, soybean flour and starch; the high molecular compound can be polyvinyl alcohol and / or polyglycol; the liquid carrier can be an organic solvent, a vegetable oil, a mineral oil or water; the organic solvent can be decane and / or dodecane.

[0020] The bacterial agent or microecological preparation or bio-fertilizer can be in various dosage forms, such as liquid, emulsion, suspension, powder, granule, wettable powder or water dispersible granule.

[0021] The bacterial agent or microecological preparation or bio-fertilizer can further comprise a surfactant (such as Tween 20, Tween 80, etc.), a binder, a stabilizer (such as an antioxidant), a pH regulator, etc. as needed.

[0022] The bacterial agent or microecological preparation or bio-fertilizer can comprise the P. putida or its progeny or / and the metabolite of the P. putida or its progeny in the form of cultured living cells, fermentation broth of living cells, filtrate of cell culture or mixture of cells and filtrate.

[0023] Herein, the metabolite of the P. putida or its progeny can be obtained from the fermentation broth of the P. putida or its progeny. The metabolite of the P. putida or its progeny can be a sterile metabolite of the P. putida or its progeny or a bacterial-containing metabolite of the P. putida or its progeny. The sterile metabolite of the P. putida or its progeny (sterile fermentation filtrate) can be prepared by culturing the P. putida or its progeny in a liquid medium and filtering to remove the P. putida or its progeny in the liquid culture (fermentation broth), thereby obtaining the sterile metabolite of the P. putida or its progeny. The bacterial-containing metabolite of the P. putida or its progeny can be prepared by culturing the P. putida or its progeny in a liquid fermentation medium and collecting the fermentation broth containing the P. putida or its progeny and substances secreted into the liquid medium, which is the bacterial-containing metabolite of the P. putida or its progeny.

[0024] Further, the composition has at least one of the following properties: A1) resistant to 110 g / L sodium chloride; A2) tolerance to 70 g / L sodium sulfate; A3) tolerance to pH 6-11; A4) IAA production; A5) potassium mobilization; A6) inhibition of Fusarium oxysporum; A7) control of plant diseases caused by Fusarium oxysporum infection; A8) alleviation of plant salt stress; A9) promotion of plant growth.

[0025] In a third aspect, the present application claims the use of the P. megaspora of the first aspect above or its progeny or the composition of the second aspect above for any one of the following: B1) use in inhibiting Fusarium oxysporum or in the manufacture of a product for inhibiting Fusarium oxysporum; B2) use in controlling plant diseases caused by Fusarium oxysporum infection or in the manufacture of a product for controlling plant diseases caused by Fusarium oxysporum infection; B3) use in alleviating plant salt stress or in the manufacture of a product for alleviating plant salt stress; B4) use in promoting plant growth or in the manufacture of a product for promoting plant growth.

[0026] In a fourth aspect, the present application claims any one of the following methods: Method I: a method for alleviating plant salt stress, comprising the step of treating a plant to be treated or its growth substrate with the P. megaspora of the first aspect above or its progeny or the composition of the second aspect above, thereby alleviating the salt stress of the plant.

[0027] Method II: a method for promoting plant growth, comprising the step of treating a plant to be treated or its growth substrate with the P. megaspora of the first aspect above or its progeny or the composition of the second aspect above, thereby promoting the growth of the plant.

[0028] Method III: a method for inhibiting Fusarium oxysporum, comprising the step of applying the P. megaspora of the first aspect above or its progeny or the composition of the second aspect above to Fusarium oxysporum, a plant suspected of carrying Fusarium oxysporum or a plant growing environment suspected of having Fusarium oxysporum, thereby inhibiting Fusarium oxysporum.

[0029] Method IV: A method for preventing and treating plant diseases caused by Fusarium oxysporum infection, comprising the following steps: applying the P. megaspora or its offspring described in the first aspect or the composition described in the second aspect to a plant infected by Fusarium oxysporum or its growth substrate, so as to prevent and treat plant diseases caused by Fusarium oxysporum infection.

[0030] In the above-mentioned related aspects, the plant growth promotion can be under normal conditions or under saline-alkali stress conditions.

[0031] Further, the saline-alkali stress can be any one of the following: (a1) sodium chloride stress; (a2) sodium sulfate stress; (a3) sodium carbonate-sodium bicarbonate stress.

[0032] In some embodiments of the present application, the saline-alkali stress is 12 g / L sodium chloride stress. In some embodiments of the present application, the saline-alkali stress is 15 g / L sodium sulfate stress. In some embodiments of the present application, the saline-alkali stress is 12 g / L sodium carbonate-sodium bicarbonate stress (wherein 12 g / L is the sum of the concentrations of sodium carbonate and sodium bicarbonate, and the mass ratio of sodium carbonate to sodium bicarbonate is 1:9).

[0033] In the above-mentioned related aspects, the plant growth promotion can be at least one of the following: improving seed germination rate, promoting root elongation, promoting plant height enhancement, promoting aboveground fresh weight and / or dry weight increase, promoting underground fresh weight and / or dry weight increase, promoting nodule number increase, and promoting nodule fresh weight increase.

[0034] In the above-mentioned related aspects, the plant can be any one of the following: C1) angiosperms; C2) monocotyledonous plants or dicotyledonous plants; C3) plants of the order Poales or plants of the order Fabales; C4) plants of the family Poaceae or plants of the family Fabaceae; C5) plants of the genus Zea or plants of the genus Glycine; C6) corn or soybeans.

[0035] In some embodiments of the present application, the plant is corn. In other embodiments of the present application, the plant is soybean.

[0036] The present application has the following advantages: 1. The present application provides a broad-spectrum salt-tolerant and alkali-tolerant bacterial strain, P. megaspora, Priestia megaterium Priestia megateriumHA22ALE can be used as a clean, pollution-free, and environmentally friendly microbial agent, and has broad application prospects in the sustainable agricultural production of soybeans and corn.

[0037] 2. The broad-spectrum salt-tolerant strain provided by this invention—Priestella megaterium ( Priestia megaterium Priestia megaterium HA22ALE can increase the germination rate of soybeans and corn by 11.77% and 23.33% respectively under 12g / L sodium chloride conditions; by 13.24% and 25.00% respectively under 15g / L sodium sulfate conditions; and by 28.33% and 34.62% respectively under 12g / L sodium carbonate-sodium bicarbonate conditions.

[0038] 3. The broad-spectrum salt-tolerant strain provided by this invention—Priestella megaterium ( Priestia megaterium Priestia megaterium HA22ALE can be used to promote plant growth under natural soil conditions under sodium chloride, sodium sulfate, and sodium carbonate-sodium bicarbonate stress. Under 12 g / L sodium chloride conditions, soybean biomass (above-ground dry weight) significantly increased by 36.69%; under 15 g / L sodium sulfate conditions, soybean biomass (above-ground dry weight) significantly increased by 29.55%; and under 12 g / L sodium carbonate-sodium bicarbonate conditions, soybean biomass (above-ground dry weight) significantly increased by 49.96%.

[0039] 4. The broad-spectrum salt-tolerant strain provided by this invention—Priestella megaterium ( Priestia megaterium Deposit Description HA22ALE can be effectively applied to promote the growth of plants under various saline-alkali conditions, and significantly improve the biomass of plants under various saline-alkali conditions. It is of great significance for addressing the problem of microbial saline-alkali stress faced by microorganisms in promoting the growth of plants under saline-alkali conditions.

[0040] Priestia megaterium Classification and nomenclature: Priestella megaterium ( Figure 1 ); Reference biological material (strain): HA22ALE; Preservation institution: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Cultures; The abbreviation for the depository institution is CGMCC. Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; Deposit date: October 13, 2025; Registration number at the Preservation Center: CGMCC No. 36160. Attached Figure Description

[0041] Priestia megaterium Priestella megaterium ( Figure 2 HA22ALE underwent 175 adaptive evolutions.

[0042] Priestia megaterium Priestella megaterium ( Figure 3 Colony morphology diagram of HA22ALE.

[0043] Priestia megaterium Priestella megaterium ( Priestia megaterium HA22 and Priestella megaterium ( Figure 4 Phylogenetic tree of HA22ALE.

[0044] Priestia megaterium Priestella megaterium ( Priestia megaterium HA22 and Priestella megaterium ( Figure 5 Growth of HA22ALE under conditions of 0 g / L to 110 g / L sodium chloride (a), 0 g / L to 70 g / L sodium sulfate (b), and pH 3.0 to pH 12.0 (c).

[0045] Priestia megaterium Priestella megaterium ( Priestia megaterium HA22 and Priestella megaterium ( Fusarium oxysporum HA22ALE against Fusarium oxysporum ( Priestia megaterium The antagonistic effect of ) was observed. Control represents the negative control, and WT represents *Priscilla megaterium* (…). Fusarium oxysporum HA22 against Fusarium oxysporum ( Priestia megaterium The antagonistic effect of ALE on Priestella megaterium; ALE indicates the presence of ALE in Priestella megaterium. Fusarium oxysporum Figure 6 HA22ALE against Fusarium oxysporum ( Priestia megaterium The antagonistic effect of ).

[0046] Priestia megaterium Priestella megaterium ( Figure 7 HA22 and Priestella megaterium ( Priestia megateriumThe effects of HA22ALE on soybean germination and growth under normal and saline-alkali stress conditions. Where: ad represents the growth-promoting effect of HA22 and HA22ALE on soybean under normal conditions (a) and salt-alkali stress conditions (bd; b: 1.2% sodium chloride, c: 1.5% sodium sulfate, d: 1.2% sodium carbonate-sodium bicarbonate, % all represent g / 100mL, the same below); in each treatment ad, the first column represents uninoculated strains, the second column represents inoculated strain HA22, and the third column represents inoculated strain HA22ALE; eh represents the effect of HA22 and HA22ALE on soybean germination rate under normal conditions (e) and salt-alkali stress conditions (fh; f: 1.2% sodium chloride, g: 1.5% sodium sulfate, h: 1.2% sodium carbonate-sodium bicarbonate), respectively. The data are mean ± standard deviation (n=4). Different letters in the data represent significant differences between different treatments in the group (Duncantest, P<0.05); i represents the effect of HA22 and HA22ALE on soybean root length under normal conditions. Data are presented as mean ± standard deviation (n = 6). Con indicates normal conditions (no stress treatment) and no inoculation with the strain. Different letters in the data indicate significant differences between different treatments within the same group (Duncantest, P < 0.05).

[0047] Priestia megaterium Priestella megaterium ( Figure 8 HA22 and Priestella megaterium ( Priestia megaterium The effects of HA22ALE on maize germination and growth under normal and saline-alkali stress conditions. Where: ad represents the growth-promoting effect of HA22 and HA22ALE on maize under normal conditions (a) and under salt-alkali stress conditions (bd; b: 1.2% sodium chloride, c: 1.5% sodium sulfate, d: 1.2% sodium carbonate-sodium bicarbonate, % all represent g / 100mL, the same below); in each treatment ad, the first column represents uninoculated strains, the second column represents inoculated strain HA22, and the third column represents inoculated strain HA22ALE; eh represents the effect of HA22 and HA22ALE on maize germination rate under normal conditions (e) and under salt-alkali stress conditions (fh; f: 1.2% sodium chloride, g: 1.5% sodium sulfate, h: 1.2% sodium carbonate-sodium bicarbonate), respectively. The data are mean ± standard deviation (n=4). Different letters in the data represent significant differences between different treatments in the group (Duncantest, P<0.05); i represents the effect of HA22 and HA22ALE on maize root length under normal conditions. Data are presented as mean ± standard deviation (n = 6). Con indicates normal conditions (no stress treatment) and no inoculation with the strain. Different letters in the data indicate significant differences between different treatments within the same group (Duncantest, P < 0.05).

[0048] Figure 9 Growth promotion of HA22ALE on soybean under 1.2% sodium chloride stress. a, b, c-j represent the effects of HA22, HA22ALE on soybean growth (a) and nodule (b), plant height (c), shoot fresh weight (d), shoot dry weight (e), root length (f), underground fresh weight (g), nodule number (h), nodule fresh weight (i), underground dry weight (j), respectively. CK represents the control without inoculation and stress treatment, Salt represents the control with 1.2% sodium chloride stress and without inoculation. Data are mean ± standard deviation (n = 10), different letters on the data represent significant differences between different treatments in the group (Duncan test, P < 0.05). Priestia megaterium

[0049] Growth promotion of HA22ALE on soybean under 1.5% sodium sulfate stress. a, b, c-j represent the effects of HA22, HA22ALE on soybean growth (a) and nodule (b), plant height (c), shoot fresh weight (d), shoot dry weight (e), root length (f), underground fresh weight (g), nodule number (h), nodule fresh weight (i), underground dry weight (j), respectively. CK represents the control without inoculation and stress treatment, Salt represents the control with 1.5% sodium sulfate stress and without inoculation. Data are mean ± standard deviation (n = 10), different letters on the data represent significant differences between different treatments in the group (Duncan test, P < 0.05). Figure 10 Priestia megaterium Growth promotion of HA22ALE on soybean under 1.2% sodium carbonate-sodium bicarbonate stress. a, b, c-j represent the effects of HA22, HA22ALE on soybean growth (a) and nodule (b), plant height (c), shoot fresh weight (d), shoot dry weight (e), root length (f), underground fresh weight (g), nodule number (h), nodule fresh weight (i), underground dry weight (j), respectively. CK represents the control without inoculation and stress treatment, Salt represents the control with 1.2% sodium carbonate-sodium bicarbonate stress and without inoculation. Data are mean ± standard deviation (n = 10), different letters on the data represent significant differences between different treatments in the group (Duncan test, P < 0.05).

[0050] Figure 1 Growth promotion of HA22ALE on soybean under 1.2% sodium carbonate-sodium bicarbonate stress. a, b, c-j represent the effects of HA22, HA22ALE on soybean growth (a) and nodule (b), plant height (c), shoot fresh weight (d), shoot dry weight (e), root length (f), underground fresh weight (g), nodule number (h), nodule fresh weight (i), underground dry weight (j), respectively. CK represents the control without inoculation and stress treatment, Salt represents the control with 1.2% sodium carbonate-sodium bicarbonate stress and without inoculation. Data are mean ± standard deviation (n = 10), different letters on the data represent significant differences between different treatments in the group (Duncan test, P < 0.05). Figure 2 DETAILED DESCRIPTION

[0051] ​​The application will be described in further detail below with specific reference to the embodiments. The examples given are merely for the purpose of illustrating the application and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0052] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0053] Example 1, isolation and purification of strains The sample was soybean, and the soybean root system was taken out as completely as possible. The plant roots were gently shaken to remove loose soil, leaving only the soil adhering to the root system. The root system was placed in PBS buffer with the addition of 0.02% Silwet L-77, and stirred with sterile tweezers to wash off the rhizosphere soil adhering to the soybean roots. The collected soil suspension was filtered with 8 layers of sterile gauze to remove plant debris and large particle precipitates, and transferred to a sterile centrifuge tube. The centrifuge tube was centrifuged at 3000 g for 5 min at 4°C, and the supernatant was discarded to obtain the rhizosphere soil sample. The rhizosphere soil sample was resuspended in PBS buffer, and glass beads were added. The mixture was shaken at 200 rpm for 10 min to obtain a soil suspension. The soil suspension was gradient diluted with a pipette to 10 -6 , 10 -4 , 10 -5 , 10 -6 Each 0.1 mL of the dilution was spread on an LB plate, and each concentration gradient was repeated three times, and the plates were incubated at 28°C upside down. After observing the growth of colonies, different bacteria were picked according to the color, morphology, and size of the colonies, and four-zone streaking was performed on LB plates. After two times of streaking and purification, strain HA22 was obtained. The purified strain HA22 was inoculated into LB liquid medium for activation, and incubated at 28°C at 200 rpm overnight. 500 μL of the bacterial solution was mixed with 500 μL of 60% sterile glycerol in a bacterial preservation tube, and the mixture was thoroughly mixed and stored at -80°C.

[0054] Example 2, obtaining a broad-spectrum salt-tolerant strain HA22ALE through adaptive evolution 1. Adaptive evolution With strain HA22 as the starting strain, with the addition of 15 g / L sodium sulfate, using sodium carbonate-sodium bicarbonate buffer solution to adjust the pH to 8.0 in 1 / 10 TSB liquid medium (formula: casein 1.7 g, soybean peptone 0.3 g, sodium chloride 0.5 g, potassium phosphate 0.25 g, glucose 0.25 g, sodium sulfate 15 g, agar 20 g, distilled water 1 L, using sodium carbonate-sodium bicarbonate buffer solution to adjust the pH to 8.0) as the starting medium for subculture, by increasing the concentration of sodium sulfate in the medium and the pH, the salt and alkali tolerance of the strain is gradually improved, and the salt and alkali tolerant evolved strain HA22ALE is obtained, the specific steps are as follows: (1) 20 μL from the glycerol tube (stored at -80°C refrigerator) was inoculated on 1 / 10 TSB solid medium, and incubated at 28°C for 24 h.

[0055] (2) The activated strain was inoculated with a loop into 5 mL of 1 / 10 TSB liquid medium, and incubated at 28°C, 200 rpm for 12 h to prepare the seed liquid.

[0056] (3) The seed liquid was transferred to 50 mL (150 mL conical flask) of 1 / 10 TSB liquid medium containing 15 g / L, using sodium carbonate-sodium bicarbonate buffer solution to adjust the pH to 8.0, with a 1% inoculation amount for subculture, and the culture conditions were 28°C, 200 rpm.

[0057] (4) After 24 h of culture, 0.5 mL of bacterial liquid was transferred to 50 mL (150 mL conical flask) of 1 / 10 TSB liquid medium containing 15 g / L, using sodium carbonate-sodium bicarbonate buffer solution to adjust the pH to 8.0, for further subculture evolution.

[0058] (5) In this way, the evolution and subculture process was repeated. When the strain could grow stably and rapidly in the evolution medium at this concentration, the concentration of sodium sulfate in the medium was further increased (1.8% Na2SO4, 2.0% Na2SO4, 3.0% Na2SO4, 3.5% Na2SO4, 4.0% Na2SO4, wherein % represents g / 100 mL) and the pH (8.5, 9.0, 9.5, 9.7, 10.0) was increased, and the above operation was repeated.

[0059] As shown in Figure 3 , through adaptive evolution, the salt and alkali tolerant strain HA22ALE was obtained. After 175 generations, the strain grew in an evolution medium of 40 g / L sodium sulfate, pH 10.0, and the OD 600 at 24 h reached 0.69, with excellent salt and alkali tolerance.

[0060] 2. Identification of strains (1) Identification of microbiological characteristics Strain HA22ALE appears as pale yellow, round, moist colonies on 1 / 10 TSB plates. pncA Gram-positive bacteria, aerobic, spore-forming, rod-shaped; can produce IAA and has potassium-solubilizing ability.

[0061] (2) Detection of 16S rRNA gene sequence Genomic DNA was extracted from bacterial strains using the TIANamp Bacteria DNA Kit. Using the bacterial genomic DNA as a template, the 16S rRNA gene sequence of the bacteria was amplified using primers 27F: GAGAGTTGATCCTGGCTCAG and 1492R: CTACGGCTACCTTGTTACGA. The PCR products were sent to Sangon Biotech Co., Ltd. for sequencing, and the obtained sequences were submitted to NCBI (https: / / www.ncbi.nlm.nih.gov / ) for BLAST alignment analysis. Phylogenetic analysis was performed based on the alignment results. ddpF The strains HA22 and HA22ALE were identified as belonging to the genus *Priscilla*. The 16S rRNA gene sequence of strain HA22 is shown in SEQ ID NO:1, and the 16S rRNA gene sequence of strain HA22ALE is shown in SEQ ID NO:2.

[0062] (3) Whole genome sequencing Bacterial cells were collected and sent to Shanghai Meiji Biotechnology Co., Ltd. for whole-genome sequencing. The raw sequencing data underwent quality assessment using FastQC, and the Illumina raw data was quality-optimized to obtain relatively accurate and effective data. The nucmer program of the MUMmer alignment software (Version 3.23, http: / / mummer.sourceforge.net / ) was used to detect the target genome against the reference genome, and the show-snps function was used to generate snps and small indels (<50bp). The snpEff (http: / / snpeff.sourceforge.net / SnpEff.html) tool was used to annotate variant sites based on the positional relationships and interactions between SNPs and genes.

[0063] Compared to HA22, strain HA22ALE, through adaptive evolution, possesses nicotinamide / pyrazinamide enzymes. ddpC Dipeptide transporter ATP-binding protein ugpB Dipeptide transport system permease protein pncAsn-glycerol 3-phosphate transport system substrate-binding protein ddpF mutated. Among them ddpC the 163rd amino acid is mutated from methionine M to isoleucine I, ugpB the 60th amino acid is mutated from serine S to proline P, Priestia megaterium the 147th amino acid is mutated from arginine R to histidine H, Priestia megaterium the 70th amino acid is mutated from glutamic acid E to glycine G.

[0064] After the above identification (including whole genome sequencing), it is determined that strain HA22 and strain HA22ALE are P. megaspora (P. Figure 4 ). Among them, P. megaspora (P. Fusarium oxysporum ) HA22ALE has been deposited with the China General Microbiological Culture Collection Center on October 13, 2025, and its registration number is CGMCC No. 36160, hereinafter referred to as strain HA22ALE.

[0065] Example 3, detection of tolerance to sodium chloride, sodium sulfate and pH 20 μL of the preserved strain HA22 and HA22ALE glycerol tube (stored in a -80°C refrigerator) was inoculated on 1 / 10 TSB solid medium, and incubated at 28°C for 24 h. The activated strain was inoculated with a loop to 5 mL of 1 / 10 TSB liquid medium, and incubated at 28°C, 200 rpm for 12 h. The bacterial cells were collected by centrifugation at 6000 r / min for 5 min, and the bacterial solution was diluted to OD 600 =1.0 with sterile water. 1 μL of the bacterial solution of strains HA22 and HA22ALE was inoculated on 1 / 10 TSB solid medium containing 0 g / L, 10 g / L, 20 g / L, 30 g / L, 40 g / L, 50 g / L, 60 g / L, 70 g / L, 80 g / L, 90 g / L, 100 g / L, 110 g / L sodium chloride, and 1 / 10 TSB solid medium containing 0 g / L, 10 g / L, 20 g / L, 30 g / L, 40 g / L, 50 g / L, 60 g / L, 70 g / L sodium sulfate, respectively. Three replicates were set, and the growth status of the strains was observed after incubation at 28°C for 24 h. At the same time, the pH was adjusted with dilute hydrochloric acid and sodium carbonate-sodium bicarbonate, and 30 μL of the bacterial solution of strains HA22 and HA22ALE was inoculated in 3 mL of 1 / 10 TSB liquid medium at pH 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, and three replicates were set. The turbidity of the culture medium was observed after incubation at 28°C, 200 rpm for 24 h.

[0066] AsFigure 5 As shown, strain HA22ALE can grow normally under conditions of 110 g / L sodium chloride, 70 g / L sodium sulfate, and pH 6.0 to 11.0, while strain HA22 cannot grow normally under 110 g / L sodium chloride and can only grow normally under conditions of 30 g / L sodium sulfate and pH 6.0 to 9.0. After adaptive evolution, the strain's salt and alkali tolerance has been significantly improved.

[0067] Example 4: Detection of the inhibitory ability of strains HA22 and HA22ALE against pathogenic fungi. 1 μL OD 600 =1.0 strains HA22 and HA22ALE were inoculated into the PDA medium at a position 3 cm from the center. The test fungus, Fusarium oxysporum, with a diameter of 6 mm, was then placed in the medium. Fusarium oxysporum The mycelial discs were inoculated into the center of PDA medium. For the negative control, only the tested pathogen was inoculated into the medium. The medium was incubated at 28°C upright until the control group's PDA medium was completely covered by pathogen hyphae. The effect of strain HA22 (HA22ALE) on the growth of the pathogen was observed. Three replicates were set up for each treatment.

[0068] like Figure 6 As shown, strains HA22 and HA22ALE are effective against Fusarium oxysporum (…). Figure 7 The growth of both strains was significantly inhibited, and strain HA22ALE showed a more significant antagonistic effect against the pathogenic fungus than strain HA22. This indicates that after adaptive evolution, the strain's ability to antagonize pathogens has been enhanced, demonstrating its potential to control the plant pathogenic fungus *Fusarium oxysporum*.

[0069] Example 5: Effects of inoculation with strain HA22ALE on germination and growth of maize and soybean. (1) Soybean seed preparation: Soybean seeds were disinfected with 95% ethanol for 30 s, 1% sodium hypochlorite for 5 min, and washed 8 times with sterile water. They were then transferred to 0.7% water agar plates and 0.7% water agar plates containing sodium chloride, sodium sulfate, and sodium bicarbonate-sodium carbonate, with 15 seeds on each plate.

[0070] (2) Preparation of corn seeds: Disinfect corn seeds with 1% sodium hypochlorite for 10 min, wash them 8 times with sterile water, and transfer them to petri dishes containing 15 mL of sterile water and sodium chloride, sodium sulfate and sodium bicarbonate-sodium carbonate solutions respectively, with 15 seeds on each petri dish.

[0071] (3) Strain activation: 20 μL of the glycerol tube (stored at -80 °C) of the preserved strains HA22 and HA22ALE was inoculated on 1 / 10 TSB solid medium, and incubated at 28 °C for 24 h. The activated strains were picked with a loop and inoculated into 5 mL of 1 / 10 TSB liquid medium, and incubated at 28 °C, 200 rpm for 12 h. The bacterial cells were collected by centrifugation at 6000 r / min for 5 min, and the bacterial solution was diluted to OD 600 = 0.05 with sterile water.

[0072] (4) Experimental treatment: The bacterial solution of HA22 and HA22ALE with OD 600 = 0.05 was inoculated on the plates of soybeans and corn, 200 μL per plate, three replicates, and incubated at 28 °C in the dark. The germination rate and root length of soybeans were counted after 48 h of germination, and the germination rate and root length of corn were counted after 48 h of germination. Twelve treatments were set for the soybean and corn groups, including: normal control group, inoculation of HA22 under normal conditions, inoculation of HA22ALE under normal conditions, sodium chloride saline stress group, inoculation of HA22 under sodium chloride saline stress conditions, inoculation of HA22ALE under sodium chloride saline stress conditions, sodium sulfate saline stress group, inoculation of HA22 under sodium sulfate saline stress conditions, inoculation of HA22ALE under sodium sulfate saline stress conditions, sodium carbonate-sodium bicarbonate saline stress group, inoculation of HA22 under sodium carbonate-sodium bicarbonate saline stress conditions, and inoculation of HA22ALE under sodium carbonate-sodium bicarbonate saline stress conditions. Among them, the final concentration of sodium chloride in the three groups related to sodium chloride stress was 1.2% (i.e. 12 g / L); the final concentration of sodium sulfate in the three groups related to sodium sulfate stress was 1.5% (i.e. 15 g / L); the final concentration of sodium carbonate-sodium bicarbonate in the three groups related to sodium carbonate-sodium bicarbonate stress was 1.2% (i.e. 12 g / L, which was the sum of the concentrations of sodium carbonate and sodium bicarbonate, and the mass ratio of sodium carbonate to sodium bicarbonate was 1:9).

[0073] As shown in Figure 8 , under normal conditions, inoculation of HA22 and HA22ALE had no significant effect on the germination rate of soybeans, but significantly increased the root length of soybeans. The root length of soybeans inoculated with HA22ALE was significantly increased by 129.25% after 48 h of germination. Under saline conditions, the germination rate of soybeans decreased significantly. Inoculation of HA22 had no significant effect on the germination rate of soybeans under saline conditions, but inoculation of HA22ALE significantly promoted the germination of soybeans under three types of saline conditions, and the germination rate of soybeans was increased by 11.77%, 13.24%, and 28.33%, respectively. Figure 9As shown, under normal conditions, inoculation of HA22 and HA22ALE had no significant effect on the germination rate of corn, but inoculation of HA22ALE significantly increased the root length of corn, and the root length of corn after 48 h of germination increased by 59.60%. Under saline conditions, the germination rate of corn decreased significantly, and inoculation of HA22 had no significant effect on the germination rate of corn under sodium chloride, sodium sulfate and sodium carbonate-sodium bicarbonate saline conditions, while inoculation of HA22ALE could significantly promote the germination of corn under the three saline conditions, and the germination rate of corn increased by 23.33%, 25.00% and 34.62%, respectively.

[0074] Example 6, Promoting effect of strain HA22ALE on soybean under sodium chloride saline stress conditions in natural soil (1) Soybean seedling preparation: After the soybean seeds were sterilized with 95% ethanol for 30 s, 1% sodium hypochlorite for 5 min and washed with sterile water for 8 times, they were germinated on 0.7% water agar at 28°C in the dark for 36 h.

[0075] (2) Strain activation: 20 μL of the preserved strains HA22 and HA22ALE (stored at -80°C) were inoculated on 1 / 10 TSB solid medium and incubated at 28°C for 24 h. The activated strains were inoculated into 5 mL of 1 / 10 TSB liquid medium using a loop, and incubated at 28°C with constant shaking at 200 rpm for 12 h. The bacterial cells were collected by centrifugation at 6000 r / min for 5 min, and the bacterial solution was diluted to OD 600 =0.5 with sterile water.

[0076] (3) Experimental treatment: The natural soil planted with soybeans was mixed with sterile vermiculite at a volume ratio of 1:3, and then placed in pots with a diameter of 9 cm, a bottom diameter of 5.5 cm and a height of 8 cm. Four treatments were set up, each with 10 replicates, including: normal control group, 1.2% sodium chloride saline stress group, inoculation of HA22 under 1.2% sodium chloride saline stress conditions, and inoculation of HA22ALE under 1.2% sodium chloride saline stress conditions, wherein % represents g / 100 mL. The inoculation treatment group was: 5 mL of HA22 and HA22ALE bacterial solution with OD 600 =0.5 was inoculated into the root of soybean.

[0077] (4) Index determination: After 21 days of continuous growth, the plant height, root length, aboveground fresh weight, underground fresh weight, aboveground dry weight, underground dry weight, nodule number, nodule fresh weight of soybean were measured.

[0078] As Figure 10As shown, under 1.2% NaCl conditions, sodium chloride salinity stress significantly affected soybean growth, with significant decreases in plant height, nodule number, nodule fresh weight, aboveground / belowground fresh weight, and aboveground / belowground dry weight. Inoculation with strain HA22ALE significantly promoted soybean growth under sodium chloride salinity stress, increasing plant height, aboveground fresh weight, and aboveground dry weight by 31.00%, 34.95%, and 36.69%, respectively, while increasing belowground fresh weight, belowground dry weight, nodule number, and nodule fresh weight by 31.95%, 25.88%, 66.26%, and 57.24%, respectively.

[0079] Example 7: Growth-promoting effect of strain HA22ALE on soybeans under sodium sulfate stress in natural soil. (1) Soybean seedling preparation: The specific operation is the same as in Example 6.

[0080] (2) Activation of strain: The specific operation is the same as in Example 6.

[0081] (3) Experimental treatment: Natural soil for soybean planting was mixed with sterile vermiculite at a volume ratio of 1:3 and filled into flowerpots with a mouth diameter of 9 cm, a bottom diameter of 5.5 cm, and a height of 8 cm. Four treatments were set up, with 10 replicates for each treatment, including: a normal control group, a 1.5% sodium sulfate salt-alkali stress group, a group inoculated with HA22 under 1.5% sodium sulfate salt-alkali stress, and a group inoculated with HA22ALE under 1.5% sodium sulfate salt-alkali stress. All percentages represent g / 100 mL. The inoculation treatment group consisted of 5 mL OD... 600 Inoculate soybean roots with HA22 and HA22ALE bacterial solutions at a concentration of 0.5.

[0082] (4) Indicator measurement: The specific operation is the same as in Example 6.

[0083] like ​ As shown, under 1.5% Na2SO4 conditions, sodium sulfate stress significantly affected soybean growth, with significant reductions in plant height, nodule number, nodule fresh weight, aboveground / belowground fresh weight, and aboveground / belowground dry weight. Inoculation with strain HA22ALE significantly promoted soybean growth under sodium sulfate stress, increasing plant height, aboveground fresh weight, and aboveground dry weight by 20.17%, 25.29%, and 29.55%, respectively, while increasing belowground fresh weight, belowground dry weight, nodule number, and nodule fresh weight by 25.06%, 26.07%, 30.23%, and 25.56%, respectively.

[0084] Example 8: Growth-promoting effect of strain HA22ALE on soybeans under sodium carbonate-sodium bicarbonate saline-alkali stress in natural soil. (1) Soybean seedling preparation: The specific operation is the same as in Example 6.

[0085] (2) Activation of strain: The specific operation is the same as in Example 6.

[0086] (3) Experimental treatment: the natural soil planted with soybeans and sterile vermiculite were mixed according to the volume ratio of 1:3, and were loaded into flowerpots with a caliber of 9 cm, a bottom diameter of 5.5 cm, and a height of 8 cm. Four treatments were set, each with 10 replicates, including: normal control group, 1.2% sodium carbonate-sodium bicarbonate saline stress group, inoculation of HA22 under 1.2% sodium carbonate-sodium bicarbonate saline stress, and inoculation of HA22ALE under 1.2% sodium carbonate-sodium bicarbonate saline stress, wherein % represents g / 100 mL, which is the sum of the concentrations of sodium carbonate and sodium bicarbonate (the mass ratio of sodium carbonate to sodium bicarbonate is 1:9). The inoculation treatment group was: 5 mL of HA22, HA22ALE bacterial liquid with OD 600 =0.5 was inoculated into the roots of soybeans, respectively.

[0087] (4) Index determination: the specific operation was the same as in Example 6.

[0088] As shown in ​ , under the condition of 1.2% NaHCO3-Na2CO3, sodium bicarbonate-sodium carbonate saline stress significantly affected the growth of soybeans, and the plant height, nodule number, aboveground fresh weight, and aboveground / underground dry weight of soybeans were significantly reduced. Inoculation of strain HA22ALE could significantly promote the growth of soybeans under sodium bicarbonate-sodium carbonate saline stress, and the plant height, aboveground dry weight, and underground fresh weight of soybeans were significantly increased by 40.22%, 49.96%, and 41.51%, respectively.

[0089] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In summary, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which deviates from the scope disclosed in the present application.

Claims

1. *Priscilla megaterium* or its progeny, characterized by: The *Priestella megaterium* is *Priestella megaterium* (… Priestia megaterium The strain number is HA22ALE, and its registration number at the China General Microbiological Culture Collection Center is CGMCC No. 36160.

2. A composition containing the *Priestella megaterium* or its progeny as claimed in claim 1.

3. The composition according to claim 2, characterized in that: The composition is a culture, which is a substance obtained by culturing the Priestella megaterium or its progeny in a microbial culture medium.

4. The composition according to claim 2, characterized in that: The composition is a microbial agent, a microecological preparation, or a bio-fertilizer.

5. The composition according to any one of claims 2-4, characterized in that: The composition has at least one of the following properties: A1) Tolerates 110 g / L sodium chloride; A2) Tolerates 70 g / L sodium sulfate; A3) Tolerates pH 6-11; A4) produces IAA; A5) Potassium dissolution; A6) Inhibits Fusarium oxysporum; A7) Prevention and control of plant diseases caused by Fusarium oxysporum infection; A8) Relieves salt and alkali stress in plants; A9) Promotes plant growth.

6. The use of the *Priestella giantiformis* or its descendants as described in claim 1, or the composition of any one of claims 2-5, wherein the use is any one of the following: B1) Use in inhibiting Fusarium oxysporum or in the preparation of products for inhibiting Fusarium oxysporum; B2) Use in the prevention and control of plant diseases caused by Fusarium oxysporum infection or in the preparation of products for the prevention and control of plant diseases caused by Fusarium oxysporum infection; B3) Applications in alleviating salt stress in plants or in the preparation of products for alleviating salt stress in plants; B4) Application in promoting plant growth or in the preparation of products for promoting plant growth.

7. Any of the following methods: Method I: A method for alleviating salt and alkali stress in plants, comprising the following steps: treating the plant to be treated or its growth substrate with the *Priestella giantiflora* or its progeny as described in claim 1 or the composition of any one of claims 2-5, thereby alleviating the salt and alkali stress in the plant; Method II: A method for promoting plant growth, comprising the following steps: treating the plant to be treated or its growth substrate with the *Priestella giantiflora* or its progeny as described in claim 1 or the composition of any one of claims 2-5, thereby promoting the growth of the plant; Method III: A method for inhibiting Fusarium oxysporum, comprising the following steps: applying the *Priestella giantiflora* or its progeny as described in claim 1 or the composition of any one of claims 2-5 to the plant growing environment of *Fusarium oxysporum*, plants suspected of carrying *Fusarium oxysporum*, or plants suspected of having *Fusarium oxysporum*, thereby inhibiting *Fusarium oxysporum*; Method IV: A method for preventing and controlling plant diseases caused by Fusarium oxysporum infection, comprising the following steps: applying *Priestella giantiflora* or its progeny or any of the compositions of claims 2-5 to a plant plant or its growth substrate susceptible to *Fusarium oxysporum* infection, thereby achieving prevention and control of plant diseases caused by *Fusarium oxysporum* infection.

8. The composition according to claim 5, the application according to claim 6, or the method according to claim 7, characterized in that: The promotion of plant growth refers to promoting plant growth under normal conditions or under saline-alkali stress conditions.

9. The composition, application, or method according to claim 8, characterized in that: The salt and alkali stress is any one of the following: (a1) sodium chloride stress; (a2) sodium sulfate stress; (a3) ​​sodium carbonate-sodium bicarbonate stress.

10. The composition, application, or method according to any one of claims 5-9, characterized in that: The plant is any one of the following: C1) Angiosperms; C2) Monocotyledons or dicotyledons; C3) Plants of the order Poaceae or Leguminosae; C4) Grasses or legumes; C5) Plants of the genus *Zea* or *Glycine*; C6) Corn or soybeans.

Images