Methods for producing multiple polynucleotides

Abstract

The present application relates to methods and kits for producing a plurality of polynucleotides from a single-stranded nucleic acid comprising a plurality of polynucleotides and at least one cleavable linker comprising two different special nucleotides and using two different endonucleases, the first endonuclease cleaves the 5'end of the first special nucleotide and the second endonuclease cleaves the 3 'end of the second special nucleotide, thereby releasing traceless polynucleotides without cleavable linkers.

Description

[0001] The present invention relates to a method and a kit-of-parts for generating a plurality of polynucleotides from a single-stranded nucleic acid.

[0002] BACKGROUND

[0003] With the development of polynucleotide synthesis technology, the throughput of synthesizing a plurality of polynucleotides on the same solid support has increased from 48 primer pairs synthesized in a 96-well plate to 96, 192, 288, 384 or more primer pairs synthesized on the same 96-well plate. At the same time, it is also possible to synthesize single-stranded nucleic acids of more than a hundred nucleotides forming several consecutive polynucleotides, wherein each polynucleotide is separated from the previous polynucleotide by a cleavage site. Enzymatic cleavage (Hitchcock et al., Nucleic Acids Research 2004, 32(13), 4071-4080), chemical cleavage (Horn et al, Nucleosides and Nucleotides, 1991, 10:299-302) or photo-cleavage (Agasti et al ., Journal of the American Chemical Society, 2012, 134(45), 18499-18502; Horn et al, 1991) enables the release of individual polynucleotides. However, the released polynucleotides can remain “scarred” (see definition of “scar-free polynucleotides” below), which hinders their use in biological applications. Therefore, additional processing is necessary to eliminate these scars. These additional processing can be time-consuming and / or expensive, thereby reducing the advantages of these methods.

[0004] Therefore, there is a need to develop cost-effective methods for generating a plurality of scar-free polynucleotides from a single-stranded nucleic acid. SUMMARY

[0005] By studying this problem, the inventors of the present application have found that special nucleotides can be advantageously used to form a cleavable junction that, in combination with specific endonucleases, can allow the release of scarless polynucleotides from a single-stranded nucleic acid comprising a plurality of polynucleotides. In particular, the inventors of the present application have designed a specific cleavable junction for isolating two adjacent polynucleotides of interest in a single-stranded nucleic acid. The cleavable junction of the present application comprises two different special nucleotides (as further defined below) that can be cleaved by different endonucleases. Thus, the inventors of the present application have developed a method that sequentially or simultaneously combines the cleavage activity of two different endonucleases (e.g. endonuclease Q (Endo Q) and endonuclease V (Endo V)) that are able to cleave the 5' end of a first special nucleotide and the 3' end of a second special nucleotide, respectively. These special nucleotides are, for example, deoxyuracil (dU) and deoxyinosine (dl), respectively. The method of the present application is performed on a single-stranded nucleic acid comprising a plurality of polynucleotides, at least two adjacent polynucleotides of which are separated by a cleavable junction of the present application comprising two different special nucleotides. The method results in the release of one or more scarless polynucleotides.

[0006] The present application relates to a method and a kit-of-parts for producing a plurality of polynucleotides, in particular a plurality of scarless polynucleotides, from a single-stranded nucleic acid.

[0007] In one aspect, the present application relates to a method for producing a plurality of polynucleotides from a single-stranded nucleic acid, the method comprising the steps of: (a) providing a single-stranded nucleic acid comprising a plurality of polynucleotides and at least one cleavable junction linking at least two adjacent polynucleotides of the single-stranded nucleic acid, the cleavable junction having two different special nucleotides, the special nucleotides each having a base selected from the group consisting of inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, 8-oxoguanine, nitroindole and thymine glycol; (b) contacting the single-stranded nucleic acid with at least one endonuclease capable of cleaving the single-stranded nucleic acid near the 5' end of a first special nucleotide of the cleavable junction and at least one endonuclease capable of cleaving near the 3' end of a second special nucleotide of the cleavable junction, so as to release at least two adjacent polynucleotides of the single-stranded nucleic acid, the released polynucleotides being free of the cleavable junction.

[0008] In some embodiments, the single-stranded nucleic acid is sequentially contacted with at least one endonuclease capable of cleaving the single-stranded nucleic acid near the 5' end of the first special nucleotide of the cleavable linker, and then with at least one endonuclease capable of cleaving near the 3' end of the second special nucleotide of the cleavable linker, or vice versa.

[0009] In some embodiments, the single-stranded nucleic acid is simultaneously contacted with at least one endonuclease capable of cleaving the single-stranded nucleic acid near the 5' end of the first special nucleotide of the cleavable linker and at least one endonuclease capable of cleaving near the 3' end of the second special nucleotide of the cleavable linker.

[0010] Another aspect of the application relates to a kit-of-parts for the enzymatic production of a plurality of polynucleotides. The kit-of-parts comprises: - a first endonuclease capable of cleaving near the 3' end of a special nucleotide having a base selected from the group consisting of inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, 8-oxoguanine, nitroindole and thymine diol; - a second endonuclease capable of cleaving near the 5' end of a special nucleotide having a base selected from the group consisting of inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, 8-oxoguanine, nitroindole and thymine diol.

[0011] In particular, the kit-of-parts of the application can further comprise: (i) any necessary reagents for the synthesis of the single-stranded nucleic acid, such as an initiator having a 3' terminal nucleotide comprising a free 3'-hydroxyl group, a template-free polymerase, a plurality of 3'-O-blocked nucleoside triphosphates, a deblocking agent, and a plurality of 3'-O-blocked special nucleotides each having a base selected from the group consisting of inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, 8-oxoguanine, nitroindole and thymine diol; and / or (ii) a single-stranded nucleic acid comprising a plurality of polynucleotides, wherein at least two adjacent polynucleotides of the single-stranded nucleic acid are separated by a cleavable linker comprising two different special nucleotides each having a base selected from the group consisting of inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, 8-oxoguanine, nitroindole and thymine diol.

[0012] The endonuclease capable of cleaving a single-stranded nucleic acid near the 3' end of a special nucleotide can be selected from endonuclease V, endonuclease VIII and / or endonuclease III. In a more particular embodiment, the endonuclease is endonuclease V.

[0013] The endonuclease capable of cleaving a single-stranded nucleic acid near the 5' end of a special nucleotide can be endonuclease Q, AGOG, modified AGOG without ligation activity, USER or UDG.

[0014] Another aspect of the application relates to an endonuclease V comprising an amino acid sequence which is at least 75% identical to the amino acid sequence of SEQ ID NO: 9, wherein the endonuclease V is capable of cleaving near the 3' end of a special nucleotide having a base selected from the group consisting of inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, nitroindole and thymine diol. In particular, the endonuclease V of the application comprises or consists of the amino acid sequence set forth in SEQ ID NO: 9 and is capable of cleaving near the 3' end of a special nucleotide having a base selected from the group consisting of inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, nitroindole and thymine diol. SUMMARY

[0016] Figure 1A An experimental design for the enzymatic release of two scarless polynucleotides ("Fwd" and "Rev" primers) from a single-stranded nucleic acid attached to a solid support is shown. It comprises "dIT" as a cleavable motif for endonuclease V (Endo V) to cleave the single-stranded nucleic acid from the support and "dUTTdIT" as a cleavable linker cleaved by two endonucleases (endonuclease V and endonuclease Q). Thus, these two enzymes are used to cleave the single-stranded nucleic acid into defined polynucleotides which can be subsequently purified.

[0017] Figure 1B Different cleavage products are shown which can be released from a single-stranded nucleic acid attached to and isolated from a solid support by using endonuclease V and / or endonuclease Q, wherein "dIT" as a cleavable motif and "dUTTdIT" as a cleavable linker between two adjacent polynucleotides of the single-stranded nucleic acid.

[0018] Figure 1C Different cleavage products are shown which can be released from a single-stranded nucleic acid attached to and isolated from a solid support by using endonuclease V and / or endonuclease Q, wherein "dIT" as a cleavable motif and "dUTTdIT" as a cleavable linker between two adjacent polynucleotides of the single-stranded nucleic acid. Figure 1Belectrophoresis data of cleavage products obtained by the method of

[0019] Figure 2 electrophoresis data of cleavage products mediated by endonuclease V and endonuclease Q when the "Fwd" and "Rev" polynucleotide sequences are separated from each other by an incomplete cleavable linker comprising only dIT or dU, or by a complete cleavable linker comprising first dU and then dIT, the dU and dIT being separated by (e.g., between the dU and dIT) the addition of 0, 1, or more nucleotide bases (e.g., thymine (T)). The black boxes indicate the two desired traceless polynucleotides released from the single-stranded nucleic acid of various designs. "NEC" refers to "no enzyme control." The cleavage products are visualized with an Oligo Pro II instrument after standard desalting purification.

[0020] Figure 3A electrophoresis data of cleavage products obtained when a single-stranded nucleic acid comprising two desired polynucleotides (i.e., "Fwd" and "Rev") separated from each other by a cleavable linker are cleaved by endonuclease V and endonuclease Q, respectively, or sequentially by endonuclease V and endonuclease Q. The black boxes indicate the desired traceless polynucleotide products. The cleavage products are visualized with an Oligo Pro II instrument after standard desalting purification.

[0021] Figure 3B electrophoresis data of polynucleotides obtained by the method of Figure 3A PCR products of polynucleotides obtained by the method of

[0022] Figure 4A shows a schematic of a method for making a spatially ordered primer pair. A starting material DNA attached to a solid support and comprising a free azido group is enzymatically synthesized into a single-stranded nucleic acid comprising at least a forward primer, a cleavable linker, and a reverse primer. The reverse primer comprises a special nucleotide that is identical to and reactive with the free azido group of click chemistry. After performing the click step, cleavage by Endo V and Endo Q results in a free linker and a pair of primers, both of which are spatially ordered primers attached to the solid support, for a downstream PCR amplification step.

[0023] Figure 4B shows Figure 4Aa variant of the above, wherein the synthesized polynucleotides do not comprise special nucleotides comprising a base (e.g., dl), and wherein no enzyme (e.g., Endo V) is used. In this embodiment, there is no release of free adapters. Rather, the adapters remain attached to the reverse primers in the form of a "tail". DETAILED DESCRIPTION

[0024] One aspect of the present invention relates to a method of producing a plurality of polynucleotides from a single-stranded nucleic acid, the single-stranded nucleic acid comprising the plurality of polynucleotides and at least one cleavable adapter comprising at least two different special nucleotides between at least two adjacent polynucleotides. The method involves the use of at least one endonuclease capable of cleaving the single-stranded nucleic acid near the 5' end of a first special nucleotide of the cleavable adapter and at least one endonuclease capable of cleaving near the 3' end of a second special nucleotide of the cleavable adapter.

[0025] The inventors of the present application have demonstrated that the combined cleavage activity of endonuclease Q (Endo Q) and endonuclease V (Endo V) can effectively release two or more polynucleotides from a single-stranded nucleic acid, wherein the polynucleotides are connected to each other by a cleavable adapter comprising two different special nucleotides, each having a base such as: inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, nitroindole, and thymine glycol. More specifically, the inventors of the present application have designed a specific cleavable adapter comprising two different special nucleotides that can be used to separate two adjacent polynucleotides in a single-stranded nucleic acid. This cleavable adapter allows for the release of polynucleotides with intact 5' phosphate and / or 3' hydroxyl groups. Thus, the combination of endonuclease Q and endonuclease V, or more generally, an endonuclease capable of cleaving the single-stranded nucleic acid near the 5' end of a first special nucleotide of the cleavable adapter and an endonuclease capable of cleaving near the 3' end of a second special nucleotide of the cleavable adapter allows for the release of scarless polynucleotides.

[0026] The molar ratio of free polynucleotides can be precisely controlled by manipulating the number of each polynucleotide in the single-stranded nucleic acid, each polynucleotide separated from another by a cleavable adapter. For example, an equal number of each polynucleotide in the single-stranded nucleic acid will result in an equimolar ratio of two free polynucleotides when resolved at the cleavable adapter. A 2: 1 ratio of two polynucleotides in the single-stranded nucleic acid will result in a 2: 1 molar ratio of two free polynucleotides when resolved at the cleavable adapter, and so on. This unique advantage of the present invention proves very useful for downstream experiments of the free polynucleotides produced using the method of the present invention, for example, where equimolar amounts of forward and reverse primers are required for a downstream PCR reaction.

[0027] The present disclosure will be best understood by reference to the following definitions.

[0028] Definitions

[0029] As used herein, the term "single-stranded nucleic acid" means a linear single-stranded deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) comprising natural nucleotides and / or non-natural nucleotides. For DNA, the natural nucleotides are, for example, deoxyadenosine (A), deoxycytidine (C), deoxyguanosine (G), or deoxythymidine (T), or for RNA, their ribose counterparts. Non-natural nucleotides include modified bases, sugars, peptide nucleic acids (PNAs), phosphorothioate internucleosidic linkages, or bases containing a linking group that allows attachment of a tag such as a fluorophore or hapten. Examples of nucleotides useful in the present invention are nucleotides having a base selected from the group consisting of inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, 8-oxoguanine, nitroindole, and thymine glycol.

[0030] The single-stranded nucleic acid comprises a plurality of polynucleotides. The term "polynucleotide" refers to a linear polymer of nucleotide monomers. A polynucleotide can comprise a few nucleotides to several thousand nucleotides. In particular, a polynucleotide can be 5-100 nucleotides or more in size. The polynucleotide can be a polydeoxyribonucleotide consisting of deoxyribonucleotides, or a polyribonucleotide consisting of ribonucleotides, or a nucleic acid comprising both deoxyribonucleotides and ribonucleotides. The polynucleotide can comprise natural nucleotides as defined above, or both natural and non-natural nucleotides.

[0031] In the context of the present invention, the term "special nucleotide" refers to a nucleotide that is a natural nucleotide different from A, T, C, G, or a non-natural nucleotide. In particular, a special nucleotide refers to a nucleotide having a base selected from the group consisting of inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, 8-oxoguanine, nitroindole, and thymine glycol. Particular examples of special nucleotides are deoxyuracil (dU) or deoxyinosine (dl).

[0032] The term "vicinity of the 5' end" means within a range of 5, 4, 3, 2, or 1 nucleotides before the 5' end of the special nucleotide, or exactly the 5' end. The term "vicinity of the 3' end" means within a range of 5, 4, 3, 2, or 1 nucleotides after the 3' end of the special nucleotide, or exactly the 3' end.

[0033] The term "released polynucleotide" refers to a polynucleotide that is cleaved from a single-stranded nucleic acid.

[0034] The term "scarless polynucleotide" refers to a polynucleotide that contains an intact 5'-phosphate and 3'-hydroxyl group and that does not have any cleavable linker or portion thereof.

[0035] "Single stranded nucleic acid" of step (a)

[0036] The inventors of the present application have developed a special linear single-stranded nucleic acid comprising a plurality of polynucleotides, wherein at least two adjacent polynucleotides are separated by a cleavable linker.

[0037] The single-stranded nucleic acid of the present application can typically comprise 15 to 1000 nucleotides, in particular 18 to 800 nucleotides, more in particular 20 to 600 nucleotides, 20 to 500 nucleotides, 20 to 400 nucleotides, more in particular 25 to 300 nucleotides. The contiguous nucleotides form a plurality of polynucleotides and at least one cleavable linker.

[0038] According to the present application, the single-stranded nucleic acid comprises at least 2 polynucleotides of interest, in particular 2 to 20 polynucleotides, more in particular 2 to 12 nucleotides, more in particular 2 to 11, 2 to 10, 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4 polynucleotides. In some embodiments, the single-stranded nucleic acid comprises 2, 4, 6, 8 or 10 polynucleotides. All or some of the plurality of polynucleotides can have a predetermined or random sequence. For example, at least 2 polynucleotides of the plurality of polynucleotides have a sequence corresponding to the sequence of a pair of PCR primers of a gene of interest. In some embodiments, the single-stranded nucleic acid comprises 4, 6, 8 or more polynucleotides of interest, the sequence of which corresponds to the sequence of primers of a multiplex PCR. In another embodiment, the single-stranded nucleic acid comprises a plurality of polynucleotides, the sequence of which corresponds to the sequence of primers of a qPCR.

[0039] In other embodiments, the single-stranded nucleic acid comprises one or more polynucleotides comprising a degenerate (random) sequence. Such degenerate sequences are widely used in the art and are sometimes referred to as, for example, DNA barcodes or UMIs (unique molecular identifiers). The skilled person will readily understand how to design a single-stranded nucleic acid comprising at least 2 polynucleotides, wherein one or more of these polynucleotides comprise a barcode, UMI or any other degenerate sequence.

[0040] In the linear single-stranded nucleic acid, at least two adjacent polynucleotides are separated from each other by a cleavable linker. This means that the two polynucleotides extend contiguously in the nucleic acid and are connected to each other in the order "polynucleotide / cleavable linker / polynucleotide".

[0041] In particular embodiments, each polynucleotide of the plurality of polynucleotides is linked to an adjacent polynucleotide by a cleavable linker.

[0042] In the context of the present invention, the term "cleavable linker" refers to a part of a nucleic acid that connects two adjacent polynucleotides and that can be cleaved under pre-determined conditions. The cleavable linker comprises two special nucleotides that are specifically recognized by two different endonucleases used in step (b) of the method of the present invention. The term "recognized" as used herein means identified by an endonuclease as a binding and / or cleavage site. The first special nucleotide is recognized by an endonuclease that is able to cleave near the 5' end of the special nucleotide, and the second special nucleotide is recognized by an endonuclease that is able to cleave near the 3' end of the special nucleotide. Advantageously, the first special nucleotide is located at the 5' end of the cleavable linker and the second special nucleotide is the penultimate nucleotide of the 3' end of the cleavable linker. The special nucleotides each have a base selected from the group consisting of inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, 8-oxoguanine, nitroindole and thymine glycol. In particular, the special nucleotides are deoxyuracil (dU) and deoxyinosine (dl).

[0043] It is therefore an object of the present invention to provide a cleavable linker as defined above for use in isolating at least two adjacent polynucleotides in a single-stranded nucleic acid.

[0044] The cleavable linker can comprise natural and / or non-natural nucleotides.

[0045] The person skilled in the art is able to adapt the sequence of the cleavable linker to the endonucleases used to perform the method of the present invention. For example, endonuclease Q cleaves the phosphodiester bond immediately next to the 5' end of dU or dl, whereas endonuclease V cleaves at the second phosphodiester bond from the 3' end of dU or dl, the latter having a higher affinity for dl. Thus, when using a combination of endonuclease Q and endonuclease V, a suitable cleavable linker can comprise dU and dl.

[0046] In particular embodiments, the cleavable linker has the sequence 5'-N1(N) m N2N3-3', wherein: - N1is a special nucleotide having a base selected from the group consisting of uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine and 8-oxoguanine, - N2is a special nucleotide having a base selected from the group consisting of inosine, deoxyinosine, nitroindole, hypoxanthine and thymine glycol, - N represents one or more natural and / or unnatural nucleotides, m is 0 or 1, - N3 is a nucleotide selected from natural nucleotides and unnatural nucleotides.

[0047] N and N3 do not comprise any special nucleotides. In particular, N can comprise one or more T. Alternatively or additionally, N3 can be T.

[0048] In a particular embodiment, the cleavable linker has the sequence 5'-N1N2N3-3', wherein N1, N2 and N3 are as defined above.

[0049] In another particular embodiment, the cleavable linker has the sequence 5'-N1NN2N3-3', wherein N1, N2 and N3 are as defined above and N represents at least one nucleotide. In particular, N comprises 1 to 500 nucleotides, in particular 1 to 300 nucleotides, 1 to 100 nucleotides, 1 to 50 nucleotides or 1 to 20 nucleotides, preferably 1 to 10 nucleotides, more preferably 2 to 6 nucleotides.

[0050] Within the scope of the present application, any range has to be considered as including the upper and lower limit.

[0051] In a particular embodiment, N1 is deoxyuracil (dU) and N2 is deoxyinosine (dl). The cleavable linker can have the sequence dUdIN3 or dUNdIN3, N and N3 being as defined above.

[0052] In a more particular embodiment, the cleavable linker is selected from the group consisting of dUdIT, dUTdIT, dUTTdIT, dUTTTdIT, dUTTTTdIT, dUTTTTTdIT and dUTTTTTTdIT, preferably from the group consisting of dUdIT, dUTdIT, dUTTdIT and dUTTTTTdIT.

[0053] According to the present application, the single-stranded nucleic acid can comprise a plurality of cleavable linkers, each cleavable linker connecting two adjacent polynucleotides. Advantageously, at least one cleavable linker is flanked at its 5' end and 3' end by a polynucleotide. More advantageously, each polynucleotide of the single-stranded nucleic acid is separated from an adjacent polynucleotide by a cleavable linker. The cleavable linkers of the same single-stranded nucleic acid can be identical or different. Preferably, the cleavable linkers of the same single-stranded nucleic acid are all identical.

[0054] In a particular embodiment, the single-stranded nucleic acid of the present application consists from 5' end to 3' end of a sequence of "polynucleotide-cleavable linker- polynucleotide-".

[0055] The single-stranded nucleic acid can be a free nucleic acid or can be attached to a solid support via its 5' end or its 3' end. In a particular embodiment, the single-stranded nucleic acid used in step (a) is attached to a solid support via its 5' end. Such solid support can be a bead, such as a magnetic bead, a capture bead or other material forming a capture bead (e.g. a macrostructure and / or an insoluble material), or a planar solid, such as a glass slide, a membrane or a plate (e.g. a plate comprising a plurality of wells).

[0056] When the single-stranded nucleic acid is attached to a solid support, the nucleic acid can be attached to the solid support via a cleavable motif, which can be cleaved to release the nucleic acid. The cleavable motif can be any way known in the art, such as a short oligonucleotide comprising at least one enzymatically cleavable nucleotide or a chemically cleavable internucleotide linkage. An example of an enzymatically cleavable nucleotide can be a nucleotide having a base selected from the group consisting of inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, 8-oxoguanine, nitroindole and thymine diol, preferably from the group consisting of inosine, deoxyinosine, nitroindole, hypoxanthine and thymidine diol. More particularly, the enzymatically cleavable nucleotide is deoxyinosine. For example, the cleavable motif is dIT. An example of a chemically cleavable nucleotide is ribouracil (rU), which can be cleaved by KOH.

[0057] In some embodiments, the cleavable linker further comprises at its 3' end a modified nucleotide, such as octadiynyl deoxyuracil (Oct-doU or OctdU), which can react with a free azido (N3) group located within the initiator via a click chemistry reaction. In this embodiment, the click reaction between the released polynucleotide and the initiator DNA attached to the solid support is performed before, simultaneously or after the endonuclease cleavage of step b).

[0058] In this embodiment, the cleavable linker has the sequence 5'-N1(N) m N2N3N4-3', wherein: - N1is a special nucleotide having a base selected from the group consisting of uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine and 8-oxoguanine, - N2is a special nucleotide having a base selected from the group consisting of inosine, deoxyinosine, nitroindole, hypoxanthine and thymidine diol, - N represents one or more natural and / or non-natural nucleotides, m is 0 or 1, - N3is a nucleotide selected from the group consisting of natural nucleotides and non-natural nucleotides, - N4 is a modified nucleotide having a base modified at a specific position of the base, wherein the multi-atom linker ends with an alkyne or azido group, for example Oct-dU.

[0059] N and N3 do not comprise any special nucleotides. In particular, N can comprise one or more T. Alternatively or additionally, N3 can be T.

[0060] In an alternative embodiment, the cleavable linker remains attached to the polynucleotide located at its 3’ end. In this embodiment, the linker has the sequence 5’-N1(N) m N3N4-3’, wherein N1, N, m, N3 and N4 are as defined above.

[0061] In some embodiments, the method of the application comprises a step of synthesizing the single-stranded nucleic acid prior to step (a) of providing the single-stranded nucleic acid. The single-stranded nucleic acid used in the present application can be designed and synthesized by any conventional method, for example by chemical synthesis based on solid-phase phosphoramidite chemistry as described by Adamset al. (1983, J. Amer. Chem. Soc., 105, 661) and Froehler et al. (1983, Tetrahedron Lett., 24, 3171) or by enzymatic synthesis. Template-independent enzymatic polynucleotide synthesis methods are for example described in detail in WO 2015 / 159023, WO 2017 / 216472, US patent 5436143, US patent 5763594, Jensen et al (Biochemistry, 57: 1821-1832 (2018)) or Mathews et al (Organic & Biomolecular Chemistry, DOI: 0.1039 / c6ob01371f (2016)); Schmitz et al (Organic Lett., 1(11): 1729-1731 (1999)).

[0062] Preferably, the single-stranded nucleic acid is synthesized on a solid support by enzymatic synthesis, in particular by enzymatic synthesis of polynucleotides with a template-free polymerase, such as terminal deoxynucleotidyl transferase (TdT) or variants thereof for DNA synthesis (e.g. as described in detail in WO2019 / 135007) or polyA polymerase (PAP) or polyU polymerase (PUP) or variants thereof for RNA synthesis (e.g. Heinisch et al, WO2021 / 018919). In some embodiments, the single-stranded nucleic acid is synthesized from a starter with a free 3'-hydroxyl group. In the context of the present invention, the term “starter” refers to a short single-stranded oligonucleotide with a free 3' end, which can be further extended by a template-free polymerase, such as TdT. The starter can comprise between 3 and 100 nucleotides, in particular between 3 and 20 nucleotides. In some embodiments, the starter can comprise a non-nucleic acid compound with a free hydroxyl group to which TdT can couple a 3'-O-blocked dNTP. The starter can be attached to a solid support by its 5' end by any conventional method. In some embodiments, the starter comprises a cleavable motif as defined above at or near its 3' end. In particular embodiments of the present invention, the penultimate nucleotide at the 3' end of the starter has a base selected from the group consisting of inosine, deoxyinosine, hypoxanthine, nitroindole and thymidine glycol. In particular, the penultimate nucleotide at the 3' end is deoxyinosine.

[0063] Endonuclease of step (b)

[0064] According to the method of the present invention, the single-stranded nucleic acid as described above is contacted with: - at least one endonuclease capable of cleaving the single-stranded nucleic acid near the 5' end of the first special nucleotide of the cleavable linker, and - at least one endonuclease capable of cleaving near the 3' end of the second special nucleotide of the cleavable linker.

[0065] “Contacting” means adding the endonuclease to a reaction medium containing the single-stranded nucleic acid.

[0066] The choice of the special nucleotides of the cleavable linker is adapted to the cleavage specificity of the endonuclease to be used. Alternatively, the choice of the endonuclease is adapted to the sequence of the cleavable linker used and to the special nucleotides to be cleaved. By doing so, each cleavable linker comprising two different special nucleotides is cleaved by the endonuclease, releasing the corresponding polynucleotide.

[0067] According to the method of the present invention, at least one endonuclease capable of cleaving near the 5' end of a specific nucleotide is used to cleave and release a polynucleotide having an intact 3'-OH group. The endonuclease may be endonuclease Q. This enzyme is capable of cleaving the phosphodiester bond at the 5' end of the specific nucleotide, which comprises a base selected from: inosine, deoxyinosine, uracil, deoxyuracil, nitroindole, hypoxanthine, thymidine diol, 5-hydroxyuracil, 5,6-dihydrouracil, and 5-hydroxycytosine. Preferably, the specific nucleotide comprises a base selected from: uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, and 5-hydroxycytosine. More preferably, the specific nucleotide comprises deoxyuracil (dU).

[0068] Therefore, endonuclease Q can be used to cleave any cleavable linker containing such a specific nucleotide at its 5' end, such as a cleavable linker with the sequence dUN2N3 or dUNN2N3, where N, N2, and N3 are as defined above. In particular, endonuclease Q can be used with single-stranded nucleic acids containing a cleavable linker selected from the following: dUdIT, dUTdIT, dUTTdIT, dUTTTdIT, dUTTTTTTdIT, dUTTTTTTTTdIT, dUTTTTTTTTTdIT.

[0069] Suitable endonuclease Q can be any commercially available endonuclease Q or any endonuclease Q described in the prior art, especially prokaryotic endonuclease Q, such as endonuclease Q derived from or derived from organisms such as Thermococcus spp. Kodakarens ( Thermococcus kodakarensis (Shiraishi et al., Nucleic Acids Res. 2015; 43(5): 2853–2863), *Fireflyia* ( Pyrococcus furiosus (Shiraishi et al., Sci Rep 6, 25532 (2016)), Bacillus pumilus ( Bacillus pumulis ) (Shiraishi et al., Biosci Biotechnology Biochem 81, 1–7 (2017)) or thermoautotrophic methanophilic bacteria ( Methanothermobacter thermautotrophicus Therefore, a suitable endonuclease Q can be any Endo Q enzyme derived from the following organisms and containing a sequence with the following Genbank accession numbers: *Bacillus pumilus* 8G134 (KY014246); *Bacillus acidothermicus* subsp. *acidothermicus* (...). Alicyclobacillus acidocaldarius subsp. acidocaldarius ) Tc-4-1 (AEJ43581); *Symplocos vorticella* Göttingen strain ( Syntrophomonas wolfei Goettingen ) G311 (ABI67927); pyrolytic anaerobic bacteria ( Thermoanaerobacterium thermosaccharolyticum DSM571 (ADL68842); Bacillus vortex ( Paenibacillus vortex V453 (EFU41322); Bacillus thermophilus ( Geobacillus thermoglucosidasius C56-YS93 (AEH47337); Glycolytic and pyrolytic cellulosic bacteria ( Caldicellulosiruptor saccharolyticus DSM 8903 (ABP67491); Autotrophic desulfurobacillus ( Desulfobacterium autotrophicum (WP_015906045); Nitrogen-fixing nutrient spirochetes ( Treponema azotonutricium ZAS-9 (AEF81123); Bacteroides warwickii ( Bilophila wadsworthia ) 3_1_6(EFV43592); Desulfurization Vibrio ( Desulfovibrio desulfuricans ND132 (EGB14354); Thermostylophora insemblica ( Spirochaeta thermophila DSM 6192 (ADN02349); *Mortisomonas motileis* subsp. Z. mobilis subsp. mobilis ATCC 10988 (AEH63449); Metal-reducing Geobacterium ( Geobacter metallireducens GS-15 (ABB33436); Tropical Sand Spore ( Salinispora tropica ) CNB-440(ABP56967); Clostridiales ( Clostridales )bacteria 1 _7_47FAA (EEQ56693); Methanococcus swampus ( Methanosphaerula palustris E1 9c (WP_012617631); Methanococcus acetate ( Methanosarcina acetivorans C2A (WP_011020688); Methanococcus marinum ( Methanococcus maripaludis C5 (WP_011869325); methanothermic archaea ( Methanopyrus kandleri AV19 (AAM01639); Thermoautotrophic methanophilic bacillus Delta H (WP_010876918); Fierce fire cocci DSM 3638 (WP_011012698) and Thermococcus kodakarens KOD1 (WP_011249838).

[0070] In particular, the endonuclease Q is an endonuclease Q from or derived from Methanocaldococcus jannaschii or Pyrococcus kodamarensis. More particularly, the endonuclease Q is isolated from the thermophilic bacterium Pyrococcus kodamarensis and has the sequence SEQ ID NO: 8.

[0071] Alternatively or additionally, the endonuclease capable of cleaving near the 5' end of the particular nucleotide can also be selected from the group consisting of AGOG, modified AGOG without ligase activity, USER and UDG in combination with endonuclease VIII.

[0072] AGOG or archeal 8oxoG DNA glycosylase, capable of cleaving 8-oxoguanine, has been described in Wang et al. 2022, Acta Biochim Biophys Sin, 2022, 54(12): 1801-1810. It is a bifunctional enzyme also showing ligase activity. However, appropriate mutations or substitutions can be made to produce a modified AGOG without ligase activity, when AGOG or modified AGOG is used as an endonuclease, the particular nucleotide is 8-oxoguanine.

[0073] USER (or Uracil-Specific Excision Reagent) is an enzyme commercialized by New England Biolabs under reference number M5505. USER combines the UDG enzymatic activity of uracil DNA glycosylase (UDG) and the cleavage enzyme activity of endonuclease VIII (see Bitinaite J., et al. (2007) Nucl. Acids Res. 35, 1992-2002; Bitinaite, J. and Nichols, N.M. (2009) Curr Protoc Mol Biol. Chapter 3:Unit 3.21; Vaisvila, R. and Bitinaite, J. (2013) Methods Mol. Biol. 978, 165-171).

[0074] Uracil DNA glycosylase (UDG) can also be used as an endonuclease capable of cleaving at the 5' end of the particular nucleotide, followed by cleavage by endonuclease VIII. In this case, the particular nucleotide is uracil. UDG excises the uracil base, endonuclease VIII subsequently cleaves the phosphodiester backbone.

[0075] According to the method of the present invention, at least one endonuclease capable of cleaving near the 3' end of a specific nucleotide is also used to cleave and release a polynucleotide having an intact 5'-phosphate group. The endonuclease can be used alone or in combination with other enzymes. The endonuclease can be endonuclease V, endonuclease VIII, or endonuclease III.

[0076] Endonuclease V is a highly conserved family of endonucleases that cleaves a specific nucleotide at the second phosphodiester bond at the 3' end. This specific nucleotide contains a base selected from: inosine, deoxyinosine (dI), hypoxanthine, uracil, deoxyuracil (dU), 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, nitroindole, and thymidine diol (Wu et al., 2019). Molecular Cell 76, 44–56). In the context of this invention, the base is preferably selected from inosine, deoxyinosine, nitroindole, hypoxanthine, and thymidine diol, more preferably deoxyinosine (dI).

[0077] Therefore, endonuclease V can be used to cleave any cleavable linker containing such a specific nucleotide as its penultimate nucleotide at the 3' end, such as the cleavable linker of the sequence N1dIN3 or N1NdIN3, where N, N1, and N3 are as defined above. In particular, endonuclease V can be used with single-stranded nucleic acids containing a cleavable linker selected from the following: dUdIT, dUTdIT, dUTTdIT, dUTTTdIT, dUTTTTdIT, dUTTTTTTdIT, and dUTTTTTTTTTTdIT.

[0078] Endonuclease V has been identified in various organisms, particularly in bacteria such as Gondwana bacteria. Fervidobacterium gondwanense ), marine thermocline fungus ( Thermotoga maritima ) or E. coli ( E. coli In a specific embodiment, the endonuclease V used is a prokaryotic endonuclease V, particularly an endonuclease V derived from or derived from Gondwanathecium. More specifically, the endonuclease V used in step (b) comprises, or consists of, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the amino acid sequence of SEQ ID NO: 9. Advantageously, the endonuclease V used in step (b) comprises or consists of the amino acid sequence SEQ ID NO: 9. The endonuclease V is thermostable and can be active in a temperature range up to 72°C, with optimal activity at 60°C.

[0079] As an alternative or in addition to endonuclease V, endonuclease VIII or endonuclease III can also be used in combination with uracil DNA glycosylase (UDG) to cleave and release polynucleotides with intact 5'-phosphate groups at special nucleotides. The special nucleotides have bases such as: uracil, thymine glycol, 5,6-dihydroxythymine, 5-hydroxy-5-methylhydantoin, uracil glycol, 6-hydroxy-5,6-dihydrothymine, and methylpropanediol hydantoin. UDG first recognizes and excises such special bases to create an apurinic site, and then endonuclease VIII or Endo III cleaves the phosphodiester backbone, thereby separating the single-stranded nucleic acid into two polynucleotides with 3'-phosphate and 5'-phosphate, respectively. In a subsequent reaction, the remaining 3'-phosphate can be removed, for example, by using a polynucleotide kinase.

[0080] Endonuclease VIII and Endo III have been identified in bacteria, such as E. coli. Suitable endonuclease VIII and Endo III are exemplified by or derived from E. coli.

[0081] In particular embodiments, step (b) comprises or consists of contacting the single-stranded nucleic acid with at least one endonuclease Q and at least one endonuclease V.

[0082] For example, step (b) comprises or consists of contacting the single-stranded nucleic acid with one endonuclease Q and one endonuclease V, the endonuclease Q being selected from or derived from M. thermautotrophicus, Pyrococcus kodamaensis, and Pyrococcus furiosus, and the endonuclease V being selected from or derived from E. coli, Thermatoga naerovibio or Thermotoga maritima.

[0083] In particular, step (b) comprises or consists of contacting the single-stranded nucleic acid with an endonuclease Q from Pyrococcus kodamaensis and an endonuclease V from Thermatoga naerovibio.

[0084] More particularly, step (b) comprises or consists of contacting the single-stranded nucleic acid with an endonuclease Q of SEQ ID NO: 8 and an endonuclease V of SEQ ID NO: 9.

[0085] More particularly, step (b) comprises or consists of contacting the single-stranded nucleic acid with an endonuclease Q of SEQ ID NO: 8 and an endonuclease V of SEQ ID NO: 9. Cutting activity

[0086] According to the present application, the single-stranded nucleic acid can be contacted with the first endonuclease and the second endonuclease simultaneously or sequentially.

[0087] The term "simultaneous contacting" means that the first endonuclease and the second endonuclease perform their enzymatic activity on the single-stranded nucleic acid at the same time.

[0088] The simultaneous cleavage of both enzymes is advantageously performed under suitable conditions for both endonucleases, such as temperature, pH, etc. For example, the simultaneous cleavage is performed at a temperature of 30°C to 65°C and a pH of 7 to 9. In particular embodiments, the single-stranded nucleic acid is contacted with endonuclease Q and endonuclease V, preferably a thermostable endonuclease V, such as endonuclease V from G. stearothermophilus, simultaneously at a temperature of 50°C to 65°C, in particular at 60°C + / - 5°C, and at a pH of 7.5 to 9.5, preferably at a pH of 8.0 to 9.0, more preferably at a pH of about 8.5.

[0089] The simultaneous cleavage can be performed by two enzymes with different enzymatic activities at different molar ratios. For example, the simultaneous cleavage can be performed by endonuclease V and endonuclease Q at a molar ratio of 5: 1 (endonuclease V: endonuclease Q) to 1:5 (endonuclease V: endonuclease Q). The molar ratio can be adjusted to favor the cleavage of the 5' end of dU and / or the 3' end of dIT by endonuclease Q and endonuclease V, respectively. In particular embodiments, the molar ratio of endonuclease V: endonuclease Q is 1: 1. In another embodiment, the molar ratio of endonuclease V: endonuclease Q is 5: 1. In another embodiment, the molar ratio of endonuclease V: endonuclease Q is 1:5. The person skilled in the art is able to adjust the molar ratio and the conditions (e.g. pH and temperature) to the used endonucleases and the particular nucleotides.

[0090] The term "sequential contacting" means that the first endonuclease and the second endonuclease perform their enzymatic activity one after the other.

[0091] In particular embodiments of step (b), the single-stranded nucleic acid is sequentially contacted first with endonuclease Q and then with endonuclease V.

[0092] In another particular preferred embodiment of step (b), the single-stranded nucleic acid is sequentially contacted first with endonuclease V and then with endonuclease Q.

[0093] The sequential cleavage of the single-stranded nucleic acid by the two endonucleases can be performed in the same reaction medium, possibly under different reaction conditions. For example, the first cleavage can be performed at a first temperature and / or a first pH optimal for the first enzyme, and the subsequent cleavage at a second temperature and / or a second pH optimal for the second enzyme. By way of example, the single-stranded nucleic acid can first be contacted with endonuclease V (e.g. endonuclease V from E. coli) at 37°C, and then contacted with endonuclease Q at a temperature of 50°C to 65°C. At the end of the first cleavage reaction, the second endonuclease can be added to the reaction medium. Optionally, the first endonuclease can be inactivated at the end of the first cleavage reaction and before the addition of the second endonuclease.

[0094] Alternatively, the sequential cleavage of the single-stranded nucleic acid by the two endonucleases can be performed in different reaction media. For example, at the end of the first cleavage reaction in the first reaction medium, the intermediate product is recovered and contacted with the second endonuclease in a second reaction medium. The intermediate product, which corresponds to the product obtained after cleavage of the nucleic acid by the first enzyme, can be recovered by any conventional method, for example by purification or centrifugation.

[0095] At the end of the reaction, the final product can be recovered. The final product corresponds to the product obtained after cleavage by the two enzymes. The final product can comprise released scarless polynucleotides and potentially partially split polynucleotides. Partially split polynucleotides refer to released polynucleotides comprising at least one scar. The composition of the final product will depend on the sequence of the single-stranded nucleic acid (i.e. the succession of repeat units “polynucleotide-cleavable linker-polynucleotide”), the sequence of the cleavable linker and / or the endonucleases used.

[0096] At the end of step (b), at least one of the released polynucleotides is a scarless polynucleotide, i.e. a polynucleotide having a 5’-phosphate group and a 3’-hydroxyl group. In some embodiments, at least two of the released polynucleotides at the end of step (b) are scarless polynucleotides. Preferably, all of the released polynucleotides at the end of step (b) are scarless polynucleotides. The released polynucleotides can thus be directly extended by a polymerase. The released polynucleotides can be used as primers for a polymerase chain reaction (PCR), in particular for multiplex PCR or quantitative PCR.

[0097] In one embodiment, the single-stranded nucleic acid comprises a pair of forward and reverse primers which can be directly used in a subsequent PCR amplification reaction.

[0098] In one embodiment, the cleavable linker comprises at its 3’ end a modified nucleotide, for example an octadiynyl deoxyuracil (Oct-dolU), which can react by click chemistry with a free azido (N3) group located within the initiatorFigure 4A ). In this embodiment, the click reaction between the released polynucleotides and the starting DNA attached to the solid support is performed before, simultaneously or after the cleavage by the endonuclease which releases the linker. In this way, the two released polynucleotides, the forward primer and the reverse primer, are immobilized on the solid support in close proximity. This spatial arrangement is advantageous for the downstream PCR amplification.

[0099] Generally, when a large number of synthesis, cleavage and amplification reactions are performed on the surface of a single flow cell, this method allows to capture the targets and sequence them in multiple ways without the need for indexed primers. Indeed, because the primers are spatially ordered, the position within the flow cell serves as a unique identifier for each reaction without the need for an indexing step.

[0100] In an alternative embodiment, as shown in Figure 4B , the linker does not comprise a special nucleotide (e.g. dl) and no enzyme (e.g. Endo V) is used. In this embodiment, there is no release of free linkers. Instead, the linker remains attached to the reverse primer in the form of a "tail".

[0101] In one aspect, the present application relates to a method for multiplex sequencing of a target-captured library without prior library preparation, said method comprising the following steps: - enzymatically synthesizing a set of single-stranded nucleic acids each comprising a pair of forward and reverse primers separated by a cleavable linker, wherein the reverse primer comprises a modified base at its 5' end; - click reaction occurs between the modified base and a free azido group present in the starting DNA; - separation of the forward and reverse primers by reaction with an endonuclease (e.g. endonuclease Q) able to cleave the single-stranded nucleic acid near the 5' end of the special nucleotide; - capturing the target sequences and clonally amplifying them; - sequencing the target sequences.

[0102] In some embodiments, the method of the present application further comprises a step (c) of recovering the released traceless polynucleotides at the end of step (b). The recovery step can be performed by any standard nucleic acid purification method, for example by gel purification, affinity column or any commercially available nucleic acid purification kit. For example, this step (c) allows to separate the released polynucleotides from the released cleavable linker and from the partially dissociated polynucleotides that can be present at the end of step (b).

[0103] The step (c) for recovery can also be performed by isopropanol-mediated precipitation or by affinity column-mediated purification to remove salts, enzymes, short and non-precipitated oligonucleotides such as the cleavable linker.

[0104] Kit

[0105] The present application also provides a kit for producing a plurality of polynucleotides, in particular a plurality of scarless polynucleotides. The term "kit" refers to any set of reagents used to practice the methods of the present application.

[0106] In some embodiments, the kit of the present application comprises: (i) a first endonuclease capable of cleaving near the 3' end of a special nucleotide having a base selected from the group consisting of inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, nitroindole, and thymine diol; and (ii) a second endonuclease capable of cleaving near the 5' end of a special nucleotide having a base selected from the group consisting of inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, nitroindole, and thymine diol. The first and second endonucleases in the kit are different.

[0107] In particular, the kit comprises: (i) a first endonuclease capable of cleaving near the 3' end of a special nucleotide, in particular at the second phosphodiester bond of the 3' end, the special nucleotide having a base selected from the group consisting of nitroindole, hypoxanthine, and thymine diol; and (ii) a second endonuclease capable of cleaving near the 5' end of a special nucleotide, in particular the 5' end, the special nucleotide selected from the group consisting of uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, and 5-hydroxycytosine.

[0108] More particularly, the kit comprises: (i) a first endonuclease capable of cleaving at the second phosphodiester bond of the 3' end of deoxyinosine; and (ii) a second endonuclease capable of cleaving the phosphodiester bond immediately adjacent to the 5' end of deoxyuracil.

[0109] The endonucleases can be any of the endonucleases described above, depending on the single-stranded nucleic acid being cleaved.

[0110] Preferably, the kit of products comprises an endonuclease Q and an endonuclease V. More particularly, the kit of products comprises the following endonuclease Q and endonuclease V: the endonuclease Q is from or derived from K. codakii, in particular the endonuclease Q of sequence SEQ ID NO: 8, the endonuclease V is from or derived from G. gamaensis endonuclease V, in particular an endonuclease V comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 9.

[0111] In a particular embodiment, the kit of products of the application comprises an endonuclease Q of sequence SEQ ID NO: 8 and an endonuclease V of sequence SEQ ID NO: 9.

[0112] The kit of products of the application can also comprise any delivery system for the delivery of the materials. Such delivery systems include systems allowing the storage of reaction reagents and / or support materials (e.g. reaction media, written instructions for performing the assay, etc.), the transport or delivery of said reaction reagents and / or support materials from one location to another. For example, the kit of products can comprise one or more enclosures (e.g. boxes) comprising the relevant reaction reagents and / or support materials.

[0113] The first endonuclease and the second endonuclease can be stored in the same container or in different containers.

[0114] Such kit of products of the application can also comprise a reaction medium for the cleavage reaction. Depending on the kind of endonucleases comprised, the kit of products of the application can comprise a first reaction medium for the first endonuclease and a second reaction medium for the second endonuclease. Alternatively or additionally, the kit of products of the application can comprise a reaction medium suitable for the simultaneous cleavage by the combination of endonucleases of the kit of products.

[0115] The kit of products of the application can also comprise means for recovering the released scarless polynucleotides at the end of step (b). Such means can be any conventional polynucleotide recovery system, e.g. a column for purification by affinity purification or by isopropanol-mediated precipitation.

[0116] The kit of products of the application can also comprise at least one single-stranded nucleic acid as defined above.

[0117] The single-stranded nucleic acid can be attached to a solid support, preferably by means of a cleavable motif as defined above.

[0118] The kit of the present invention may also contain any necessary reagents for synthesizing such single-stranded nucleic acids. For example, the kit may contain a starter having a 3'-terminal nucleotide containing a free 3'-hydroxyl group, a template-free polymerase, a plurality of 3'-O-blocked nucleoside triphosphates, a deblocking agent, and a plurality of 3'-O-blocked specific nucleotides, each having a base selected from: inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, nitroindole, and thymidine diol. The 3'-O-blocked specific nucleotides are particularly selected from 3'-O-blocked deoxyuracil and 3'-O-blocked deoxyinosine. The kit may also contain a solid support with the starter attached. Optionally, the starter is attached to the solid support via its 5' end.

[0119] In one embodiment, the starting material contains a free azide group, which can be reacted with a modified nucleotide (e.g., octadiynyldeoxyuracil (Oct-dou)) via click chemistry.

[0120] Therefore, such kits allow (i) the extension of a 3'-hydroxyl-containing starter or extension fragment to form a 3'-O-blocked extension fragment using a template-free polymerase with 3'-O-blocked nucleoside triphosphate or a specific nucleotide, then (ii) the deblocking of the extension fragment to form an extension fragment with a free 3'-hydroxyl-containing nucleotide, until (iii) a single-stranded nucleic acid with a predetermined sequence is formed, comprising multiple polynucleotides and at least one cleavable adapter that links at least two adjacent polynucleotides.

[0121] Template-free polymerases can be any template-free polymerase, such as TdT or its variants for DNA synthesis (e.g., Ybert et al, WO2017 / 216472; Champion et al, WO2019 / 135007) or polyA polymerase (PAP) or polyU polymerase (PUP) or their variants for RNA synthesis (e.g., Heinisch et al, WO2021 / 018919).

[0122] The 3'-O-blocked nucleoside triphosphates provided in this invention kit can be 3'-O-blocked dNTPs and / or 3'-O-blocked rNTPs. These compounds contain a blocking group that protects the 3'-hydroxyl group from chemical change during chemical or enzymatic processes. This blocking group can be any blocking group known in the art, such as 3'-O-NH₂, 3'-O-azidomethyl, 3'-O-allyl, or 3'-O-phosphate.

[0123] Accordingly, the kit of the application can also comprise a "deblocking agent" which is a chemical or enzymatic reagent capable of cleaving the blocking group. The choice of deblocking agent depends on the type of 3'-nucleotide blocking group used, whether one or more blocking groups are used, whether the initiator is attached to a solid support, etc. For example, a phosphine such as tris(2-carboxyethyl)phosphine (TCEP) can be used to cleave a 3'-0-azidomethyl group, a palladium complex can be used to cleave a 3'-0-allyl group, or sodium nitrite can be used to cleave a 3'-0-amino group.

[0124] Endonuclease V

[0125] The present application also provides an endonuclease V capable of cleaving near the 3' end of a special nucleotide having a base selected from the group consisting of inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, nitroindole, and thymine diol. The endonuclease V comprises or consists of an amino acid sequence that is at least 75% identical to the amino acid sequence of SEQ ID NO: 9. In particular, the endonuclease V of the present application comprises or consists of an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 9. In some embodiments, the amino acid sequence of the endonuclease V of the present application comprises or consists of the amino acid sequence of SEQ ID NO: 9. In other embodiments, the endonuclease V of the present application comprises or consists of an amino acid sequence that is at least 75% identical to the amino acid sequence of SEQ ID NO: 9 and does not comprise or consist of the amino acid sequence of SEQ ID NO: 9. In other embodiments, the endonuclease V of the present application comprises or consists of an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 9 and does not comprise or consist of the amino acid sequence of SEQ ID NO: 9.

[0126] In some embodiments, the endonuclease V of the application preferably cleaves near the 3' end of a special nucleotide having a base selected from the group consisting of inosine, deoxyinosine, nitroindole, hypoxanthine and thymine diol; more preferably, it cleaves near the 3' end of a special nucleotide having deoxyinosine (dl) as a base.

[0127] The endonuclease V of the application can be isolated from nature or produced by any conventional molecular biology techniques. In a particular embodiment, the endonuclease V is a prokaryotic endonuclease V, more particularly an endonuclease V from or derived from G. stearothermophilus, more particularly an endonuclease V comprising or consisting of the amino acid sequence of SEQ ID NO: 9.

[0128] In another particular embodiment, the endonuclease V of the application is thermostable and can have activity at a temperature range up to 72°C, with optimal activity at 60°C.

[0129] The following examples illustrate the application in more detail.

[0130] Example

[0131] Example 1: Synthesis of single stranded nucleic acids comprising multiple polynucleotides

[0132] Enzymatically synthesizing a custom single-stranded nucleic acid comprising a plurality of polynucleotides and at least one cleavable linker on a bead-based solid support provided in a suspension in 100 μΐ of molecular biology grade H20 at a scale of 750 pmol. The initiator conjugated to the solid support and used to prime the synthesis of the single-stranded nucleic acid contains a dlT residue at its 3' end as a cleavable motif, the thymine residue having a 3'-hydroxyl group. Alternatively, the single-stranded nucleic acid can be obtained from a supplier and then chemically conjugated to the solid support. Alternatively, no solid support is used in the synthesis and only free initiator in solution is used. Sequences for endonuclease V and endonuclease Q mediated release are provided in Table 1.

[0133] Table 1: Single-stranded nucleic acid sequences for endonuclease V and endonuclease Q mediated release.

[0134]

[0135] 1 The cleavable linker sequence intended for removal is indicated in bold.

[0136] The released polynucleotides can be used as primers to target HER2a portion of the ERBB2 gene having the following nucleotide sequence (SEQ ID NO: 7): ACGGACGTGGGATCCTGCA CCCTCGTCTGCCCCCTGCACAACCAAGAGGTGACAGCAGAGG ATGGAACA CAGCGGTGTGAGAAG wherein the underlined sequences represent the Fwd and Rev primer binding sites, respectively.

[0137] Example 2: Enzymatic cleavage of single stranded DNA immobilized on a solid support

[0138] Fermentas) and Thermococcus kodakarensis endonuclease Q (Tko endonuclease Q; SEQ ID NO: 8) were diluted in release buffer (170 mM NaCl, 50 mM MgCl2, and 10 mM TRIS-Cl, pH 8.0) to final concentrations of 800 nM and 10 µM, respectively, either alone or in combination. 100 µl of each enzyme mix, i.e. endonuclease V only, endonuclease Q only, or endonuclease V and endonuclease Q, were added to the appropriate wells of an AcroPrep™ Advance 96-well filter plate (PALL) containing 750 pmol of enzymatically synthesized single-stranded nucleic acids ligated to a solid support. The reactions were incubated at 60°C for 60 minutes with shaking at 900 rpm in a thermomixer. The enzymatically released polynucleotides were collected from the 96-well filter plate by centrifugation at 4700 rpm for 5 minutes. To ensure that all cleaved polynucleotides were collected, an additional 50 µl of release buffer was added to each well of the 96-well filter plate, incubated with shaking at 900 rpm for 2 minutes, and the eluate was collected in the same collection plate by centrifugation as described above.

[0139] Example 3: Enzymatic cleavage of single stranded DNA in solution

[0140] Fg endonuclease V (0.8 µM) and Tko endonuclease Q (2 µM) were combined with a solution containing 300 pmol DNA substrate (100 µM) and release buffer (170 mM NaCl, 50 mM MgCl2, and 10 mM TRIS-Cl, pH 8.0) to a final volume of 100 μl in a 96-well twin.tec LoBind PCR reaction plate (Eppendorf) in order to release the polynucleotides. The reactions were incubated at 60 °C for 60 minutes with shaking at 900 rpm in a thermomixer. The cleavage reaction was stopped by the addition of 60 mM EDTA (Sigma-Aldrich).

[0141] Example 4: Polynucleotide purification

[0142] The released polynucleotides were purified from the cleavage reaction mixture and smaller adapters as follows using standard desalting techniques. A 3-fold volume of 100% isopropanol was added to precipitate the larger polynucleotides and the mixture was transferred to a DNA binding plate E (Invitec) desalting plate. The isopropanol was subsequently removed by vacuum filtration and the remaining salts, smaller unprecipitated oligonucleotide fragments and other impurities were washed away by two rounds of vacuum filtration with 80% EtOH (800 µl). After drying, the purified polynucleotides were eluted by the addition of two 50 μl aliquots of molecular biology grade H2O and collected by centrifugation at 4700 rpm for 5 minutes in an Eppendorf 5430R centrifuge. The purified released polynucleotides were visualized on an Oligo Pro II fragment analyser.

[0143] Example 5: PCR amplification

[0144] The ability of the polynucleotides produced by endonuclease V and endonuclease Q mediated cleavage to prime PCR amplification reactions was determined as follows. 5 μl of each purified polynucleotide was combined with 10 ng human genomic DNA (Roche), 10 μl REDTaq® ReadyMix™ (Merck) and H2O to a final volume of 20 μl without normalizing the polynucleotide concentrations. To mediate PCR amplification, the mixtures were incubated in a Biometra T One thermocycler programmed to perform the following cycles: denaturation at 95 °C for 1 minute followed by 35 cycles each comprising denaturation at 95 °C for 30 seconds, annealing at 60 °C for 15 seconds and elongation at 72 °C for 30 seconds. The final PCR products were visualized on an Oligo Pro II fragment analyser.

[0145] Example 6

[0146] According to the method described above, a single-stranded nucleic acid "Fwd / dUTTdIT / Rev" (sequence SEQ ID NO: 5) having 47 base pairs (bp) was synthesized on a solid support. The single-stranded nucleic acid was detached from the solid support by the sequence dIT as an endonuclease V cleavable motif Figure 1A The 19 bp "Fwd" and 23 bp "Rev" polynucleotides were separated from each other by the dUTTdIT motif, which served as a cleavable linker for endonuclease V and endonuclease Q. Figure 1B All cleavage products that can be obtained when the single-stranded nucleic acid Fwd / dUTTdIT / Rev is cleaved with endonuclease V and endonuclease Q are shown. Figure 1C Purified cleavage products obtained when Fwd / dUTTdIT / Rev is cleaved from the resin using only endonuclease V, or only endonuclease Q, or a combination of endonuclease V and endonuclease Q are shown. Only when endonuclease V and endonuclease Q are used in combination, the traceless 19 bp Fwd and 23 bp Rev polynucleotides can be released from Fwd / dUTTdIT / Rev and separated.

[0147] Example 7

[0148] The free single-stranded nucleic acids of sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 were contacted with endonuclease V and endonuclease Q under the conditions described above in "Example 3: Enzymatic cleavage of single-stranded DNA in solution".

[0149] Figure 2 The importance of the linker design for obtaining traceless Fwd and Rev polynucleotides from single-stranded nucleic acids encoding the Fwd and Rev polynucleotides was demonstrated. For this, various single-stranded nucleic acids with cleavable linkers containing only one special nucleotide (dU or dl), or a combination of special nucleotides, and optionally additional T spacers were treated with a combination of endonuclease V and endonuclease Q. Figure 2 The results demonstrate that only linkers containing two different special nucleotides (dU and dl) mediate the separation of traceless Fwd and Rev polynucleotide sequences when cleavage is performed using a combination of endonuclease V and endonuclease Q. The length of the linker mediated by varying the number of T bases between dU and dl does not affect the separation of traceless Fwd and Rev polynucleotide sequences.

[0150] Example 8

[0151] A 51 bp single-stranded nucleic acid, “Fwd / dUTTTTTTdIT / Rev” (SEQ ID NO: 6) was contacted with endonuclease V, or endonuclease Q, or a combination of endonuclease V and endonuclease Q to split Fwd / dUTTTTTTdIT / Rev into multiple cleavage products. Figure 3A It was demonstrated that only when Fwd / dUTTTTTTdIT / Rev was cleaved by both endonuclease V and endonuclease Q, did the scarless Fwd and Rev polynucleotides result. Cleavage with endonuclease V or endonuclease Q only made Rev or Fwd, respectively, into scarred products. The other polynucleotide retained a cleavable linker or portion thereof.

[0152] When the cleavage products were used as primers in a PCR reaction to amplify an 84 bp HER2 gene from human genomic DNA, only when the scarless cleavage products were produced by using a combination of endonuclease V and endonuclease Q did the expected product result Figure 3B ). When Fwd / dUTTTTTTdIT / Rev was cleaved with endonuclease V only or endonuclease Q only, the subsequent PCR reaction was unsuccessful or produced a larger, undesired 5’ scarred product, respectively.

Claims

1. A method for generating multiple polynucleotides from a single-stranded nucleic acid, the method comprising the following steps: (a) Providing the single-stranded nucleic acid comprising the plurality of polynucleotides and at least one cleavable linker connecting at least two adjacent polynucleotides of the single-stranded nucleic acid, the cleavable linker having two different specific nucleotides, each of the specific nucleotides having a base selected from: inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, 8-oxoguanine, nitroindole, and thymidinediol; (b) Contacting the single-stranded nucleic acid with at least one endonuclease capable of cleaving the single-stranded nucleic acid near the 5' end of a first specific nucleotide of the cleavable linker and at least one endonuclease capable of cleaving near the 3' end of a second specific nucleotide of the cleavable linker, so as to release at least two adjacent polynucleotides of the single-stranded nucleic acid, the released polynucleotides lacking the cleavable linker, and (c) Optionally recover the released oligonucleotides.

2. The method of claim 1, wherein the single-stranded nucleic acid comprises a plurality of cleavable adapters, each cleavable adapter connecting two adjacent polynucleotides.

3. The method according to claim 1 or 2, wherein the endonuclease capable of cleaving near the 3' end of the specific nucleotide is endonuclease V, endonuclease VIII, or endonuclease III, preferably wherein the endonuclease V is a prokaryotic endonuclease V, particularly one derived from or derived from Gondwanathecium. Fervidobacterium gondwanense ), marine thermocline fungus ( Thermotoga maritima ) or E. coli ( E. coli ) endonuclease V.

4. The method according to any one of claims 1 to 3, wherein the endonuclease capable of cleaving the single-stranded nucleic acid near the 5' end of the specific nucleotide is endonuclease Q, preferably, wherein the endonuclease Q is a prokaryotic endonuclease Q, particularly one derived from or derived from thermoautotrophic methanophiles (Bacillus methanogenus). Methanothermobacter thermautotrophicus ) or Thermococcus spp. Kodakarens ( Thermococcus kodakarensis ) endonuclease Q.

5. The method according to any one of claims 1 to 4, wherein the cutable joint has a sequence 5'-N1(N). m N2N3-3', where: (a) N1 is a special nucleotide containing a base selected from the following: uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, and 8-oxoguanine; (b) N2 is a special nucleotide that has a base selected from the following: inosine, deoxyinosine, nitroindole, hypoxanthine and thymidinediol; (c) N represents one or more natural and / or non-natural nucleotides, and m is 0 or 1; (d) N3 is a nucleotide selected from natural and non-natural nucleotides.

6. The method according to claim 5, wherein N1 is deoxyuracil (dU) and N2 is deoxyinosine (dI).

7. The method according to claim 5 or 6, wherein (N) comprises 1 to 500 nucleotides, particularly 1 to 300 nucleotides, 1 to 100 nucleotides, 1 to 50 nucleotides or 1 to 20 nucleotides, preferably 1 to 10 nucleotides, more preferably 2 to 6 nucleotides.

8. The method according to any one of the preceding claims, wherein the cuttable connector is selected from dUdIT, dUTdIT, dUTTdIT, dUTTTdIT, dUTTTTdIT, dUTTTTTdIT and dUTTTTTTdIT.

9. The method according to any one of claims 1 to 8, wherein the single-stranded nucleic acid is attached to a solid support via its 5' end, preferably wherein the solid support is a bead or a plate.

10. The method according to any one of claims 1 to 9, comprising a step of synthesizing the single-stranded nucleic acid prior to the step of providing the single-stranded nucleic acid, preferably by enzymatic synthesis.

11. The method of claim 10, wherein the single-stranded nucleic acid is synthesized from a starting material having a free 3'-hydroxyl group.

12. The method of claim 11, wherein the penultimate nucleotide of the 3' end of the starting material has a base selected from: inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, nitroindole, and thymidine diol.

13. The method according to any one of claims 1 to 12, wherein at least one released polynucleotide has a 5' end containing a monophosphate group and a 3' end containing a hydroxyl group.

14. A kit for the enzymatic production of multiple oligonucleotides, said kit comprising: (a) A first endonuclease capable of cleaving near the 3' end of a specific nucleotide having a base selected from: inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, nitroindole, and thymidinediol. (b) A second endonuclease capable of cleaving near the 5' end of a specific nucleotide having a base selected from: inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, 8-oxoguanine, nitroindole, and thymidinediol; (c) and optionally at least one of the following: i. A starting material having a 3'-terminal nucleotide containing a free 3'-hydroxyl group, optionally said starting material being attached to a solid support via its 5' end; a template-free polymerase; a plurality of 3'-O'-blocked nucleoside triphosphates; a deblocking agent; and a plurality of 3'-O'-blocked specific nucleotides, each of said specific nucleotides having a base selected from: inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, nitroindole, and thymidinediol; or ii. A single-stranded nucleic acid comprising multiple polynucleotides, wherein at least two adjacent polynucleotides of the single-stranded nucleic acid are separated by a cleavable linker comprising two different specific nucleotides, each of the specific nucleotides having a base selected from: inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, 8-oxoguanine, nitroindole, and thymidinediol.

15. The kit product according to claim 14, wherein the first endonuclease is endonuclease V and the second endonuclease is endonuclease Q.

16. An endonuclease V comprising at least 75% identical amino acid sequence to that of SEQ ID NO: 9, wherein the endonuclease V is capable of cleaving near the 3' end of a specific nucleotide having a base selected from: inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, nitroindole, and thymidinediol.

Images