Wheat TaSTART1 gene and application of encoded protein thereof in wheat powdery mildew resistance

By inhibiting the expression of the wheat TaSTART1 gene or regulating the activity of its encoded protein, gene editing technology was used to improve wheat resistance to powdery mildew, solving the problem of unclear wheat powdery mildew resistance genes and achieving efficient and green control.

CN121518563APending Publication Date: 2026-02-13SHANDONG AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511989903.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-26
Publication Date
2026-02-13

AI Technical Summary

Technical Problem

In the current technology, the genes that play a key negative regulatory role in wheat powdery mildew resistance are not yet clear, which limits the progress of efficient disease-resistant breeding, and chemical pesticide control poses an environmental pollution risk.

Method used

By inhibiting the expression of the wheat TaSTART1 gene or regulating the activity of its encoded protein, gene editing technologies such as CRISPR/Cas systems can be used to silence or reduce the function of the TaSTART1 gene, thereby improving wheat's resistance to powdery mildew.

Benefits of technology

It significantly enhances wheat's resistance to powdery mildew, reduces pathogen biomass, and lowers disease incidence, providing a new strategy for molecular breeding and an effective approach for green disease control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121518563A_ABST
    Figure CN121518563A_ABST
Patent Text Reader

Abstract

The invention discloses application of a wheat TaSTART1 gene and an encoding protein thereof in wheat powdery mildew resistance, and belongs to the technical field of plant genetic engineering. Experiments prove that TaSTART1 plays a role of a negative regulatory factor in the immune response of wheat to powdery mildew. By silencing the expression of the TaSTART1 gene in wheat, the biomass of pathogenic bacteria inoculated with powdery mildew is obviously reduced, the number of spore heaps of plants is reduced, and the disease resistance is obviously enhanced. The discovery reveals that TaSTART1 is a brand new endogenous target which can be used for genetic manipulation to improve wheat powdery mildew resistance. The results prove that the strategy for improving the resistance of the wheat to the powdery mildew by regulating the TaSTART1 is effective, and a solid experimental basis is provided for the practical application of the target spot in molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to a wheat YourSTART1 Application of genes and their encoded proteins in wheat resistance to powdery mildew. Background Technology

[0002] Wheat, as one of the world's most important food crops, is crucial to national welfare and people's livelihoods through its safe production. This is due to the fungus *Powdery Mildew* (*P. spp.*). Blumeria graminis f. sp. wheat Powdery mildew, caused by an airborne fungus, is a widespread and serious disease that can hinder photosynthesis in wheat leaves, resulting in incomplete grain filling and severe yield and quality losses. Currently, the control of wheat powdery mildew mainly relies on chemical pesticides and the planting of resistant varieties. However, the long-term and excessive use of chemical pesticides not only increases production costs but may also lead to environmental pollution and pesticide residue problems. Therefore, discovering and utilizing wheat's own disease-resistant genes to cultivate high-yielding, high-quality, and multi-resistant new wheat varieties is the fundamental way to achieve green and sustainable control of wheat powdery mildew.

[0003] Plants have developed a complex immune system to combat pathogen invasion over a long period of evolution. Recent studies have shown that plant immune responses are finely regulated by a series of positive and negative regulatory factors to balance disease resistance with growth and development. Among these, some genes acting as negative regulators play a crucial role in controlling the intensity of the immune response and preventing cell death and growth inhibition caused by excessive immune responses. Inhibiting the function of these negative regulators through molecular means is considered an effective strategy to enhance broad-spectrum or durable disease resistance in crops. However, in wheat, an important food crop, the genes playing a key negative regulatory role in powdery mildew resistance remain poorly understood, and their molecular mechanisms are unclear. This limits our progress in using this strategy for efficient disease-resistant breeding.

[0004] The Enhanced Disease Resistance 2 (EDR2) family of genes encodes proteins containing PH and START domains, playing a crucial role in plant disease resistance immune responses. Previous studies have confirmed that in Arabidopsis thaliana... EDR2 The gene mutants exhibited significantly enhanced resistance to powdery mildew pathogens, and this resistance was mediated through the salicylic acid signaling pathway. It is important to emphasize that the function of plant disease resistance genes exhibits significant species specificity; gene sequences, regulatory pathways, and interaction patterns with pathogens differ among different species. The functions of EDR2 family genes are not completely conserved in different plants, and functional differentiation is possible. Currently, no studies have confirmed the disease resistance function of EDR2 family genes in wheat, a monocotyledonous food crop. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a wheat YourSTART1 Application of genes and their encoded proteins in wheat resistance to powdery mildew.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides wheat YourSTART1 The application of genes in any of the following (1)-(3): (1) Regulating wheat resistance to powdery mildew; (2) Develop wheat varieties resistant to powdery mildew; (3) Develop drugs to target and control stripe rust; The wheat YourSTART1 A gene is a DNA molecule as shown in any of the following (I)-III): I) The nucleotide sequence is the DNA molecule (CDS sequence) shown in SEQ ID NO.1, as follows: SEQ ID NO.1:

[0007] II) DNA molecules encoding the amino acid sequence shown in SEQ ID NO.2, excluding those in I); III) A DNA molecule that has 80% or more identity with the DNA fragment defined in I) or II) and whose encoded protein is functionally equivalent to the protein shown in SEQ ID NO.2.

[0008] Preferably, the powdery mildew is a disease caused by infection with wheat-specific powdery mildew species E09.

[0009] Preferably, by inhibiting wheat YourSTART1 Gene expression is used to enhance wheat's resistance to powdery mildew.

[0010] Preferably, the inhibition of wheat YourSTART1 Gene expression is achieved through virus-induced gene silencing, RNA interference, CRISPR / Cas gene editing, or antisense RNA technology.

[0011] In a second aspect, the present invention provides wheat YourSTART1 The application of the gene-encoded protein in the following (1) or (2): (1) Regulating wheat resistance to powdery mildew; (2) To develop drugs for the prevention and control of stripe rust as a target; The wheat YourSTART1 The proteins encoded by the gene are shown in (A1) or (A2) below: (A1) A protein consisting of the amino acid sequence shown in SEQ ID NO.2 of the sequence listing, as follows: SEQ ID NO.2: .

[0012] (A2) The protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).

[0013] Preferably, by reducing or inhibiting wheat YourSTART1 The activity of gene-encoded proteins is used to enhance wheat's resistance to powdery mildew.

[0014] In a third aspect, the present invention provides the use of the substance described in (1) or (2) below in the preparation of a medicament for preventing and controlling wheat powdery mildew resistance: (1) Blocking or inhibiting genes YourSTART1The substance being expressed; (2) Repressor genes YourSTART1 Substances that encode protein activity.

[0015] In a fourth aspect, the present invention provides a method for improving the resistance of wheat to powdery mildew, comprising the following steps: (a) Constructing YourSTART1 Recombinant VIGS vector for gene-specific silencing fragments; (b) The recombinant VIGS vector was introduced into wheat plants to induce... YourSTART1 Gene silencing to improve wheat's resistance to powdery mildew.

[0016] In step (a), the specific silencing fragment corresponds to YourSTART1 Nucleotides 1432 to 1749 of the full-length gene sequence. The nucleotide sequence of the selected specific silencing fragment is shown in SEQ ID NO.3: SEQ ID NO.3: GATGATGTTACAACCCCGAAGGCTGGAAAGGTGAAGTTGAAGAACGTATCATGGGCCATTGCAGGTTTAGCTATGAAGCGAACTAAAGCTTCGCTTGAGAGGAGCGAATTGGTTACAAATTCTATTCCCATAGCTATTGACTCGAGCCATTTCCATGGC ACCGTTCGACAAGCGAAAAGTGAAGATGACCCAAATTCTTGGAGTTCACCTGGTGGAGAGAAGTTTATGATAAGAGGGAAGACTTACTTGACAGATTACGCCAAGATTGCTGGAGGTGATCCTCTTCTAAAGCTTATTGCAGTTGATTGGTTCAAGGTT.

[0017] The beneficial effects of this invention are: This invention has been experimentally verified. YourSTART1 It plays the role of a negative regulator in the immune response of wheat to powdery mildew. This is achieved by silencing the immune response of wheat cells. YourSTART1 Gene expression led to a significant reduction in pathogen biomass after inoculation with powdery mildew, resulting in fewer spore masses and significantly enhanced disease resistance in the plants. This discovery reveals... YourSTART1 As a novel endogenous target that can be genetically manipulated to enhance wheat powdery mildew resistance, the above results demonstrate that by regulating... YourSTART1The strategy of improving wheat resistance to powdery mildew is effective and provides a solid experimental basis for the practical application of this target in molecular breeding (such as combining it with gene editing technologies such as CRISPR / Cas). Attached Figure Description

[0018] Figure 1 For the momentary silencing of wheat leaves YourSTART1 The relative expression level of genes.

[0019] Figure 2 For silence YourSTART1 The gene enhanced Fielder's resistance to powdery mildew. Detailed Implementation

[0020] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0021] The specific embodiments of the present invention will be described in further detail below with reference to examples. The following detailed descriptions are illustrative and intended to provide further explanation of this application, rather than limiting the scope of the invention.

[0022] Example 1: YourSTART1 Gene cloning and sequence verification Young leaves of the wheat variety 'Chinese Spring' were used as material. Genomic DNA was extracted using the CTAB method. Based on publicly available wheat genome database information and homology alignment, specific primers were designed and synthesized for amplification. YourSTART1 Gene.

[0023] Primer sequences: YourSTART1 -F (SEQ ID NO: 4): ATGGCGGCGACGACAGCGCAG; YourSTART1 -R (SEQ ID NO: 5): GATCGCTACAGCACCCTCAGGATTTACACGG.

[0024] PCR products were detected by 1% agarose gel electrophoresis, and the target band was recovered by gel extraction using a DNA gel extraction kit. The sequenced sequences were compared with reference sequences in a database to ultimately determine the sequence involved in this invention. YourSTART1 The gene coding region (CDS) sequence is shown in SEQ ID NO: 1; the amino acid sequence of the protein it encodes is shown in SEQ ID NO: 2.

[0025] Example 2: Construction of virus-induced gene silencing (VIGS) vector and plant inoculation 1. VIGS fragment design and primer synthesis according to YourSTART1 The full-length gene sequence was selected using the online tool SGN VIGS Tool. YourSTART1 Design primers for the specific silencing fragment of the gene (corresponding to positions 1432-1749 bp in the full-length genome): YourSTART1 -γ-F (SEQ ID NO: 6): GATGATGTTACAACCCCGAAGGC; YourSTART1 -γ-R (SEQ ID NO: 7):AACCTTGAACCAATCAACTGCAATAAGC.

[0026] 2. Construction of VIGS Recombinant Vector The silenced fragment was amplified using primers shown in SEQ ID NO: 6-SEQ ID NO: 7. The purified PCR product and the pBSMV-γ vector digested with ApaI were recombinantly ligated. The recombinant product was transformed into DH5α competent cells and plated on LB agar plates containing kanamycin. Single clones were picked for colony PCR verification, and positive clones were sequenced to confirm the correct insertion sequence and orientation. The correctly verified recombinant plasmid was named pBSMV-γ. YourSTART1 .

[0027] 3. In vitro transcription and viral inoculation pBSMV-α, pBSMV-β, and pBSMV-γ were respectively: YourSTART1 The plasmid was linearized using restriction endonucleases. The linearized DNA template was then transcribed in vitro to obtain BSMV. YourSTART1 Recombinant viral RNA.

[0028] Retrieve BSMV: YourSTART1 Recombinant viral RNA was gently rubbed onto the surface of the second leaf of 'Fielder' seedlings for inoculation. An empty vector virus without the target fragment was used as a control. After inoculation, the plants were placed in the dark at 23-27°C with high humidity for 24 hours to promote viral infection, and then moved back to normal light conditions (16h / 8h light-dark cycle) for continued cultivation.

[0029] 4. Detection of gene silencing efficiency Approximately 10-12 days after inoculation, observing the third leaf for obvious virus-induced chlorosis or mosaic symptoms indicates successful BSMV system infection. BSMV- YourSTART1Total RNA was extracted from the third leaves of grafted plants and BSMV-CK control plants using a total RNA extraction kit, and first-strand cDNA was synthesized using a reverse transcription kit. Real-time quantitative PCR analysis was performed using specific primers with the cDNA as a template.

[0030] The qRT-PCR primer sequences are as follows: YourSTART1 -RT-F (SEQ ID NO: 8):GTTATGTACTACGCAGCAGAGAAGC; YourSTART1 -RT-R (SEQ ID NO: 9):CCACGACGATGCTTGTCACATATC.

[0031] Ta18S-rRNA-RT-F (SEQ ID NO: 10): GTGACGGGGTGACGGAGAATT; Ta18S-rRNA-RT-R (SEQ ID NO: 11): GACACTAATGCGCCCGGTAT.

[0032] Ta18S-rRNA was used as an internal reference gene in Real-time PCR analysis.

[0033] like Figure 1 As shown, the qRT-PCR results indicate that, compared with the BSMV-CK control, BSMV- YourSTART1 In the grafted plants YourSTART1 The mRNA level of the gene decreased significantly by about 50%, indicating that the VIGS system effectively silenced the gene in wheat. YourSTART1 Gene.

[0034] After confirming the effectiveness of gene silencing, the plants to be treated can be used for subsequent powdery mildew inoculation experiments when the fourth leaf has fully unfolded, in order to evaluate the effect of gene silencing on wheat powdery mildew resistance (see Example 3).

[0035] Example 3: YourSTART1 Evaluation of resistance of silent plants to powdery mildew Fourteen days after virus inoculation in Example 2, when the fourth leaf was fully expanded, wheat-specific powdery mildew strain E09 was inoculated. After inoculation, the strain was cultured in a greenhouse at 20 ± 2℃ and humidity >80%. Disease incidence was observed 14 days after inoculation with the powdery mildew strain.

[0036] Compared with the blank control BSMV-CK, YourSTART1 After inoculation with powdery mildew E09, sporadic spore masses appeared on the leaves of gene-silenced plants, which were fewer in number than those in the control group. YourSTART1The biomass of powdery mildew was significantly reduced after inoculating silent plants with powdery mildew E09. Figure 2 This result directly confirms YourSTART1 The role of genes in the negative regulation of wheat powdery mildew resistance.

[0037] The above description is merely a preferred embodiment of this application and is not intended to limit the application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications made within the spirit and principles of this application are not permitted. Equivalent substitutions, improvements, etc., should all be included within the scope of protection of this application.

Claims

1. Wheat TaSTART1 The application of genes in any of the following (1)-(3): (1) Regulating wheat resistance to powdery mildew; (2) Develop wheat varieties resistant to powdery mildew; (3) Develop drugs to target and control stripe rust; The wheat TaSTART1 A gene is a DNA molecule as shown in any of the following (I)-III): I) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.1; II) DNA molecules encoding the amino acid sequence shown in SEQ ID NO.2, excluding those in I); III) A DNA molecule that has 80% or more identity with the DNA fragment defined in I) or II) and whose encoded protein is functionally equivalent to the protein shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The powdery mildew is a disease caused by infection with E09, a specific type of wheat powdery mildew fungus.

3. The application according to claim 1, characterized in that, By inhibiting wheat TaSTART1 Gene expression is used to enhance wheat's resistance to powdery mildew.

4. The application according to claim 3, characterized in that, The inhibition of wheat TaSTART1 Gene expression is achieved through virus-induced gene silencing, RNA interference, CRISPR / Cas gene editing, or antisense RNA technology.

5. Wheat TaSTART1 The application of the gene-encoded protein in the following (1) or (2): (1) Regulating wheat resistance to powdery mildew; (2) To develop drugs for the prevention and control of stripe rust as a target; The wheat TaSTART1 The proteins encoded by the gene are shown in (A1) or (A2) below: (A1) A protein consisting of the amino acid sequence shown in SEQ ID NO.2 of the sequence listing; (A2) The protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).

6. The application according to claim 5, characterized in that, By reducing or inhibiting wheat TaSTART1 The activity of gene-encoded proteins is used to enhance wheat's resistance to powdery mildew.

7. The application of the substance described in (1) or (2) below in the preparation of drugs for preventing and controlling wheat powdery mildew resistance: (1) Blocking or inhibiting genes TaSTART1 The substance being expressed; (2) Repressor genes TaSTART1 Substances that encode protein activity.

8. A method for improving wheat resistance to powdery mildew, characterized in that, Includes the following steps: (a) Constructing TaSTART1 Recombinant VIGS vector for gene-specific silencing fragments; (b) The recombinant VIGS vector was introduced into wheat plants to induce... TaSTART1 Gene silencing to improve wheat's resistance to powdery mildew.

9. The method according to claim 8, characterized in that, In step (a), the specific silencing fragment corresponds to TaSTART1 Nucleotides 1432 to 1749 of the full-length gene sequence, the nucleotide sequence of the specific silenced fragment is shown in SEQ ID NO.3.