ERAS fusion gene and application thereof in diagnosis and treatment of glioma

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a biomarker and application thereof in glioma detection and treatment. The invention discloses a novel ERAS fusion gene which can be used as a biomarker and a therapeutic target of glioma, especially children type H3-wild type and IDH-wild type high-grade glioma. Further, a compound capable of effectively inhibiting ERAS positive cells is verified through calculation prediction and experiments, and a first targeted drug for children type H3-wild type and IDH-wild type high-grade glioma is provided.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a biomarker and its use in the detection and treatment of glioma. Background Technology

[0002] In recent years, with advancements in molecular biology and genetics, it has become increasingly clear that tumorigenesis and development are complex, multi-step, and multi-gene-involved processes. Within this process, the generation and function of fusion genes have received widespread attention. A fusion gene is a chimeric gene formed by the fusion of two or more different genes through various mechanisms. Fusion genes often exhibit tumor specificity and susceptibility to drug intervention, thus showing great potential as diagnostic indicators and therapeutic targets in cancer treatment. In recent years, molecular subtyping has been widely applied in cancer diagnosis, defining various cancer types based on the presence or absence of certain fusion genes. Furthermore, significant therapeutic effects have been achieved with several small-molecule inhibitors that specifically target fusion genes, and the FDA has approved these inhibitors for treating cancer patients carrying such fusion genes.

[0003] Gliomas are the most common and aggressive malignant brain tumors in adults. Several functional fusion genes have been identified in gliomas, including FGFR3::TACC3 fusion, PTPRZ1::MET fusion, and NTRK fusion. In recent years, advancements in molecular detection and computational methods have made it possible to integrate molecular features such as somatic mutations, fusion genes, and methylation characteristics of tumors, thus enabling precise diagnosis of brain tumors. However, the standard treatment for gliomas remains surgery plus radiotherapy and chemotherapy. Pediatric IDH-wildtype H3-wildtype high-grade glioma, a subtype of brain tumor first introduced in the 2021 WHO classification of tumors of the central nervous system, is a highly malignant brain tumor with a poor prognosis, primarily occurring in children and adolescents. Research on this type of disease is limited, and its molecular characteristics remain unclear. There is also a lack of viable treatment options for this disease.

[0004] Traditionally, the diagnosis and classification of gliomas have relied on clinicians' evaluation of pathological images. However, these methods are subjective, and assessments often vary among clinicians. The 2016 WHO Classification of Tumors of the Central Nervous System introduced IDH mutations and combined deletions of chromosome 1p / 19q. The 2021 WHO Classification of Tumors of the Central Nervous System further incorporated chromosome 7 augmentation / 10 loss, EGFR, TERT, and CDKN2A alterations for the molecular diagnosis of diffuse gliomas in adults. Simultaneously, some IDH-wildtype and H3-wildtype high-grade gliomas are now classified as "childhood H3-wildtype and IDH-wildtype high-grade gliomas."

[0005] To date, existing technologies offer very limited understanding of "childhood H3-wild-type and IDH-wild-type high-grade gliomas." These tumors typically do not exhibit the typical IDH, H3, chr1p / 19q, or chr7 / 10 mutations and lack universally accepted diagnostic molecular markers. Currently, differential diagnosis of this subtype relies heavily on DNA methylation classification, but methylation classification does not provide clues regarding target sites for therapeutic development.

[0006] Currently, the treatment strategy for pediatric H3-wild-type and IDH-wild-type high-grade gliomas mainly involves surgery, combined with adjuvant therapies such as radiotherapy and chemotherapy. However, these traditional treatments often fail to achieve ideal results, and patients' survival rates and quality of life remain low.

[0007] Overall, the molecular characteristics of this disease remain unclear, which greatly limits the development of targeted therapies. Furthermore, there are few available treatment options, current treatments are ineffective, and patient survival rates and quality of life remain low. Therefore, identifying new therapeutic targets and developing effective drugs are crucial tasks in this field. Summary of the Invention

[0008] As mentioned above, the existing technology has very limited understanding of "childhood H3-wild-type and IDH-wild-type high-grade gliomas", and the molecular characteristics of the disease are still unclear, which greatly limits the development of diagnosis and treatment of the disease.

[0009] Therefore, in a first aspect, the present invention provides a biomarker, the biomarker being an ERAS fusion gene, wherein the breakpoint of the ERAS fusion gene is located at the 5' end of the second exon of ERAS.

[0010] In a second aspect, the present invention provides a glioma detection agent for detecting biomarkers according to the first aspect of the present invention.

[0011] In a third aspect, the present invention provides the use of an ERAS fusion gene detection agent in the preparation of a glioma detection agent or glioma detection kit, wherein the ERAS fusion gene is HUWE1-ERAS and / or PARD6G-ERAS.

[0012] In a fourth aspect, the present invention provides a system for diagnosing gliomas, wherein the system comprises at least:

[0013] The detection module is configured to detect biomarkers in the subject.

[0014] An assessment module is configured to assess the subject's disease status based on the detection results of the biomarkers obtained by the detection module;

[0015] The biomarkers are the expression products of HUWE1-ERAS and / or PARD6G-ERAS.

[0016] In a fifth aspect, the present invention provides the use of substances that inhibit the expression of ERAS fusion gene expression products and / or reduce their activity in the preparation of medicaments for treating gliomas, wherein the ERAS fusion gene is HUWE1-ERAS and / or PARD6G-ERAS.

[0017] The beneficial effects of this invention: This invention reveals a novel ERAS fusion gene that can serve as a biomarker and therapeutic target for gliomas, particularly pediatric H3-wild-type and IDH-wild-type high-grade gliomas. Furthermore, through computational prediction and experimental validation, compounds that can effectively inhibit ERAS-positive cells were identified, providing the first targeted drug for pediatric H3-wild-type and IDH-wild-type high-grade gliomas. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other implementation schemes can be obtained based on these drawings without creative effort.

[0019] Figure 1 Novel ERAS fusions were discovered in pediatric H3-wild-type and IDH-wild-type high-grade gliomas.

[0020] Figure 2 The presence of ERAS fusions in the samples was verified by polymerase chain reaction (PCR) and Sanger sequencing.

[0021] Figure 3 ERAS fusions can be detected in various tumor types.

[0022] Figure 4 Genome-wide distribution of ERAS fusion target genes.

[0023] Figure 5 The structure and functional domains of ERAS fusion transcripts.

[0024] Figure 6 Median values ​​of ERAS gene promoter and mRNA expression in glioma samples from the TCGA cohort.

[0025] Figure 7 ERAS gene promoter methylation status in pediatric H3-wild-type and IDH-wild-type high-grade gliomas with and without ERAS fusion.

[0026] Figure 8 ERAS mRNA expression in pediatric H3-wild-type and IDH-wild-type high-grade gliomas with and without ERAS fusion.

[0027] Figure 9 The expression of ERAS mRNA in various tumors is stratified according to their ERAS fusion status. Red diamonds indicate samples carrying ERAS fusion genes. For cancer types, please refer to https: / / gdc.cancer.gov / resources-tcga-users / tcga-code-tables / tcga-study-abbreviat ions.

[0028] Figure 10 .ERAS activation of the PI3K-AKT-mTOR pathway in human immortalized astrocytes (HA).

[0029] Figure 11 In patient-derived glioma cell spheres 22-1, ERAS activates the PI3K-AKT-mTOR pathway.

[0030] Figure 12 The upregulation and downregulation of the ERAS pathway before and after overexpression in patient-derived glioma spheroids 22-1.

[0031] Figure 13 In patient-derived glioma spheres 22-1, overexpression of ERAS can activate the PI3K-AKT-mTOR pathway.

[0032] Figure 14 Differentially expressed genes in pediatric H3-wild-type and IDH-wild-type high-grade gliomas with and without ERAS fusions.

[0033] Figure 15 Differentially expressed genes in pediatric H3-wild-type and IDH-wild-type high-grade gliomas with and without ERAS fusions.

[0034] Figure 16 Growth curves of HA cells overexpressing and not overexpressing ERAS.

[0035] Figure 17 Growth curves of 22-1 cells with and without ERAS overexpression.

[0036] Figure 18 A computational workflow for identifying potential drugs for ERAS-positive cancer cells.

[0037] Figure 19The small molecules that can be preferentially used to inhibit ERAS-activated cells were calculated.

[0038] Figure 20 GSK690693 inhibits the growth of ERAS-positive cells. Detailed Implementation

[0039] The present invention will now be clearly and completely described in conjunction with its embodiments and accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments that can be obtained by those skilled in the art based on the embodiments of the present invention are within the scope of protection of the present invention.

[0040] As used herein, unless otherwise stated, the following terms shall be understood to have the following meanings. Unless otherwise defined herein, technical terms used in conjunction with the disclosed and / or claimed inventive concepts shall have the meanings commonly understood by one of ordinary skill in the art. Furthermore, unless the context requires otherwise, singular terms shall include plural forms, and plural terms shall include singular forms.

[0041] The singular indefinite and definite articles include the plural referent unless the context clearly indicates otherwise or the cited context clearly implies the opposite meaning. As used herein, the words “contain,” “have,” “include,” or “contain” are inclusive or open-ended and do not exclude additional, unlisted elements or steps of action.

[0042] Existing research in this field indicates that gene fusions are closely related to the occurrence and development of various diseases, especially cancer, and are even a direct cause of some cancers. Therefore, gene fusions have become an important research topic in current omics big data analysis. The US FDA has approved several drugs targeting specific gene fusions to treat corresponding cancers.

[0043] The RAS family is a family of small GTPases that play a crucial role in cell signal transduction. They regulate cell growth, differentiation, and various biological processes by switching between a GTP-bound active state and a GDP-bound inactive state. RAS family members include HRAS, KRAS, and NRAS, located on human chromosomes 11, 12, and 1, and exhibit highly conserved sequence homology and function. The activity of RAS proteins is regulated by GTP and GDP; they are activated upon GTP binding and participate in the regulation of multiple signaling pathways. The ERAS gene is the gene that expresses RAS in embryonic stem cells.

[0044] Since pediatric brain tumors are often associated with fusion genes, the inventors extracted RNA from tumor specimens and then reverse transcribed it into cDNA to obtain the fusion sites in 11 samples that should have been classified as "pediatric H3-wild-type and IDH-wild-type high-grade gliomas". Surprisingly, they found that two of the tumor samples carried ERAS gene fusions, and the ERAS fusion gene had not been reported in any domestic or international publications. The breakpoint of the RNA of the ERAS fusion gene was located at the 5' end of the second exon of ERAS.

[0045] Therefore, in a first aspect, the present invention provides a biomarker, the biomarker being an ERAS fusion gene, wherein the breakpoint of the ERAS fusion gene is located at the 5' end of the second exon of ERAS.

[0046] In one embodiment, the biomarker is HUWE1-ERAS as shown in SEQ ID NO.1 or PARD6G-ERAS as shown in SEQ ID NO.2.

[0047] The cDNA sequence of the HUWE1-ERAS fusion gene contains the nucleotide sequence shown below (SEQ ID NO.1):

[0048]

[0049] (fusion site)

[0050]

[0051]

[0052] The cDNA sequence of the PARD6G-ERAS fusion gene contains the nucleotide sequence shown below (SEQ ID NO.2):

[0053]

[0054] (fusion site)

[0055]

[0056] In a second aspect, the present invention provides a glioma detection agent for detecting biomarkers according to the first aspect of the present invention.

[0057] All detection reagents capable of detecting the ERAS fusion gene (e.g., HUWE1-ERAS and / or PARD6G-ERAS) described in this invention are within the scope of protection of this invention. Such detection reagents include, but are not limited to, specific primers for amplifying the ERAS fusion gene, probes for hybridizing with the nucleotide sequence of the ERAS fusion gene, etc.

[0058] In one embodiment, the detection agent comprises primers for HUWE1-ERAS: the forward primer shown in SEQ ID NO.3 and the reverse primer shown in SEQ ID NO.4, and primers for PARD6G-ERAS: the forward primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.6.

[0059] In one embodiment, the glioma is a high-grade glioma; in a specific embodiment, the glioma is a pediatric H3-wild-type and IDH-wild-type high-grade glioma.

[0060] In a third aspect, the present invention provides the use of an ERAS fusion gene detection agent in the preparation of a glioma detection agent or glioma detection kit, wherein the ERAS fusion gene is HUWE1-ERAS and / or PARD6G-ERAS.

[0061] In one embodiment, the glioma is a high-grade glioma; in a specific embodiment, the glioma is a pediatric H3-wild-type and IDH-wild-type high-grade glioma.

[0062] In one embodiment, the detection reagent for the ERAS fusion gene includes specific primers for amplifying the ERAS fusion gene and a probe for hybridizing with the nucleotide sequence of the ERAS fusion gene.

[0063] In one embodiment, the detection agent for the ERAS fusion gene includes primers for HUWE1-ERAS: the forward primer shown in SEQ ID NO.3 and the reverse primer shown in SEQ ID NO.4, and primers for PARD6G-ERAS: the forward primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.6.

[0064] In a fourth aspect, the present invention provides a system for diagnosing gliomas, wherein the system comprises at least:

[0065] The detection module is configured to detect biomarkers in the subject.

[0066] An assessment module is configured to assess the subject's disease status based on the detection results of the biomarkers obtained by the detection module;

[0067] The biomarkers are the expression products of HUWE1-ERAS and / or PARD6G-ERAS.

[0068] In one embodiment, the glioma is a high-grade glioma; in a preferred embodiment, the glioma is a pediatric H3-wild-type or IDH-wild-type high-grade glioma.

[0069] In one implementation, the assessment of the subject's condition includes evaluating the subject's diagnosis of glioma, the degree of malignancy of the glioma, and the survival time of glioma patients.

[0070] In a fifth aspect, the present invention provides the use of substances that inhibit the expression of ERAS fusion gene expression products and / or reduce their activity in the preparation of medicaments for treating gliomas, wherein the ERAS fusion gene is HUWE1-ERAS and / or PARD6G-ERAS.

[0071] In one embodiment, the glioma is a high-grade glioma, preferably a pediatric H3-wild-type or IDH-wild-type high-grade glioma.

[0072] In one embodiment, the substances that inhibit the expression of ERAS fusion gene expression products and / or reduce their activity include shRNA, siRNA, dsRNA, microRNA, antisense nucleic acid, and compound inhibitors.

[0073] In one embodiment, the compound inhibitor is a PAM inhibitor, preferably an AKT inhibitor, and more preferably GSK690693.

[0074] Example

[0075] Example 1 - Detection and validation of ERAS fusion in pediatric high-grade gliomas

[0076] ERAS fusions were detected using the Clin-fuse algorithm. RNA-seq and DNA methylation microarray data were collected from 27 tumor samples suspected of being juvenile H3-wild-type and IDH-wild-type high-grade gliomas. Based on the DKFZ MNP DNA methylation classification method, 11 of the 27 cases were ultimately identified as "juvenile H3-wild-type and IDH-wild-type high-grade gliomas". Surprisingly, despite the small cohort size, 2 of these 11 tumor samples carried ERAS gene fusions. Figure 1 ).

[0077] Furthermore, the inventors extracted RNA from the two tumor samples, reverse transcribed it into cDNA, and further verified the presence of ERAS gene fusions, namely HUWE1-ERAS and PARD6G-ERAS, in the two tumor samples using polymerase chain reaction (PCR) and Sanger sequencing. Figure 2 ).

[0078] The primer sequences are as follows:

[0079] HUWE1-ERAS primers:

[0080] Forward primer: GACCTGAGTGGGTTAGTGATCC (SEQ ID NO.3)

[0081] Reverse primer: TAGGAATCCTGGATGGTGGGG (SEQ ID NO.4)

[0082] PARD6G-ERAS primers

[0083] Forward primer: CTTGCGATTCTACGATTGCAGC (SEQ ID NO.5)

[0084] Reverse primer: CCACCACAGCCTTGTACTCAG (SEQ ID NO.6)

[0085] The amplification conditions are as follows:

[0086] Step 1: 95 degrees Celsius for 5 minutes

[0087] Step 2: (35 loops)

[0088] 95 degrees Celsius for 30 seconds, 55 degrees Celsius for 30 seconds, 72 degrees Celsius for 40 seconds

[0089] Step 3: 72 degrees Celsius for 10 minutes

[0090] The amplified product is stored in a refrigerator, and then Sanger sequencing is performed using reverse transcription primers.

[0091] Example 2 - Identification of ERAS fusions in other cancer types

[0092] In addition to "childhood H3-wild-type and IDH-wild-type high-grade gliomas," the inventors have also detected ERAS fusions in many other types of cancer, including lung cancer, gastric cancer, prostate cancer, medulloblastoma, osteoblastoma, and ovarian cancer. Figure 3 Both men and women can carry ERAS fusions, and the age range spans from childhood to adulthood. The genome-wide distribution of detected ERAS fusions is shown below. Figure 4As shown. It is worth noting that the target genes for fusion are mainly distributed on the X chromosome where the ERAS gene is located, but other chromosomes may also be involved, including chromosomes 1, 6, 18, 19, 21, and 22.

[0093] Example 3 - Structure of ERAS fusion transcript

[0094] Although ERAS fusions involve different target genes, their breakpoints in ERAS are the same. Figure 5 More specifically, the breakpoint at the RNA level is always at the 5' end of the second exon of the ERAS. In fusion-related cases, the breakpoint is mostly located in the first 1-2 exons, with the 5'utr region being the breakpoint. Therefore, the functional domains of the ERAS, including the ras-like family domains and the GTP / Mg2+ binding site, are completely preserved in the fusion case.

[0095] Example 4 - ERAS fusion induces ERAS expression and activates the PI3K-AKT-mTOR pathway. In gliomas, the promoter region of the ERAS gene is highly methylated, therefore ERAS expression in gliomas is almost zero. Figure 6 However, in samples with ERAS fusion, due to changes in the promoter region, ERAS expression is activated, leading to significant increases in ERAS expression when the original promoter is methylated. Figure 7-8 This activation is commonly observed in a variety of cancer types. Figure 9 ).

[0096] As a member of the Ras family, ERAS binds to and activates phosphatidylinositol-3-OH kinase, but not raf. In HA and 22-1 cells, we observed that ERAS promotes AKT phosphorylation, thereby activating the PI3K-AKT-mTOR pathway. Figure 10-11 At the same time, we also observed pathway activation at the transcriptome level. Figure 12-13 ).

[0097] Example 5 - ERAS fusion promotes cell proliferation

[0098] ERAS is an oncogene containing the same amino acid sequence as the active RAS mutant, and its protein is in a state of persistent self-activation. Compared with ERAS fusion-negative samples, samples carrying the ERAS fusion gene upregulated multiple cell cycle and embryonic development-related genes, such as CCND1, MYCN, SOX4, SOX8, and SOX10. Figure 14Other upregulated genes include OLIG1 and PDGFRA, which are known markers of oligodendrocyte progenitors. Therefore, gene set enrichment analysis showed that the MYC target, G2M checkpoint, and E2F target were activated in ERAS fusion tumors, indicating higher cell proliferation capacity. Figure 15 ).

[0099] To further explore the function of ERAS activation in gliomas, the inventors overexpressed ERAS in immortalized human astrocytes (HA) and patient-derived glioma stem cell spheres (22-1). Cell growth rates were investigated using cell proliferation and colony formation assays, revealing that ERAS overexpression significantly promoted cell proliferation in both HA and 22-1 cells. Figure 16-17 ).

[0100] Example 6 - AKT inhibitors can effectively inhibit the growth of ERAS-positive cells

[0101] To identify potential drugs for ERAS fusion-positive cancer patients, the inventors designed a computational algorithm ( Figure 18 This algorithm assumes that potential drugs can reverse transcriptomic changes caused by ERAS overexpression. Therefore, the first step is to compare the transcriptomes of cells with high ERAS expression and those without to identify transcriptional signatures associated with ERAS expression. Then, it searches the LINCS1000 database for small molecules that can induce transcriptional signatures opposite to those caused by ERAS expression. This method successfully predicted and identified several small molecules, with the most prominent candidate molecules mostly falling into the category of PAM inhibitors. Figure 19 Therefore, the inventors screened six inhibitors (Sapanisertib, GSK-1059615, MK-1775, BGT-226, GSK690693, CGP-60474), and determined the AKT inhibitor GSK690693 (which significantly inhibited the growth of 22-1 ERAS-OE cells) by measuring the effects of different drugs on the proliferation rate of cells expressing and not expressing ERAS. Figure 20 ).

Claims

1. A biomarker, wherein the biomarker is an ERAS fusion gene, and the breakpoint of the ERAS fusion gene is located at the 5' end of the second exon of ERAS, such as HUWE1-ERAS shown in SEQ ID NO.1 or PARD6G-ERAS shown in SEQ ID NO.

2.

2. A glioma detection agent, said detection agent being used to detect biomarkers according to claim 1, for example, said glioma being a juvenile H3-wild-type or IDH-wild-type high-grade glioma.

3. The glioma detection reagent of claim 2, wherein the detection reagent comprises specific primers for amplifying the biomarker and probes for hybridizing with the nucleotide sequence of the biomarker, for example, the detection reagent comprises primers for HUWE1-ERAS: the forward primer shown in SEQ ID NO.3 and the reverse primer shown in SEQ ID NO.4, and primers for PARD6G-ERAS: the forward primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.

6.

4. The use of ERAS fusion gene detection agents in the preparation of glioma detection agents or glioma detection kits, wherein the ERAS fusion gene is HUWE1-ERAS and / or PARD6G-ERAS.

5. The use as claimed in claim 4, wherein the glioma is a high-grade glioma, such as juvenile H3-wild-type and IDH-wild-type high-grade gliomas.

6. The use according to any one of claims 4 or 5, wherein the detection agent for the ERAS fusion gene comprises specific primers for amplifying the ERAS fusion gene and probes for hybridizing with the nucleotide sequence of the ERAS fusion gene, for example, the detection agent comprises primers for HUWE1-ERAS: the forward primer shown in SEQ ID NO.3 and the reverse primer shown in SEQ ID NO.4, and primers for PARD6G-ERAS: the forward primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.

6.

7. A system for diagnosing gliomas, wherein the system comprises at least: The detection module is configured to detect biomarkers in the subject. An assessment module is configured to assess the subject's disease status based on the detection results of the biomarkers obtained by the detection module; The biomarkers are the expression products of HUWE1-ERAS and / or PARD6G-ERAS. Preferably, the glioma is a high-grade glioma, more preferably a pediatric H3-wild-type or IDH-wild-type high-grade glioma.

8. The system of claim 7, wherein the assessment of the subject's condition includes assessing the subject's diagnosis of glioma, the degree of malignancy of the glioma, and the survival time of the glioma patient.

9. Use of substances that inhibit the expression of ERAS fusion gene expression products and / or reduce their activity in the preparation of medicaments for the treatment of gliomas, wherein the ERAS fusion gene is HUWE1-ERAS and / or PARD6G-ERAS. in, The glioma is preferably a high-grade glioma, more preferably a pediatric H3-wild-type or IDH-wild-type high-grade glioma.

10. The use as described in claim 9, wherein the substance that inhibits the expression of the ERAS fusion gene expression product and / or reduces its activity includes shRNA and siRNA. dsRNA, microRNA, antisense nucleic acid, and compound inhibitors.

11. The use as described in claim 10, wherein the compound inhibitor is a PAM inhibitor, preferably an AKT inhibitor, and more preferably GSK690693.

Images