Primer group and kit for detecting pet lepidobacterium

By using real-time quantitative PCR technology and specific primer sets to detect Chlamydia trachomatis in pets, the problem of long detection time and low efficiency in pet Chlamydia trachomatis detection has been solved, achieving rapid, accurate, and low-cost detection of Chlamydia trachomatis in pets, which is suitable for pet hospitals.

CN121518677APending Publication Date: 2026-02-13NANJING ZHUOYI BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511980344.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-25
Publication Date
2026-02-13

AI Technical Summary

Technical Problem

Existing methods for detecting Chlamydia trachomatis in pets are time-consuming, inefficient, and costly, making it difficult to diagnose quickly and accurately in the early stages.

Method used

Real-time quantitative PCR technology was used to design a highly specific primer set to detect the 6BC gene of Chlamydia vesiculosus. The nucleic acid was extracted by centrifugation column method and qPCR reaction was performed using SYBR qPCR Mix and internal control primers. The reaction conditions were optimized to ensure high sensitivity and specificity.

Benefits of technology

It enables rapid, accurate, and low-cost diagnosis of chlamydia in pets, providing results within 2 hours. This improves testing efficiency and reduces the requirements for testing platforms and personnel, making it suitable for widespread adoption in pet hospitals.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121518677A_ABST
    Figure CN121518677A_ABST
Patent Text Reader

Abstract

The invention discloses a primer group for detecting pet lepidobacterium and application of the primer group. The primer group comprises primer sequences as shown in SEQ ID NO: 1-4. The method comprises the following steps: extracting DNA of a sample to be detected by using a respiratory tract sample nucleic acid extraction kit, carrying out qPCR reaction by using the primer group by taking the DNA of the sample to be detected as a template to obtain an amplification curve, and if the Ct value of the amplification curve of the sample to be detected is 0 lt; ctt, Ctt; the Ct value of the internal control primer is 1t; and 40, determining that the interpretation result is positive, and indicating that the sample to be detected contains the dracocephalum molpadioides. According to the invention, a primer sequence with high sensitivity and specificity is adopted, so that the quality of a detection result is ensured; the detection method is simple to operate, time-saving and labor-saving; the detection flux is high, and the reagent consumable cost is low.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a primer set and kit for detecting Chlamydia trachomatis in pets. Background Technology

[0002] Chlamydia psittaci is a type of Gram-negative obligate intracellular parasite. Its cell structure is unique, possessing an outer membrane similar to a cell wall, primarily composed of proteins and lipopolysaccharides. This bacterium lacks the ability to synthesize ATP (adenosine triphosphate) and relies on the host cell for energy and nutrients to complete its life cycle. Chlamydia invades cells in two forms: the elementary body (EB), a highly infectious form that adheres to the host cell surface and enters the cell via endocytosis. Once inside the host cell, the elementary body transforms into a reticulate body (RB). The reticulate body utilizes the host cell's nutrients and reproduces through binary fission, producing numerous progeny elementary bodies.

[0003] Chlamydia infection is relatively common in pets. In birds, infection can cause lethargy, difficulty breathing, and diarrhea. It can spread among birds and may also be transmitted to humans. In cats and dogs, chlamydia can cause conjunctivitis, respiratory diseases, and reproductive system disorders. The symptoms of chlamydia infection in pets are similar to those of common respiratory viral infections; therefore, early, rapid, and accurate diagnosis of the source of infection is crucial for selecting appropriate antibacterial drugs and timely treatment.

[0004] Traditional methods for detecting Chlamydia trachomatis in pets include cell culture, enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay, and conventional PCR. However, these methods have drawbacks such as being time-consuming, difficult to culture, having low sensitivity, and high cost. The results are often delayed and the accuracy is not high, which may delay the best treatment time for pets that urgently need diagnosis and treatment.

[0005] Quantitative real-time PCR (qPCR) technology recognizes highly specific target primers and, under the action of hot-start DNA polymerase, amplifies the target nucleic acid as a template through cyclic amplification. The amount of target nucleic acid increases exponentially with each cycle. Even if the sample contains only a very small amount of pathogen nucleic acid, a sufficiently strong fluorescence signal can be generated for detection after multiple cycles. In the early stages of infection when viral load is low, qPCR can detect the presence of the virus earlier than traditional detection methods. This high sensitivity makes qPCR irreplaceable for the early diagnosis of pathogens and the screening of asymptomatic carriers, helping to promptly identify potential sources of infection, buying valuable time for disease control, and can be used for large-scale screening. The qPCR method used in this invention for detecting Chlamydia suis in pets has the characteristics of high sensitivity, strong specificity, and fast speed, while also offering advantages such as low cost, ease of operation, and high efficiency. Summary of the Invention

[0006] The purpose of this invention is to solve the problems of long detection cycle, low detection efficiency and high detection cost in existing pet chlamydia detection technologies, and to provide a new primer set and method for pet chlamydia detection, so as to improve the problems of low detection efficiency and high detection cost in related detection technologies.

[0007] To achieve the above objectives, the present invention provides a qPCR primer set for detecting Chlamydia suis, wherein the primer set includes primers as shown in Table 1 below.

[0008] This invention provides a primer set for detecting Chlamydia suis in pets. The target gene detected by the primer set is the CPSIT_02830 region of the Chlamydia suis 6BC gene, which is a unique fragment of Chlamydia suis.

[0009] The primer set includes primer sequences as shown in SEQ ID NO:1~4.

[0010] The use of the primer set for detecting Chlamydia suis in the preparation of reagents for detecting Chlamydia suis.

[0011] A primer set and kit for detecting Chlamydia suis in pets, the kit containing primer sets as shown in SEQ ID NO:1~4.

[0012] It also includes a nucleic acid extraction kit for respiratory samples to be tested, 2× SYBR qPCR Mix, internal control primers and corresponding templates.

[0013] The internal control primer is:

[0014] F2: TCAAGCTCAGCAACATGAAC, as shown in SEQ ID NO:3;

[0015] R2: AGGTGTGCGATGGCGTCCTTG, as shown in SEQ ID NO:4.

[0016] Template sequence:

[0017] AGGTGTGCGATGGCGTCCTTGATCATCTTCACGCGCGTGTCGTCGTCGACGCGGCGGACCTCGATCTCGTTCTCCATCTTGTCGTGGAACCTGCTGACGCGCTGGTTCATGTTGCTGAGCTTGA, as shown in SEQ ID NO:5.

[0018] In the reaction system, 2 μL of the internal control primer mixture (final concentration 0.5 μmol / L).

[0019] The present invention provides a method for detecting Chlamydia psittaci in pets, and the method comprises the following steps:

[0020] (1) Extract the DNA of the test sample using a respiratory sample nucleic acid extraction kit;

[0021] (2) Using the DNA as a template and using the primer set or kit of the present invention, perform a qPCR reaction. The reaction system includes 10 μL of 2× SYBR qPCR Mix, 2 μL of the above-mentioned Chlamydia psittaci primer mixed solution, and 8 μL of the DNA template of the test sample to be detected.

[0022] (3) The reaction amplification conditions are pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing / extension at 60°C (collecting fluorescence signals) for 30 s, and reacting for 45 cycles to obtain an amplification curve after qPCR amplification;

[0023] If the Ct value of the internal control primer > 40, re-detection is required;

[0024] If the Ct value of the amplification curve of the test sample, if Ct value > 38 or NoCt, and the Ct value of the internal control primer < 40, the interpretation result is negative, indicating that there is no Chlamydia psittaci in the test sample;

[0025] If the Ct value of the amplification curve of the test sample is: 0 < Ct < 35, and the Ct value of the internal control primer < 40, the interpretation result is positive, indicating that the test sample contains Chlamydia psittaci.

[0026] This method uses a centrifugal column method nucleic acid extraction kit to extract nucleic acid from respiratory samples, and the PCR inhibitors in the obtained DNA samples have been basically removed. The primer set provided by this method has been carefully designed and tested multiple times. There will be no cross-amplification reaction between primer sets and no dimer is generated between primers. Positive and negative controls are added during detection to ensure the reliability of the detection results.

[0027] This invention provides a primer set for detecting Chlamydia trachomatis in pets and establishes a qPCR detection method based on a real-time quantitative PCR platform. This invention employs highly sensitive and specific primer sequences to ensure the quality of detection results; the detection method is simple to operate, saving time and effort; it has high throughput and low reagent and consumable costs; it can directly detect respiratory samples, and compared to traditional detection methods, results can be obtained within 2 hours, greatly shortening the detection time; it has low requirements for the detection platform and personnel, and can be widely promoted in veterinary hospitals. Attached Figure Description

[0028] Figure 1 This is the experimental result of detecting Chlamydia trachomatis according to the present invention, wherein 1 is Chlamydia trachomatis, 2 is the internal control primer, and 3 is the blank control.

[0029] Figure 2 The results are the primer specificity detection results of this invention, where 1 is a sample containing Chlamydia trachomatis, 3-7 are feline calicivirus, feline herpesvirus, feline mycoplasma, feline chlamydia, and feline bronchodilator, respectively, 2 is the internal control primer, and 8 is the blank control.

[0030] Figure 3 These are the primer sensitivity test results of this invention, where 1-6 represent different concentrations of Chlamydia plasmid DNA template (10... 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 copies / μL, 1 copies / μL). Detailed Implementation

[0031] To better understand the present invention, the following embodiments further illustrate its content, but should not be construed as limiting the scope of protection of the present invention. Any non-essential improvements and adjustments made by those skilled in the art based on the above-described invention are within the scope of protection of the present invention.

[0032] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the invention. The embodiments include the following steps:

[0033] 1. DNA extraction from the sample to be tested

[0034] This detection method obtains DNA from respiratory samples from pets. DNA extraction is performed using a commercial centrifuge column nucleic acid extraction kit, following the kit's instructions. The extracted DNA sample can be stored in a 1.5 mL centrifuge tube at 4°C for later use.

[0035] 2. Primer design and synthesis

[0036] This invention provides a primer set for detecting Chlamydia suis in pets, wherein the primer set includes primers for detecting the genes shown in Table 1.

[0037] Referring to the conserved region CPSIT_02830 of the *Chlamydomonas* 6BC gene sequence published in GenBank, a *Chlamydomonas*-specific sequence, specific primers were designed using Primer Premier 6 software. The designed primers were preliminarily validated using BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and Primer-LAST (https: / / www.nc-bi.nlm.nih.gov / tools / primer-blast / ). All primers were synthesized by Suzhou Genewiz Biotechnology Co., Ltd. This method compares the target gene of different isolates of the target pathogen to select conserved regions for primer design. Dimer analysis and amplicon analysis were performed on the designed primer sets to ensure no cross-amplification between primer sets and to avoid false positives.

[0038] Table 1 qPCR reaction primers

[0039]

[0040] 3. qPCR reaction

[0041] The reaction system was prepared as follows: 10 μL of 2×SYBR qPCR Mix, 2 μL of the above Chlamydia primer mixture, and 8 μL of DNA template from the sample to be tested.

[0042] The qPCR amplification conditions include the following steps: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing / extension (collecting fluorescence signal) for 30 s, for 45 cycles, to obtain the amplification curve after qPCR amplification.

[0043] 4. Interpretation of test results

[0044] The present invention relates to a method for judging the results of a detection method for detecting Chlamydia trachomatis in pets:

[0045] (1) Using the total DNA as a template and the primer set described in the present invention, perform qPCR reaction to obtain an amplification curve after qPCR amplification;

[0046] If the Ct value of the internal control primer > 40, re-detection is required;

[0047] If the Ct value of the amplification curve of the test sample, if the Ct value > 38 or NoCt, and the Ct value of the internal control primer < 40, the result is judged as negative, indicating that there is no Chlamydia in the test sample;

[0048] If the Ct value of the amplification curve of the test sample is: 0 < Ct < 35, and the Ct value of the internal control primer < 40, the result is judged as positive, indicating that the test sample contains Chlamydia.

[0049] Example 1

[0050] Primer design and synthesis

[0051] Referring to the Chlamydia 6BC gene sequence published in GenBank, use Primer Premier 6 software to design respective specific primers, and preliminarily verify the designed primers through BLAST (https: / / blast.ncbi.nlm.nih.gov- / Blast.cgi) and Primer-LAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). After optimization, the primer sequences are shown in Table 1.

[0052] Example 2

[0053] Optimization of Chlamydia qPCR reaction conditions and method establishment

[0054] (1) Optimization of the annealing temperature of the system: Set 3 annealing temperatures of 58°C, 60°C and 62°C. The results show that the amplification effect of the system is the best when the annealing temperature is 60°C.

[0055] (2) Optimization of the qPCR amplification system: Optimize the addition amount and cycle number of each component of the real-time fluorescence quantitative PCR amplification system. The results show that the best PCR amplification system is as follows: The reaction system includes 10 μL of 2× SYBR qPCR Mix, 2 μL of primer mixed solution (the final concentration of the primer is 0.5 μmol / L), and 8 μL of DNA template of the test sample. Real-time fluorescence quantitative amplification conditions: Pre-denaturation at 95°C for 5 min; Denaturation at 95°C for 15 s, annealing at 60°C for 30 s (collect fluorescence signal), extension at 72°C for 15 s, and cycle amplification for 45 times.

[0056] (when) After the qPCR reaction, obtain an amplification curve, as Figure 1.

[0057] Example 3

[0058] Specific detection

[0059] The samples used in this invention are pet respiratory samples. Total nucleic acid was extracted from the respiratory samples using a kit (the kit used in this embodiment is the "Centrifugation Column Nucleic Acid Extraction Kit", catalog number TL-NEK01, purchased from TianSai (Shanghai) Technology Co., Ltd.). These samples may contain nucleic acids from various respiratory pathogens. To test the specificity of the primers used in this invention, five non-target respiratory pathogen plasmids were selected as simulated interference samples: feline calicivirus, feline herpesvirus, feline mycoplasma, feline chlamydia, and *Bordetella bronchiseptica*. Based on the optimized amplification conditions for qPCR, the aforementioned *Chlamydia* primers were used to detect samples containing these five irrelevant respiratory pathogens, as well as samples containing *Chlamydia*. The results showed that only the *Chlamydia* sample exhibited a typical S-shaped amplification curve; the others did not show an amplification curve, indicating that the established detection method has good specificity. Figure 2 .

[0060] Example 4

[0061] Sensitivity detection

[0062] A Chlamydia plasmid vector was constructed to obtain a standard plasmid. As a further limitation based on Example 2, the kit in this example includes the compositions shown in Table 1. The kit with the above formulation was used to detect high concentrations (10... 5 The results showed that this primer combination could effectively detect target gene concentrations as low as 10 copies / μL, such as (copies / μL) to low concentrations (1 copies / μL). Figure 3 .

[0063] As fully illustrated by the above embodiments, this invention, as a highly sensitive, specific, and easy-to-operate qPCR detection method, can efficiently detect Chlamydia trachomatis in pet respiratory samples. It has certain development, utilization, and promotion value and can provide technical support for the clinical diagnosis of Chlamydia trachomatis in pets.

[0064] The above description, in conjunction with specific embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection defined by the claims submitted herein.

Claims

1. A primer set for detecting Chlamydia trachomatis in pets, characterized in that, The primer set includes a pair of Chlamydia primers F1 and R1 and a pair of internal control primers F2 and R2; The nucleic acid sequences of the two primers in the Chlamydia primer pair are shown in SEQ ID NO:1 or 2, respectively; The nucleic acid sequences of the two primers in the internal control primer pair are shown as SEQ ID NO:3 or 4, respectively.

2. The use of the primer set of claim 1 in the preparation of reagents or kits for the detection of Chlamydia suis in pets.

3. A kit for detecting Chlamydia trachomatis in pets, characterized in that, It includes the primer set as described in claim 1.

4. The kit for detecting Chlamydia trachomatis in pets according to claim 3, characterized in that, It also includes nucleic acid extraction reagents for the samples to be tested and 2× SYBR qPCR Mix.

5. The kit for detecting Chlamydia trachomatis in pets according to claim 3, characterized in that, It also includes internal control primers and corresponding templates.

6. The kit for detecting Chlamydia trachomatis in pets according to claim 5, characterized in that, The internal control primer is: F2: TCAGCTCAGCAACATGAAC, as shown in SEQ ID NO:3; R2: AGGTGTGCGATGGCGTCCTTG, as shown in SEQ ID NO:

4.

7. A method for detecting Chlamydia trachomatis in pets, characterized in that, The method includes the following steps: (1) Extract DNA from the sample to be tested; (2) Using the sample DNA as a template, and using the primer set described in claim 1 or the kit described in claim 3, perform qPCR reaction to obtain the amplification curve after qPCR amplification.

8. The method for detecting Chlamydia suis in pets according to claim 7, characterized in that, The reaction system included 10 μL of 2×SYBR qPCR Mix, 1 μL each of Chlamydia trachomatis upper and lower primers, and 8 μL of DNA template from the sample to be tested.

9. The method for detecting Chlamydia suis in pets according to claim 7, characterized in that, The reaction amplification conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s; 60℃ annealing / extension for 30 s; and 45 cycles of reaction.