Application of transcription factor MID1 in regulation and control of expression of rice RDR1 and RDR6 and improvement of RGSV resistance

Abstract

The invention discloses application of a transcription factor MID1 in regulation of expression of rice RDR1 and RDR6 and improvement of RGSV resistance, the transcription factor MID1 capable of jointly regulating rice RDR1 and RDR6 genes is identified in the scheme, the genes are remarkably inducible to express after being infected by RGSV and can be directly combined with promoter regions of the RDR1 and RDR6, transcription activation of the genes is promoted, an antiviral RNAi pathway of rice is enhanced, and the RDR1 and RDR6 genes can be combined with the promoter regions of the RDR1 and RDR6 genes. Therefore, the resistance of the plant to the RGSV is improved; the discovery of MID1 provides a new molecular basis for analyzing a regulation mechanism of rice antiviral gene silencing, and provides a new target and strategy for plant antiviral molecular breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and particularly relates to application of transcription factor MID1 in regulating expression of rice RDR1 and RDR6 and improving RGSV resistance. BACKGROUND

[0002] Rice grassy stunt virus (RGSV) is a negative-sense single-stranded RNA virus transmitted by the brown planthopper in a persistent propagative manner, and is a pathogen with important damage in rice production. After RGSV infects rice, it can significantly inhibit plant growth, cause an increase in ineffective tillering, developmental disorder of the ear, and a significant decrease in seed setting rate, thereby leading to significant yield loss. Due to its intermittent and explosive prevalence, RGSV is considered as a major potential risk threatening the safe production of rice. Therefore, it is of great significance to analyze the pathogenic and host resistance mechanisms of RGSV to ensure food production.

[0003] In the plant antiviral response, RNA interference (RNAi) is one of the core defense mechanisms to inhibit the replication and systemic transmission of viruses in host cells. In the RNAi-mediated antiviral pathway, Dicer-like enzymes (DCL), Argonaute proteins (AGO), and RNA-dependent RNA polymerases (RDR) are responsible for the initiation, effect, and signal amplification of gene silencing, respectively, and are key core components in the RNAi pathway. The most significant feature of virus-induced gene silencing is the production of a large amount of virus-derived small interfering RNAs (vsiRNAs). Viral double-stranded RNA or double-stranded RNA-like structures can be processed by different DCL proteins into 21-24 nt vsiRNAs, which target viral RNA for specific cleavage in cooperation with RDR and AGO, thereby inhibiting viral proliferation. Previous studies have shown that after RGSV infects rice, multiple key genes (including RDR1, RDR6, DCL1, DCL2, DCL3, DCL4, AGO1, AGO2, AGO3, AGO4, AGO5, AGO6, and AGO7) in the RNAi pathway are significantly induced, and the upregulation of their expression is associated with the enhancement of antiviral RNAi, but the upstream regulatory mechanism of virus-induced RNAi is unclear. DCL2 DCL4 RDR1 RDR6 AGO18 SUMMARY

[0004] Therefore, the present application aims to provide application of transcription factor MID1 in regulating expression of rice RDR1 and RDR6 and improving RGSV resistance.​​​​​

[0005] To achieve the above-mentioned technical objectives, the technical solution adopted by this invention is as follows: Transcription factor MID1, which includes the amino acid sequence shown in SEQ ID NO:2.

[0006] A nucleotide molecule encoding the transcription factor MID1 described above, wherein the amino acid sequence of the nucleotide molecule is shown in SEQ ID NO:1, or comprises a nucleic acid sequence having at least 90% homology and equivalent function.

[0007] Promoter sequence, which includes promoters RDR1 and / or promoters RDR6 promoter RDR1 The nucleotide sequence is shown in SEQ ID NO:3, and the promoter is... RDR6 The nucleotide sequence is shown in SEQ ID NO:4.

[0008] A recombinant expression vector comprising the nucleotide molecules described above.

[0009] A transgenic rice plant, plant part, or propagable material comprising the nucleotide molecules described above or expressing the transcription factor MID1 described above, wherein the rice includes japonica rice, indica rice, tropical indica rice, tropical japonica rice, indica-japonica hybrid rice, intermediate varieties, and other cultivated rice subspecies.

[0010] The use of the aforementioned transcription factor MID1 or the aforementioned nucleotide molecule in the preparation of transgenic crops for enhancing the virus resistance of rice; wherein the enhancement of rice virus resistance is achieved by the transcriptional regulation of promoters RDR1 and / or RDR6 by the transcription factor MID1.

[0011] An application method for improving the viral resistance of rice utilizes the induction of transcription factor MID1 by RGSV, thereby enhancing RNA-mediated gene silencing and improving resistance to rice grass dwarf virus RGSV; the nucleotide sequence of the transcription factor MID1 is shown in SEQ ID NO:1, and the protein sequence it encodes is shown in SEQ ID NO:2, wherein improving the viral resistance of rice is achieved by enhancing the expression levels of RDR1 and / or RDR6 through the induction of transcription factor MID1.

[0012] A breeding method for enhancing the virus resistance of rice, comprising: (1) Construct an expression vector containing the nucleotide sequence shown in SEQ ID NO:1; (2) The vector was introduced into rice to overexpress the transcription factor MID1 encoded by the nucleotide sequence shown in SEQ ID NO:1; (3) Obtain transgenic rice with overexpression of transcription factor MID1; (4) The transgenic rice utilizes the transcription factor MID1 to bind to the promoter RDR1 and promoter RDR6 This promotes transcriptional activation, enhances the rice antiviral RNAi pathway, and thus improves the plant's resistance to RGSV.

[0013] As an example of implementation, the technical approach of this solution can be summarized as follows: 1. Wild-type rice ZH11 was inoculated with RGSV, and candidate transcription factor genes that were significantly differentially expressed during RGSV infection were obtained by RNA-seq and bioinformatics analysis.

[0014] 2. Cis-acting element analysis was performed on the promoter sequences of rice RDR1 and RDR6 genes to predict their potential transcription factor binding sites. The predicted results were then combined with the candidate transcription factors obtained by RGSV induction to further narrow down the potential transcription factors to 14.

[0015] 3. The above candidate genes were cloned (including the gene LOC_Os05g37060 (MID1) corresponding to the coding sequence SEQ ID NO:1 and the protein sequence SEQ ID NO:2), and the transcription factor MID1 that can significantly activate the RDR1 and RDR6 promoter activities was screened and identified using a dual-luciferase reporter system.

[0016] 4. Using DNA affinity purification sequencing (DAP-seq), micro thermophoresis (MST), gel retardation assay (EMSA), and chromatin immunoprecipitation-quantitative PCR (Chip-qPCR), we confirmed that MID1 can directly bind to the promoter regions of RDR1 and RDR6 and exert transcriptional regulatory effects.

[0017] 5. We constructed transgenic rice with MID1 gene knockout (mid1) and overexpression (CE). Through disease resistance identification and detection of the expression levels (transcriptional and protein levels) of RDR1 and RDR6, we further demonstrated that MID1 can regulate the transcriptional activation of RDR1 and RDR6 and enhance the resistance of rice to RGSV.

[0018] By adopting the above technical solution, the beneficial effects of this invention compared with the prior art are as follows: This solution identifies a mechanism that can jointly regulate rice... RDR1 and RDR6 The transcription factor MID1 of the gene. This gene is significantly induced to express after RGSV infection and can directly bind to... RDR1 and RDR6The discovery of MID1 activates the promoter region of rice antiviral RNAi, thereby enhancing the plant's resistance to RGSV. This provides new molecular evidence for elucidating the regulatory mechanism of rice antiviral gene silencing and offers new targets and strategies for molecular breeding of plant antivirals. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 This is a diagram showing the overlap of data in each group in Example 1 of this solution; Figure 2 This is the transcription factor verified by the dual-luciferase reporter system in Example 1 of this scheme; Figure 3 In Example 2 of this scheme, DAP-seq and Chip-qPCR were used to verify the binding of MID1 to the RDR1 and RDR6 promoters; Figure 4 This is the MST and EMSA experiments in Example 2 of this scheme that verify the promoter motif of MID1 binding to RDR1 and RDR6; Figure 5 This refers to the identification of disease resistance in transgenic rice with MID1 knockout and MID1 overexpression in Example 4 of this scheme. Detailed Implementation

[0021] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be particularly noted that the following embodiments are for illustrative purposes only and do not limit the scope of the invention. Similarly, the following embodiments are only some, not all, embodiments of the present invention, and all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0022] This embodiment provides a method for screening transcription factors that regulate key genes RDR1 and RDR6 in the plant antiviral RNAi pathway under virus induction, and has been verified by molecular biology and genetic methods. The method includes the following embodiments.

[0023] Example 1: Screening of transcription factors induced by RGSV and acquisition of candidate genes First, wild-type rice ZH11 was inoculated with RGSV, and candidate genes of differentially expressed transcription factors after RGSV treatment were obtained by RNA-seq analysis. Subsequently, online tools Plant TFDB 5.0 and PlantPAN 4.0 were used to further analyze the expression of these genes. RDR1 and RDR6 The promoter sequences (SEQ ID NO:3 and SEQ ID NO:4) were used to predict cis-acting elements, obtaining a set of transcription factors that could potentially bind to both promoters. Cross-screening of the two datasets ultimately yielded 14 candidate transcription factor genes that are upregulated or downregulated by RGSV and have potential binding ability (process principle referenced). Figure 1 Their gene numbers are as follows: LOC_Os05g37060, LOC_Os02g47810, LOC_Os03g21060, LOC_Os04g43680, LOC_Os02g41510, LOC_Os08g33940, LOC_Os07g38240, LOC_Os09g31438, LOC_Os08g01330, LOC_Os05g37730, LOC_Os03g19120, LOC_Os10g28330, LOC_Os05g47650, LOC_Os10g41200.

[0024] All information related to the above gene numbers can be found on the RGI website (https: / / riceome.hzau.edu.cn / dev / ).

[0025] Using rice NIP cDNA as a template, the following primers were used for amplification to obtain... RDR1 and RDR6 The promoter sequence was obtained and cloned into the 0800LUC vector to construct a promoter reporter system. Primers included: RDR1pro:LUC-F: (SEQ ID NO:5) ccccctcgaggtcgacTCCTCTCTCCGTGGCCGCGA RDR1pro:LUC-R: (SEQ ID NO:6) tagaactagtggatccGGGATTCGAGGACGAGGAGT RDR6pro:LUC-F: (SEQ ID NO:7) ccccctcgaggtcgacATTCGCATGAGGGATAACCT RDR6pro:LUC-R: (SEQ ID NO:8) tagaactagtggatccGGACGGGTGCGAACTGTGTG Based on the above, the coding region sequences of 14 candidate transcription factors were simultaneously amplified using attB1 / 2 adapter primers. The corresponding adapter primers are as follows: pDONR221-LOC_Os05g37060-221-F: (SEQ ID NO:9) ggggacaagtttgtacaaaaaagcaggcttcATGGCGTTCTACCTCGGCAG pDONR221-LOC_Os05g37060-221-R: (SEQ ID NO:10) ggggaccactttgtacaagaaagctgggtcTCATGGGGCAGTGATGTCGT pDONR221-LOC_Os02g47810-F: (SEQ ID NO:11) ggggacaagtttgtacaaaaaagcaggcttcATGATGGCAGGAGCTCCCCCGATGCA pDONR221-LOC_Os02g47810-R: (SEQ ID NO:12) ggggaccactttgtacaagaaagctgggtcTCAGATGGCAGCGGAGGAGCCATGGTG pDONR221-LOC_Os03g21060-F: (SEQ ID NO:13) ggggacaagtttgtacaaaaaagcaggcttcATGGTTCTGTCGAACCCGGCGATGCT pDONR221-LOC_Os03g21060-R: (SEQ ID NO:14) ggggaccactttgtacaagaaagctgggtcTCAGTTCATCCCCATGTTAGAGTGGAG pDONR221-LOC_Os04g43680-F: (SEQ ID NO:15) ggggacaagtttgtacaaaaaagcaggcttcATGGGGAGGGCTCCGTGCTGCGAGAA pDONR221-LOC_Os04g43680-R:(SEQ ID NO:16) ggggaccactttgtacaagaaagctgggtcCTAGATCTGCGGCAAGTCTTGCGCTTC pDONR221-LOC_Os02g41510-F:(SEQ ID NO:17) ggggacaagtttgtacaaaaaagcaggcttcATGGGGAGGGCGCCGTGCTGCGAGAAG pDONR221-LOC_Os02g41510-R:(SEQ ID NO:18) ggggaccactttgtacaagaaagctgggtcTTAAATCTGGGGCAAATCTGCATGCC pDONR221-LOC_Os08g33940-F::SEQ ID NO:19) ggggacaagtttgtacaaaaaagcaggcttcATGGGGAGGCCGCCGTGCTGCGTGAAG pDONR221-LOC_Os08g33940-R:(SEQ ID NO:20) ggggaccactttgtacaagaaagctgggtcCTAAAAGAACTCACTCGGGTCCCCCAA pDONR221-LOC_Os07g38240-F::SEQ ID NO:21) ggggacaagtttgtacaaaaaagcaggcttcATGGGGACGCCGGAGTTCCCCAACCTG pDONR221-LOC_Os07g38240-R:(SEQ ID NO:22) ggggaccactttgtacaagaaagctgggtcCTACGCTCTTGACGTTCCTCCATGGTC pDONR221-LOC_Os09g31438-F::SEQ ID NO:23) ggggacaagtttgtacaaaaaagcaggcttcATGGCGACCGGCGGCAGCGGCGGCGGC pDONR221-LOC_Os09g31438-R:(SEQ ID NO:24) ggggaccactttgtacaagaaagctgggtcCTACAGAGACCAGTTCATGGCATTGGT pDONR221-LOC_Os08g01330-F::SEQ ID NO:25) ggggacaagtttgtacaaaaaagcaggcttcATGGATCGGCATGAGGAGGAGGCAGGA pDONR221-LOC_Os08g01330-R:(SEQ ID NO:26) ggggaccactttgtacaagaaagctgggtcTCAGTCTCGGTCATCGATGAAGCCCTGA pDONR221-LOC_Os05g37730-F:(SEQ ID NO:27) ggggacaagtttgtacaaaaaagcaggcttcATGATGAAGGAGTCGTACATGGAGGTG pDONR221-LOC_Os05g37730-R:(SEQ ID NO:28) ggggaccactttgtacaagaaagctgggtcTCAACCGAGAGGCTGCATCAGCTGGCC pDONR221-LOC_Os03g19120-F:(SEQ ID NO:29) ggggacaagtttgtacaaaaaagcaggcttcATGGGGAGGGCGCCGTGCTGCGAGAAG pDONR221-LOC_Os03g19120-R:(SEQ ID NO:30) ggggaccactttgtacaagaaagctgggtcTCAGCAGGAGTCCGAGAGGAGCCAGCT pDONR221-LOC_Os10g28330-F::SEQ ID NO:31) ggggacaagtttgtacaaaaaagcaggcttcATGGCGGCGGCGCAGGAGCCGAGAGCC pDONR221-LOC_Os10g28330-R: (SEQ ID NO:32) ggggaccactttgtacaagaaagctgggtcTTAGAAGTTGTGGCTCCACGTCTCGTT pDONR221-LOC_Os05g47650-F: (SEQ ID NO:33) ggggacaagtttgtacaaaaaagcaggcttcATGGACAGCACGAGCTGTCTCTTGGAC pDONR221-LOC_Os05g47650-R: (SEQ ID NO:34) ggggaccactttgtacaagaaagctgggtcCTAGGTTAGCGCAAGCTCTATGCATTG pDONR221-LOC_Os10g41200-F: (SEQ ID NO:35) ggggacaagtttgtacaaaaaagcaggcttcATGACGAGGCGGTGCTCGCACTGCAGC pDONR221-LOC_Os10g41200-R: (SEQ ID NO:36) ggggaccactttgtacaagaaagctgggtcTCATGCCTGTGCCCTTGTTGGTGGATT Intermediate vectors were obtained via homologous recombination using the Gateway® BP Clonase™ II Enzyme Mix kit, and their corresponding names include: LOC_Os05g37060-221 (MID1), LOC_Os02g47810-221, LOC_Os03g21060-221, LOC_Os04g43680-221, LOC_Os02g41510-221, LOC_Os08g33940-221, LOC_Os07g38240-221, LOC_Os09g31438-221, LOC_Os08g01330-221, LOC_Os05g37730-221, LOC_Os03g19120-221, LOC_Os10g28330-221, LOC_Os05g47650-221, LOC_Os10g41200-221.

[0026] The intermediate carrier is processed Mlu Enzyme I digestion was performed, and the recovered product was used to obtain the final vector via homologous recombination using the Gateway® LR Clonase™ II EnzymeMix kit. The corresponding vector names include: LOC_Os05g37060-202 (MID1), LOC_Os02g47810-202, LOC_Os03g21060-202, LOC_Os04g43680-202, LOC_Os02g41510-202, LOC_Os08g33940-202, LOC_Os07g38240-202, LOC_Os09g31438-202, LOC_Os08g01330-202, LOC_Os05g37730-202, LOC_Os03g19120-202, LOC_Os10g28330-202, LOC_Os05g47650-202, LOC_Os10g41200-202,.

[0027] The effects of a dual-luciferase reporter system on 14 candidate transcription factors were detected one by one. RDR1 and RDR6 The regulatory ability of promoter activity was investigated, and it was ultimately determined that LOC_Os05g37060 (MID1) could significantly activate... RDR1 and RDR6 The promoter (see data comparison results) Figure 2 Its nucleotide sequence is SEQ ID NO:1, and the amino acid sequence of the transcription factor MID1 it encodes is SEQ ID NO:2.

[0028] Example 2: MID1 and RDR1 / RDR6 Promoter binding verification Using primers and the MID1-221 vector (i.e., LOC_Os05g37060-221) as a template, the band was amplified. BamH I and Pst I restriction enzyme cleavage site linker MID1PCR products, and fused to the target cell via homologous recombination. BamH I and Pst The Flag-MID1 vector was obtained by digesting the pCAMBIA2300-Actin-N-2×Flag vector with enzyme I.

[0029] The primer sequences used include: Actinpro:Flag-MID1-F: (SEQ ID NO:37) cgacgacaggggatccATGGCGTTCTACCTCGGCAG Actinpro:Flag-MID1-R: (SEQ ID NO:38) aaagcagggcatgcctgcagTCATGGGGCAGTGATGTCGT The constructed expression vector was transformed into rice ZH11 (rice genetic transformation was completed by Wuhan Boyuan Biotechnology Co., Ltd.) to obtain... MID1 CE transgenic rice. Using a MID1-specific antibody, it was found to be effective against ZH11 and... MID1 CE performed DAP-seq analysis on the binding sites of MID1 on the genome, and the results showed that MID1... RDR1 and RDR6 Multiple enrichment regions exist on the promoters of each.

[0030] Primers used include: RDR1pro-P1-F: (SEQ ID NO:39) CCATGGGGCTATGTACTCG RDR1pro-P1-R: (SEQ ID NO:40) CAAGAACCGAATGAACAGTCG RDR1pro-P2-F: (SEQ ID NO:41) CCATGAATTTCCGTGTCC RDR1pro-P2-R: (SEQ ID NO:42) TGATTTCCGTGCCTAACG RDR1pro-P3-F: (SEQ ID NO:43) CCCTAATTAACCAAAGCTAAAATTTGA RDR1pro-P3-R: (SEQ ID NO:44) GCATCATCGGTTACCCATATTT RDR1pro-P4-F: (SEQ ID NO:45) GATGAGCATATAATCGAGCACG RDR1pro-P4-R: (SEQ ID NO:46) CGGTAGAATTGATATTGTGTTGACC RDR1pro-P5-F: (SEQ ID NO:47) GGCTTGTTTTGGGATAAACATTTAC RDR1pro-P5-R: (SEQ ID NO:48) GGAACGTGAAGGCCTATATATATG RDR6pro-P1-F: (SEQ ID NO:49) CAGCTTCCAACCTTGCA RDR6pro-P1-R: (SEQ ID NO:50) TGGTATATCATTATTTGAAAAGAGAGGAAG RDR6pro-P2-F: (SEQ ID NO:51) CACTTTCTGAACCGCTAACGGC RDR6pro-P2-R: (SEQ ID NO:52) GCTACAAATCTGTAGCCCG RDR6pro-P3-F: (SEQ ID NO:53) ACGCTTTCTCCACCAGT RDR6pro-P3-R: (SEQ ID NO:54) AATATGCCGTTAGCGGTTCA RDR6pro-P4-F: (SEQ ID NO:55) CAAAATTTCATTACGTATCGATTTGTTG RDR6pro-P4-R: (SEQ ID NO:56) TCCGTCGTAGTAGAATTCACC Using chip-qPCR experiments RDR1 and RDR6 Enrichment verification was performed on different regions of the promoter sequence of MID1, and it was found that MID1 binds to different regions of the promoter sequence. RDR1P5 area and RDR6 P3 region ( Figure 3 ).

[0031] To verify binding specificity, targeting RDR1 and RDR6 The promoter design is as follows: RDR1-probe:TTGCCACGGATAAGGTTACA (SEQ ID NO:57) RDR6-probe:AACTTGAGATAAGGGACTTC (SEQ ID NO:58) And the following probes are mutated: RDR1-M-probe:TTGCCACGgggggGGTTACA (SEQ ID NO:59) RDR6-M-probe:AACTTGAgggggGGGACTTC (SEQ ID NO:60) EMSA and MST were used to further verify that MID1 can interact with RDR1 and RDR6 The specific motif of the promoter directly binds ( Figure 4 The above results collectively prove that MID1 is... RDR1 and RDR6 Direct regulators.

[0032] Example 3: MID1 Overexpression RDR1 and RDR6 Regulation at the transcriptional level Detection by RT-qPCR using primers RDR1 and RDR6 In ZH11 and MID1 Expression levels in CE transgenic rice were found RDR1 and RDR6 exist MID1 The expression levels in CE were significantly higher than those in the control ZH11, indicating that MID1 can promote... RDR1 and RDR6 Transcriptional activation.

[0033] The primers used include the following: OsRDR1-F:ATTCCGCCTCGTATGGTGAC (SEQ ID NO:61) OsRDR1-R: TGCCTTGAGGTCTTCCTTATCC (SEQ ID NO:62) OsRDR6-F: GGACTACTCCCCACCTGAAGC (SEQ ID NO:63) OsRDR6-R:GAAGTCCACGGCAGTTGCTGCTAGC (SEQ ID NO:64) Example 4: MID1 Construction and Disease Resistance Testing of Gene Knockout Materials (1) Based on the MID1 sequence, CRISPR / Cas9 target points were designed. Primers for constructing the CRISPR / Cas9 system were designed using the website http: / / skl.scau.edu.cn / home / . UF: (SEQ ID NO:65) CTCCGTTTTACCTGTGGAATCG gRNA-R: (SEQ ID NO:66) CGGAGGAAAATTCCATCCAC MID1-gRT1: (SEQ ID NO:67) 5'-TCCCGGAGCACACGCACAACgttttagagctagaaat-3' MID1-OsU3T1: (SEQ ID NO:68) 5'-GTTGTGCGTGTGCTCCGGGATgccacggatcatctgc-3' MID1-gRT2: (SEQ ID NO:69) 5'-GGCTAGAGAAATATGGGCGgttttagagctagaaat-3' MID1-OsU6aT2: (SEQ ID NO:70) 5'-CGCCCATATTTCTCTAGCCCggcagccaagccagca-3' B1': (SEQ ID NO:71) TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG BL: (SEQ ID NO:72) AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC (2) Using the intermediate vectors U3 and U6 as templates, the target gRNA expression cassette sequence was obtained by two rounds of PCR amplification using three pairs of primers: UF / MID1-U3T1, MID1-gRT1 / gRNA-R, and B1' / BL. (3) The expression cassette sequence and Cas9 vector were processed by restriction endonuclease. Bsa I is digested and then ligated using T4 ligase; (4) The ligation product was transformed into Escherichia coli strain DH5α, plated on a medium containing kanamycin resistance to obtain transformants, plasmids of transformants were extracted, and positive transformants with correct sequencing were the final recombinant vector, named CRISPR-MID1. (5) CRISPR-MID1 was sent to Wuhan Boyuan Biotechnology Co., Ltd. for genetic transformation to obtain MID1 Knockout genetically modified rice mid1 .right mid1 and MID1 CEs were inoculated with RGSV, and their resistance was assessed. Phenotypic analysis and viral accumulation detection revealed... MID1 CE significantly enhances resistance to RGSV, while mid1 Disease resistance was significantly lower than that of wild-type rice ZH11 ( Figure 5 ).

[0034] Further detection using primers via RT-qPCR RDR1 and RDR6 The expression level, the results showed mid1 middle RDR1 / RDR6 Expression levels were significantly reduced, while MID1 Significantly elevated in CE.

[0035] The primers used include: OsRDR1-F: (SEQ ID NO:73) ATTCCGCCTCGTATGGTGAC OsRDR1-R: (SEQ ID NO:74) TGCCTTGAGGTCTTCCTTATCC OsRDR6-F: (SEQ ID NO:75) GGACTACTCCCCACCTGAAGC OsRDR6-R: (SEQ ID NO:76) GAAGTCCACGGCAGTTGCTGCTAGC Western blot analysis further confirmed that the accumulation levels of RDR1 and RDR6 proteins were consistent with their transcriptional changes, both being positively regulated by MID1. Figure 5 The above results indicate that MID1 can positively regulate the expression of RDR1 and RDR6, thereby enhancing the resistance of rice to RGSV.

[0036] The above description is only a part of the embodiments of the present invention and does not limit the scope of protection of the present invention. Any equivalent device or equivalent process transformation made based on the content of the present invention specification and drawings, or direct or indirect application in other related technical fields, are similarly included within the patent protection scope of the present invention.

Claims

1. Transcription factor MID1, characterized in that, It includes the amino acid sequence shown in SEQ ID NO:

2.

2. A nucleotide molecule, characterized in that, It encodes the transcription factor MID1 as described in claim 1, wherein the amino acid sequence of the nucleotide molecule is as shown in SEQ ID NO:1, or includes a nucleic acid sequence having at least 90% homology and equivalent function.

3. A promoter sequence, characterized in that, It includes promoters RDR1 and / or promoters RDR6 promoter RDR1 The nucleotide sequence is shown in SEQ ID NO:3, and the promoter is... RDR6 The nucleotide sequence is shown in SEQ ID NO:

4.

4. A recombinant expression vector, characterized in that, It comprises the nucleotide molecule as described in claim 2.

5. A transgenic rice plant, plant part, or propagable material, characterized in that, It comprises the nucleotide molecule of claim 2 or expresses the transcription factor MID1 of claim 1, wherein the rice includes japonica rice, indica rice, tropical indica rice, tropical japonica rice, indica-japonica hybrid rice, intermediate varieties and other cultivated rice subspecies.

6. Use of the transcription factor MID1 of claim 1 or the nucleotide molecule of claim 2 in the preparation of transgenic crops for enhancing the virus resistance of rice.

7. The use according to claim 6, characterized in that, The enhanced antiviral resistance of rice is achieved through transcriptional regulation of promoters RDR1 and / or RDR6 by the transcription factor MID1.

8. An application method for improving the virus resistance of rice, characterized in that: The transcription factor MID1 was induced by RGSV, thereby enhancing RNA-mediated gene silencing and improving resistance to rice straw dwarf virus RGSV; the nucleotide sequence of the transcription factor MID1 is shown in SEQ ID NO:1, and the protein sequence it encodes is shown in SEQ ID NO:

2.

9. The application method according to claim 8, characterized in that, Improving the virus resistance of rice is achieved by enhancing the expression levels of RDR1 and / or RDR6 through the induction of the transcription factor MID1.

10. A breeding method for enhancing the virus resistance of rice, characterized in that, It includes: (1) Construct an expression vector containing the nucleotide sequence shown in SEQ ID NO:1; (2) The vector was introduced into rice to overexpress the transcription factor MID1 encoded by the nucleotide sequence shown in SEQ ID NO:1; (3) Obtain transgenic rice with overexpression of transcription factor MID1; (4) The transgenic rice utilizes the transcription factor MID1 to bind to the promoter RDR1 and promoter RDR6 This promotes transcriptional activation, enhances the rice antiviral RNAi pathway, and thus improves the plant's resistance to RGSV.

Images