Promoter screening system, screening method and use

By constructing P&E-Vector and E-Vector vector systems and combining real-time quantitative PCR and high-throughput sequencing technologies, the lack of promoter screening systems was solved, enabling efficient screening and validation. A whole-genome map was constructed, and the characteristics and mechanisms of promoters were elucidated.

CN121538237BActive Publication Date: 2026-04-21AGSINO GENSOURCES CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
AGSINO GENSOURCES CO LTD
Filing Date
2026-01-19
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

In the existing technology, facilitators, as a novel regulatory element, have unclear functional characteristics and lack efficient and convenient screening systems and methods, which limits in-depth research on their functions.

Method used

P&E-Vector and E-Vector vector systems were constructed, and promoters were screened and verified using real-time quantitative PCR and high-throughput sequencing technologies to eliminate enhancer interference, thereby achieving highly sensitive promoter identification and whole-genome mapping.

Benefits of technology

It enables efficient and convenient promoter screening and validation, constructs whole-genome maps, and elucidates promoter characteristics and mechanisms, providing technical support for further research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121538237B_ABST
    Figure CN121538237B_ABST
Patent Text Reader

Abstract

This invention discloses a promoter screening system, comprising a P&E-Vector vector and an E-Vector vector. The P&E-Vector vector sequence is shown in SEQ ID No:1, and the E-Vector vector sequence is shown in SEQ ID No:2. The P&E-Vector vector enables efficient identification and high-throughput screening of promoters, while the E-Vector vector effectively eliminates the influence of enhancers. This screening system is highly sensitive and simple to operate, providing important technical support for constructing whole-genome maps of promoters and elucidating their characteristics and mechanisms.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to a promoter screening system, screening method, and application. Background Technology

[0002] Transcriptional regulation is one of the key mechanisms regulating lineage differentiation and cell fate determination during biological development. The spatiotemporal patterns of gene expression are encoded in the genome as cis-regulatory elements, which are important components of the gene expression regulatory network and mainly include promoters, enhancers, silencers, and insulators. However, currently known cis-regulatory elements only account for a small portion of the genome. Taking the human and mouse genomes as examples, all identified functional genes and regulatory elements account for only about 5% of the genome, meaning that the functions of approximately 95% of the genome remain unclear. Functional analysis and mechanistic studies of these unknown genomic regions have become a key research direction in the post-genomics era, and are of great significance for a deeper understanding of the structure and function of the genome.

[0003] In 2023, Mira Kassouf's research group at the University of Oxford discovered a novel class of regulatory elements in mouse α-globin super-enhancers (α-SEs). These elements do not possess enhancer activity themselves, but can regulate gene expression levels by promoting enhancer activity. These regulatory elements were named facilitators (Blayney JW, Francis H, Rampasekova A, et al. Super-enhancers include classical enhancers and facilitators to fully activate gene expression[J]. Cell, 2023, 186: 5826-5839). The discovery of facilitators has opened up new research directions for genome function studies and the elucidation of gene expression regulatory networks. However, currently, only three facilitators have been discovered (R3, R4, and Rm), resulting in a lack of clarity regarding the fundamental characteristics that distinguish facilitators from other regulatory elements. Therefore, there is an urgent need to research and develop an efficient and convenient facilitator screening system and method to provide technical support for in-depth discovery and screening of facilitators and further research on their functions. Summary of the Invention

[0004] The purpose of this invention is to provide a promoter screening system, screening method and application, providing technical support for in-depth discovery and screening of promoters and further research on their functions.

[0005] According to a first aspect of the present invention, a promoter screening system is provided, comprising a P&E-Vector vector and an E-Vector vector, wherein the P&E-Vector vector sequence is shown in SEQ ID No:1 and the E-Vector vector sequence is shown in SEQ ID No:2. Therefore, this system allows for efficient and convenient screening or verification of promoters, eliminates interference from enhancers, exhibits high sensitivity, is widely applicable, and provides important technical support for constructing promoter genome maps and elucidating promoter characteristics and mechanisms.

[0006] According to a second aspect of the present invention, the application of the aforementioned promoter screening system in promoter screening or validation is provided. Thus, this application can provide important technical support for constructing promoter whole-genome maps and elucidating promoter characteristics and mechanisms.

[0007] According to a third aspect of the present invention, a method for facilitating sub-verification is provided, the method comprising the following steps:

[0008] S1. Construct the P&E-Vector and E-Vector: The P&E-Vector sequence is shown in SEQ ID No:1, and the E-Vector sequence is shown in SEQ ID No:2;

[0009] S2. Insert the sequence to be tested into the P&E-Vector and E-Vector vectors;

[0010] S3. Real-time quantitative PCR detection of mCherry expression: If the relative expression level of mCherry protein in the P&E-Vector vector with the inserted test sequence is significantly upregulated compared to the blank P&E-Vector vector without the inserted sequence, while the relative expression level of mCherry protein in the E-Vector vector with and without the inserted test sequence is not significantly different or not expressed, then the test sequence is a promoter sequence; otherwise, it is a non-promoter sequence. Therefore, this method can efficiently and conveniently verify promoters, providing important technical support for constructing promoter genome maps and elucidating promoter characteristics and mechanisms.

[0011] According to a fourth aspect of the present invention, the application of the aforementioned promoter verification method in promoter verification is provided. Therefore, this application can provide important technical support for constructing promoter whole-genome maps and elucidating promoter characteristics and mechanisms.

[0012] According to a fifth aspect of the present invention, a method for promoting high-throughput screening is provided, the method comprising the following steps:

[0013] S1. Prepare the insertion fragment: Break the genome or the sequence to be tested into fragments, and then add homologous arms to both ends of the fragmented DNA fragments;

[0014] Construction of S2, P&E-Input plasmid and E-Input plasmid: The P&E-Vector and E-Vector are linearized by enzyme digestion. Then, the DNA fragment from step S1 is ligated with the linearized P&E-Vector by homologous recombination to construct the P&E-Input plasmid. The DNA fragment from step S1 is ligated with the linearized E-Vector by homologous recombination to construct the E-Input plasmid.

[0015] S3. Input library construction: After amplifying the P&E-Input plasmid using sequencing primers, the amplified fragments were recovered and sequenced to form the experimental group Input library; after amplifying the E-Input plasmid using sequencing primers, the amplified fragments were recovered and sequenced to form the control group Input library.

[0016] S4. Output library construction: After transfecting cells with the constructed P&E-Input plasmid and E-Input plasmid for 24 hours, cells were collected, mRNA was enriched, and the mRNA was reverse transcribed into cDNA, then amplified, and the amplified fragments were recovered for sequencing. The output library obtained by transfecting P&E-Input plasmid was the experimental group output library, and the output library obtained by transfecting E-Input plasmid was the control group output library.

[0017] S5. Comparative analysis of Input and Output library data from the experimental and control groups: If the relative abundance in the Output library is significantly higher than that in the Input library in the experimental group, and the relative abundance in the Output library is not significantly different from that in the Input library in the control group, then the sequence to be tested is a promoter sequence; otherwise, it is not. Therefore, this method can achieve high-throughput screening of promoters, providing important technical support for constructing a whole-genome map of promoters and elucidating their characteristics and mechanisms.

[0018] In some embodiments, the homologous arm sequences in step S1 are shown as SEQ ID No:3 and SEQ ID No:4.

[0019] In some embodiments, step S1 involves breaking the genome or the sequence to be tested into DNA fragments of 400-600 bp.

[0020] According to a sixth aspect of the present invention, an application of the method in high-throughput screening of promoters is provided. Thus, this application enables high-throughput screening of promoters, providing important technical support for constructing whole-genome maps of promoters and elucidating their characteristics and mechanisms.

[0021] According to a seventh aspect of the present invention, a method for detecting promoter activity is provided, the method comprising the following steps:

[0022] S1. Construct a P&E-Vector vector, the sequence of which is shown in SEQ ID No:1;

[0023] S2. Insert the promoter sequence to be tested into the P&E-Vector vector;

[0024] S3. Real-time quantitative PCR was used to detect the transcriptional level of the mCherry protein gene. The higher the transcriptional level, the stronger the activity of the promoter inserted at that site. Therefore, this method can effectively detect the activity of promoters, providing technical support for further research on their function.

[0025] The beneficial effects of this invention are as follows: This invention constructs a promoter screening FHI-Seq system, which includes a P&E-Vector vector and an E-Vector vector. The P&E-Vector vector sequence is shown in SEQ ID No:1, and the E-Vector vector sequence is shown in SEQ ID No:2. The P&E-Vector vector enables the identification and high-throughput screening of promoters, while the E-Vector vector effectively eliminates the influence of enhancers. This screening system is highly sensitive and simple to operate, providing important technical support for constructing promoter genome maps and elucidating promoter characteristics and mechanisms. Attached Figure Description

[0026] Figure 1 A flowchart for the FHI-Seq system used to facilitate high-throughput sub-screening;

[0027] Figure 2 The following figure shows the expression levels of mCherry after inserting promoters or enhancers into the P&E-Vector vector: Control represents the relative expression level of mCherry in the blank P&E-Vector vector without the inserted sequence; R3, R4, and Rm represent the relative expression levels of mCherry after inserting promoters R3, R4, and Rm; and CMV-E represents the relative expression level of mCherry after inserting the CMV enhancer. The above indicate highly significant differences. P <0.01;

[0028] Figure 3 The graph shows the expression levels of mCherry after inserting promoters or enhancers into the E-Vector vector: Control represents the relative expression level of mCherry in the blank E-Vector vector without the inserted sequence; R3, R4, and Rm represent the relative expression levels after inserting promoters R3, R4, and Rm; and CMV-E represents the relative expression level after inserting the CMV enhancer. Indicates a highly significant difference. P <0.01, ns indicates no significant difference. P >0.05;

[0029] Figure 4 The figure shows the relative abundance results of the experimental groups during high-throughput screening: R3, R4 and Rm represent the relative abundance of promoters R3, R4 and Rm, and R1 and R2 represent the relative abundance of enhancers R1 and R2.

[0030] Figure 5 The figure shows the relative abundance results of the control group during high-throughput screening: R3, R4 and Rm represent the relative abundance of promoters R3, R4 and Rm, and R1 and R2 represent the relative abundance of enhancers R1 and R2. Detailed Implementation

[0031] The present invention will now be described in detail with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make several changes and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Unless otherwise specified, the chemical substances, proteins, enzymes, or reagent kits used in the present invention are all commercially available.

[0032] Example 1: Construction of a FHI-Seq system for promoting sub-screening.

[0033] The FHI-Seq (Facilitators High-throughput Identification Sequencing) system consists of two parts: the Facilitators & Enhancer Screen Vector (hereinafter referred to as "P&E-Vector") and the Enhancer Screen Vector (hereinafter referred to as "E-Vector").

[0034] The P&E-Vector vector was constructed by systematically modifying the PGL4.1 plasmid (Promega, HG-VQP1552) as its backbone. The specific construction process is as follows: First, the PGL4.1 plasmid was double-digested with SacI and AfeI restriction endonucleases. Then, key functional elements such as SCP1-promoter (which retains the core region of the promoter, but its existence alone is insufficient to start downstream genes and needs to work with enhancers to start downstream gene expression), intron sequence, mCherry reporter gene, SV40 enhancer, ccdB lethal gene, and SV40 poly-A tail (the sequences of each functional element are shown in Table 1 or as shown in SEQ ID No:5-10) were artificially synthesized and inserted into the restriction sites to complete the vector modification. The nucleotide sequence of the modified P&E-Vector vector is shown in SEQ ID No:1. In this P&E-Vector, there is an "insertion fragment" region between the mCherry reporter gene and the SV40 Enhancer. The "insertion fragment" region has homologous arms [left arm: CTAGAGCATG (SEQ ID No: 3); right arm: ATATCGCGGC (SEQ ID No: 4)] and restriction enzyme sites (AgeI and SalI restriction sites) at both ends, which can insert the test sequence into this region through homologous recombination.

[0035] The E-Vector vector is constructed by specifically removing the SV40 Enhancer element from the P&E-Vector vector. The nucleotide sequence of the E-Vector vector is shown in SEQ ID No:2.

[0036] Both the P&E-Vector and E-Vector vectors were validated by Sanger sequencing after construction to ensure sequence accuracy.

[0037] Table 1 Sequence List

[0038] name Sequence information SCP1-promoter GTACTTATATAAGGGGGGTGGGGGCGCGTTCGTCCTCAGTCGCGATCGAACACTCGAGCCGAGCAGACGTGCCTACGGACCG (SEQ ID No: 5) Introns GTGAGTACTCCCTCTCAAAAGCGGGCATGACTTCTGCGCTAAGATTGTCAGTTTCCAAAAACGAGGAGGATTTGATATTCACCTGGCCCGCGGTGATGCCTTTGAGGGTGGCCGCGTCCATCTGGTCAGAAAAGACAATCTTTTTGTTGTCAAGCTTGAGGTGTGGCAGGCTTGAGATCTGGCCATACACTTGAGTGACAATGACATCCACTTTGCCTTTCTCTCCACAG (SEQ ID No: 6) mCherry reporter gene ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAA (SEQ ID No:7) SV40 Enhancer GGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCA (SEQ ID No:8) ccdB lethal gene ATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCCGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAA (SEQ ID No:9) SV40 poly-A tail ATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCCGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAA (SEQ ID No:10) The working principle of the FHI-Seq system is as follows: The FHI-Seq system consists of two parts: a P&E-Vector vector and an E-Vector vector. In both the P&E-Vector and E-Vector vectors, the test / selection sequence is cloned and inserted into the "insert fragment" region (the "insert fragment" region has homologous arms (left arm: CTAGAGCATG; right arm: ATATCGCGGC) and restriction enzyme sites (AgeI and SalI sites) at both ends). The P&E-Vector and E-Vector vectors are double-digested with restriction endonucleases AgeI and SalI. Then, the test / selection sequence, already containing the homologous arm sequence (left arm: CTAGAGCATG; right arm: ATATCGCGGC), is amplified by PCR. It is then ligated to the linearized vector via homologous recombination, and the test / selection sequence can be cloned and inserted into the "insert fragment" site. Figure 1 As shown, in the P&E-Vector vector, the genomic test / screening sequence is cloned and inserted into the "insert fragment" position. If the cloned inserted sequence has promoter activity, it can significantly enhance the activity of the "SV40 Enhancer," thereby promoting its interaction with the "SCP1-promoter," ultimately driving the upregulation of the transcription level of the reporter gene (mCherry reporter gene). It is worth noting that the "insert fragment" sequence itself is also transcribed, and its transcriptional abundance is positively correlated with promoter activity (i.e., a highly active promoter can significantly increase the transcription level of its own sequence). This characteristic provides a reliable basis for quantitatively assessing promoter strength. High-throughput sequencing can accurately obtain the sequence information and activity intensity of the promoter. However, if the test sequence inserted into the "insert fragment" position is a traditional enhancer sequence, a similar effect may occur. To eliminate interference from enhancer sequences, a specially designed E-Vector vector is used for rigorous screening. Figure 1As shown, in the E-Vector vector, the genomic test / screening sequence is also cloned into the "insertion fragment" site (the same insertion site as in the P&E-Vector vector). Since the E-Vector vector lacks enhancers, if the inserted test sequence is a promoter, it cannot drive reporter gene transcription by enhancing the activity of the "SCP1-promoter," and therefore cannot be detected. However, if the inserted test sequence is a conventional enhancer, it can directly interact with the "SCP1-promoter," driving reporter gene transcription, and thus can be specifically recognized. Therefore, the finally identified promoter sequences must meet the following criteria: sequences that show activity only in the P&E-Vector vector and are inactive in the E-Vector vector. Thus, the P&E-Vector vector can screen for promoter and enhancer sequences, while the E-Vector vector can effectively eliminate interference from enhancers. Therefore, the final promoter sequences are those that exclude enhancer sequences identified by the E-Vector vector from the sequences identified by the P&E-Vector vector.

[0039] Therefore, when the FHI-Seq system is used for promoter screening or validation, if the relative expression level of mCherry protein in the P&E-Vector vector after inserting the test sequence is significantly upregulated compared to the blank P&E-Vector vector without the inserted sequence, while the relative expression level of mCherry protein in the E-Vector vector after inserting the test sequence and without the inserted test sequence is not significantly different or is not expressed, then the test sequence is a promoter sequence; otherwise, it is a non-promoter sequence.

[0040] Example 2: Functional verification of the FHI-Seq system for promoting sub-screening.

[0041] To verify whether the FHI-Seq system can effectively identify promoters, the three reported promoters R3, R4, and Rm (genomic locations shown in Table 2) were constructed into the P&E-Vector and E-Vector vectors of the FHI-Seq system, respectively. The expression level of mCherry was detected by real-time quantitative PCR (qPCR). The detection results for the P&E-Vector vector are shown below. Figure 2 As shown, Control represents the relative expression level of mCherry in the blank P&E-Vector vector without the inserted sequence; R3, R4, and Rm represent the relative expression levels of mCherry after the insertion of promoters R3, R4, and Rm; and CMV-E represents the relative expression level of mCherry after the insertion of enhancer CMV. The results indicate that, compared to the Control group, promoters R3, R4, and Rm all significantly upregulated the expression of the mCherry reporter gene. P <0.01). In the E-Vector carrier, the detection results are as follows:Figure 3 As shown in the figure, Control represents the relative expression level of mCherry in the blank E-Vector vector without the inserted sequence, R3, R4, and Rm represent the relative expression levels of mCherry after the insertion of promoters R3, R4, and Rm, and CMV-E represents the relative expression level of mCherry after the insertion of enhancer CMV. The results show that, compared with the Control group, promoters R3, R4, and Rm did not show a significant upregulation effect on the mCherry reporter gene. P >0.05). As a positive control for validating this system, the CMV enhancer significantly upregulated the expression of the mCherry reporter gene in both the P&E-Vector and E-Vector vectors. Figure 2 and Figure 3 CMV-E in P <0.01). The above results fully verify the promoter screening or verification criteria in Example 1: "If the relative expression level of mCherry protein in the P&E-Vector vector after inserting the test sequence is significantly upregulated compared with the blank P&E-Vector vector without the inserted sequence, while the relative expression level of mCherry protein in the E-Vector vector after inserting the test sequence and without the inserted test sequence is not significantly different or not expressed, then the test sequence is a promoter sequence; otherwise, it is a non-promoter sequence." This fully demonstrates that the FHI-Seq system can accurately identify promoters R3, R4, and Rm.

[0042] Table 2. Location information of promoters and enhancers in the genome.

[0043]

[0044] Example 3: High-throughput screening using the FHI-Seq system for promoter screening.

[0045] The flowchart of the FHI-Seq system for facilitating high-throughput sub-screening is as follows: Figure 1 As shown, specifically:

[0046] 1. Prepare the insertion fragment: Break the genome or the sequence to be tested into DNA fragments of 400-600bp, and then add homologous arms to both ends of the DNA fragments (left arm: CTAGAGCATG, right arm: ATATCGCGGC).

[0047] 2. Construction of P&E-Input and E-Input plasmids: The P&E-Vector and E-Vector vectors were linearized by enzyme digestion. Then, the DNA fragments with added homologous arms were ligated with the linearized P&E-Vector vector for homologous recombination to construct the P&E-Input plasmid. The DNA fragments with added homologous arms were ligated with the linearized E-Vector vector for homologous recombination to construct the E-Input plasmid.

[0048] 3. Input Library Construction Method: The P&E-Input plasmid was amplified using sequencing primers, and the amplified fragments were recovered and sequenced to obtain the experimental input library. Similarly, the E-Input plasmid was amplified using sequencing primers, and the amplified fragments were recovered and sequenced to obtain the control input library. In other words, the input library data obtained through P&E-Input plasmid amplification is the experimental input library data, and the input library data obtained through E-Input plasmid amplification is the control input library data.

[0049] 4. Output Library Construction Method: Cells were transfected with the constructed P&E-Input plasmid and E-Input plasmid for 24 hours. Cells were then collected, and mRNA was enriched. The mRNA was reverse transcribed into cDNA, amplified, and the amplified fragments were sequenced. The output library obtained by transfecting cells with the P&E-Input plasmid was the experimental group output library, and the output library obtained by transfecting cells with the E-Input plasmid was the control group output library. In other words, the output library data obtained by transfecting cells with the P&E-Input plasmid followed by reverse transcription and amplification was the experimental group output library data, and the output library data obtained by transfecting cells with the E-Input plasmid followed by reverse transcription and amplification was the control group output library data.

[0050] 5. Comparative analysis of Input and Output library data in the experimental and control groups: Compare the transcriptional abundance ("transcriptional abundance" refers to the abundance of mRNA containing the inserted DNA fragment and the mCherry reporter gene) in the Input and Output libraries of the experimental and control groups: If the relative abundance in the Output library is significantly higher than that in the Input library in the experimental group, and the relative abundance in the Output library is not significantly different from that in the Input library in the control group, then the sequence to be tested is a promoter sequence; otherwise, it is not.

[0051] To verify the applicability of the FHI-Seq system and screening method to high-throughput screening, a library containing 1000 sequences (approximately 400-600 bp in size) was randomly synthesized. Enhancers R1 and R2, as well as promoters R3, R4, and Rm, were mixed into this library to construct an input library for high-throughput screening, which was then sequenced. Subsequently, the input library was transfected into cells, and an output library was further constructed and sequenced. The specific process is as follows:

[0052] (1) Preparation of insert fragment: Using 1000 randomly synthesized DNA sequences (mixed enhancers R1, R2 and promoters R3, R4, Rm) as templates, the insert fragment containing the homologous arm sequence (left arm: CTAGAGCATG right arm: ATATCGCGGC) was constructed by using the KAPA DNA HyperPlus library construction kit (Roche, KK8515) through steps such as end repair and A-tailing, adapter ligation, magnetic bead purification and homologous arm amplification.

[0053] (2) Construction of P&E-Input and E-Input plasmids: The P&E-Vector and E-Vector vectors were digested with AgeI (restriction site: A / CCGGT) and SalI (restriction site: G / TCGAC) restriction endonucleases, respectively. After running on an agarose gel, the linearized P&E-Vector and E-Vector vectors were recovered by gel cutting. The insert fragments prepared in step (1) were homologously recombined with the linearized P&E-Vector and E-Vector vectors respectively using Gibson AssemblyMaster Mix homologous recombinase (NEB, E2611L). After electroporation transformation of competent cells and expansion culture, plasmid DNA was extracted and labeled as "P&E-Input plasmid" (insert fragment homologous recombination with P&E-Vector vector) and "E-Input plasmid" (insert fragment homologous recombination with E-Vector vector), respectively.

[0054] (3) Input library construction method: Using 100ng of P&E-Input plasmid and E-Input plasmid DNA as templates, PCR amplification was performed using sequencing primers, followed by agarose gel running. The amplified fragments were then excised and recovered to form the Input library, which was then sent for sequencing.

[0055] (4) Output library construction method: After transfecting cells with the constructed P&E-Input plasmid and E-Input plasmid for 24 hours, the cells were collected and total RNA was extracted. The mRNA was enriched by Dynabeads Oligo(dT)25 magnetic beads (Thermo, 61005). The enriched mRNA was reverse transcribed into cDNA (containing the selection region) using SuperScript IV Reverse Transcriptase (Thermo, 18090050) and specific primers that are reverse complementary to the selection region [primer sequence: CAAACTCATCAATGTATCTTATCATG (SEQ ID No: 11), reverse complementary sequence: CATGATAAGATACATTGATGAGTTTG (SEQ ID No: 12)]. Using cDNA from the experimental group (transfected with P&E-Input plasmid) and the control group (transfected with E-Input plasmid) as templates, respectively, the cDNA was amplified using sequencing primers, then run on an agarose gel. The amplified fragments were excised and recovered to form the Output library, which was then sent for sequencing.

[0056] By comparing and analyzing the input and output library data of the experimental group (input and output libraries obtained using P&E-Input plasmids) and the control group (input and output libraries obtained using E-Input plasmids), it was found that only R1, R2, R3, R4, and Rm had significantly higher relative abundances in the output library than in the input library in the experimental group, and their enrichment folds (output library abundance / input library abundance) were as follows: Figure 4 As shown. And from Figure 4 Based on the enrichment folds of each promoter, it can be concluded that promoter R4 has the strongest activity, followed by promoter Rm, and promoter R3 has the weakest activity. In contrast, in the control group, only enhancers R1 and R2 have enrichment folds greater than 2 (e.g., Figure 5 As shown in the figure. It can be seen that the promoters are those whose relative abundance increases significantly in the experimental group but not in the control group, and vice versa (if neither increases, they are non-promoters; if both increase, they are also non-promoters).

[0057] In the above results, the FHI-Seq system can efficiently and sensitively screen for R3, R4, and Rm promoters from 1000 sequences, and effectively exclude R1 and R2 enhancers. This demonstrates that the FHI-Seq system can achieve high-throughput screening of genome-wide promoters and effectively identify promoter sequences; the system is efficient, convenient, and highly sensitive. Furthermore, based on the enrichment fold, it can efficiently detect promoter activity.

[0058] P&E-Vector vector nucleotide sequence (SEQ ID No:1):

[0059]

[0060] E-Vector vector nucleotide sequence (SEQ ID No:2):

[0061]

Claims

1. Facilitating sub-screening system, wherein, The screening system includes a P&E-Vector and an E-Vector, the P&E-Vector sequence of which is shown in SEQ ID No:1 and the E-Vector sequence of which is shown in SEQ ID No:

2.

2. The application of the promoter screening system as described in claim 1 in promoter screening or validation.

3. A method for facilitating sub-verification, wherein, The method includes the following steps: S1. Construct the P&E-Vector and E-Vector as described in claim 1; S2. Insert the sequence to be tested into the P&E-Vector and E-Vector vectors; S3. Real-time quantitative PCR detection of mCherry expression: If the relative expression level of mCherry protein in the P&E-Vector vector after insertion of the test sequence is significantly upregulated compared with the blank P&E-Vector vector without the inserted sequence, while the relative expression level of mCherry protein in the E-Vector vector after insertion of the test sequence and without the inserted test sequence is not significantly different or is not expressed, then the test sequence is a promoter sequence. Otherwise, it is a non-promoted subsequence.

4. The application of the facilitator verification method described in claim 3 in facilitator verification.

5. A method for promoting high-throughput screening of promoters, wherein, The method includes the following steps: S1. Prepare the insertion fragment: Break the genome or the sequence to be tested into fragments, and then add homologous arms to both ends of the fragmented DNA fragments; S2, Construction of P&E-Input plasmid and E-Input plasmid: The P&E-Vector and E-Vector described in claim 1 are linearized by enzyme digestion, and then the DNA fragment in step S1 is ligated with the linearized P&E-Vector by homologous recombination to construct the P&E-Input plasmid, and the DNA fragment in step S1 is ligated with the linearized E-Vector by homologous recombination to construct the E-Input plasmid. S3. Input library construction: After amplifying the P&E-Input plasmid using sequencing primers, the amplified fragments are recovered and sequenced to obtain the experimental input library; after amplifying the E-Input plasmid using sequencing primers, the amplified fragments are recovered and sequenced to obtain the control input library. S4. Output library construction: After transfecting cells with the constructed P&E-Input plasmid and E-Input plasmid for 24 hours, cells were collected, mRNA was enriched, and the mRNA was reverse transcribed into cDNA, then amplified, and the amplified fragment was recovered for sequencing. The output library obtained by transfecting the P&E-Input plasmid was the experimental group output library, and the output library obtained by transfecting the E-Input plasmid was the control group output library. S5. Comparative analysis of Input and Output library data between the experimental and control groups: If the relative abundance in the Output library is significantly higher than that in the Input library in the experimental group, and the relative abundance in the Output library is not significantly different from that in the Input library in the control group, then the sequence to be tested is a promoting sequence; otherwise, it is not.

6. The method according to claim 5, wherein, The homologous arm sequences in step S1 are shown in SEQ ID No:3 and SEQ ID No:

4.

7. The method according to claim 5, wherein, In step S1, the genome or the sequence to be tested is broken into DNA fragments of 400-600 bp.

8. The application of the method according to any one of claims 5-7 in promoting high-throughput screening.

9. A method for detecting promoter activity, wherein, The method includes the following steps: S1. Construct the P&E-Vector and E-Vector as described in claim 1; S2. Insert the promoter sequence to be tested into the P&E-Vector vector; S3. Real-time quantitative PCR is used to detect the transcription level of the mCherry protein gene. The higher the transcription level, the stronger the activity of the promoter.

Citation Information

Patent Citations

  • Whole genome insulator screening system and application thereof

    CN118853715A

  • Vector system for screening regulatory sequences and application

    WO2022142963A1