Application of corn gene RTCS1 in regulation and control of corn plant height character

Abstract

The invention belongs to the field of molecular genetics. The invention particularly relates to application of the corn gene RTCS1 in regulating and controlling the corn plant height character. The invention provides a gene RTCS1 for regulating and controlling the plant height of corn and a sequence of an encoding protein of the gene RTCS1, and discloses a method for reducing the plant height of the corn by mutating the RTCS1 gene by utilizing a genetic engineering means.

Description

Technical Field

[0001] This invention belongs to the field of molecular genetics. Specifically, it relates to the application of the maize gene RTCS1 in regulating maize plant height. This invention provides the sequence of the maize plant height regulating gene RTCS1 and its encoded protein, and discloses a method for reducing maize plant height by mutating the RTCS1 gene using genetic engineering techniques. Background Technology

[0002] Root development plays a crucial role in nutrient absorption and lodging resistance in maize. Previous research has extensively explored the genetic basis of maize root development regulation, identifying several key genes and regulatory factors, such as RTCS, RTCL, RUM1, and BIGE1. The RTCS (rootless concerning crown and seminal roots) gene was map-based cloned in 2007 (Taramino, G, et al. 2007). Studies have shown that the RTCS gene is an auxin-responsive gene, involved in early events leading to the initiation and maintenance of seed and shoot root primordia formation. Previous studies have confirmed that the RTCS gene affects maize root development, but its impact on other agronomic traits such as plant height remains unclear. Summary of the Invention

[0003] The technical problem to be solved by this invention is to clarify the function of the maize gene RTCS1 and its encoded protein.

[0004] To solve the above problems, the present invention adopts the following technical solution:

[0005] This invention provides an application of a protein in regulating maize plant height, characterized in that the amino acid sequence of the protein is shown in SEQ ID NO.1.

[0006] The present invention also provides an application of nucleic acid in regulating maize plant height, characterized in that: the nucleic acid encodes the protein described in claim 1.

[0007] In some implementations, the nucleotide sequence of the above-mentioned nucleic acid is shown in SEQ ID NO.2 or SEQ ID NO.3.

[0008] The present invention also provides a method for reducing maize plant height, characterized by: inhibiting the expression and / or activity of the above-mentioned protein in maize, and selecting maize plants with reduced plant height.

[0009] In some implementations, the methods for inhibiting protein expression and / or activity include any one of gene editing, RNA interference, or T-DNA insertion.

[0010] In some implementations, the gene editing described above uses the CRISPR / Cas9 method.

[0011] In some implementations, the DNA sequence of the genomic target region in maize by the above-described CRISPR / Cas9 method is shown in SEQ ID NO.4 and SEQ ID NO.5.

[0012] This invention also provides a kit for reducing maize plant height, characterized in that it comprises any one of the following:

[0013] (1) An RNA molecule capable of recognizing the target sequence described above; the RNA molecule may be an sgRNA molecule containing gRNA, crRNAs and tracrRNA structures, or a complex formed by gRNA, crRNAs and tracrRNA individually, or a complex containing gRNA and crRNAs; in some embodiments, the sequence of the RNA molecule described above is shown in SEQ ID NO.6 and SEQ ID NO.7.

[0014] (2) The DNA molecule encoding the RNA described in (1);

[0015] (3) Vectors that express the RNA described in (1).

[0016] The present invention also provides a maize mutant gene, characterized in that: the sequence of the mutant gene is as shown in SEQ ID NO.8 or SEQ ID NO.9.

[0017] This invention also provides the application of the aforementioned mutant genes in reducing maize plant height. These mutant genes or mutant proteins can be transferred to other maize materials or maize varieties through conventional cross-pollination, thereby reducing maize plant height and breeding new dwarf maize varieties.

[0018] The advantages and beneficial effects of this invention are as follows: The maize RTCS gene affects maize root development, but its impact on other agronomic traits such as plant height is unclear. This invention utilizes the CRISPR / Cas9 method to mutate this gene, discovering that the RTCS1 gene can regulate maize plant height, a previously unreported phenomenon. Using the CRISPR / Cas9 gene editing method and the edited mutant gene, maize plant height can be reduced, creating dwarf maize varieties, thereby increasing maize yield, reducing lodging rate, improving planting efficiency, and facilitating mechanized harvesting. Attached Figure Description

[0019] Figure 1Plant height performance after two separate transformation events following mutation of the maize RTCS1 gene protein using CRISPR-Cas9 technology. The left side of the image shows unedited plants, the middle side shows edited positive plants of transformation event 1, and the right side shows edited positive plants of transformation event 2. Detailed Implementation

[0020] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.

[0021] As used herein, “maize” means any maize plant and includes all plant varieties that can be bred with maize, including the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which the plant can regenerate, plant callus, and complete plant cells in a plant or plant part, such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stem, root, root tip, anther, etc. Unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' direction; amino acid sequences are written from left to right in the amino to carboxyl direction. Amino acids may be represented herein by their commonly known three-letter symbols or the single-letter symbols recommended by the IUPAC-IUB biochemical nomenclature. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the range. As used herein, “nucleic acid” includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and, unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) that have the basic properties of natural nucleotides and hybridize with single-stranded nucleic acids in a manner similar to that of naturally occurring nucleotides. As used herein, the term “encoding” or “encoded” in the context of a particular nucleic acid means that the nucleic acid contains the necessary information to guide the translation of that nucleotide sequence into a particular protein. Codons are used to represent the information encoding the protein. As used herein, “full-length sequence” referring to a particular polynucleotide or the protein it encodes means the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. Full-length polynucleotides encode the full-length, catalytically active form of that particular protein. The terms “polypeptide” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. This term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. This term is also used for naturally occurring amino acid polymers. The terms “residue” or “amino acid residue” or “amino acid” are used interchangeably in this document to refer to an amino acid incorporated into a protein, polypeptide, or peptide (collectively, “protein”). Amino acids can be naturally occurring amino acids, and unless otherwise limited, may include known analogs of naturally occurring amino acids that can function in a similar manner to naturally occurring amino acids.

[0022] As used herein, the terms "isolated" and "purified" may be used interchangeably to refer to nucleic acids or polypeptides or their biologically active portions, which are substantially or essentially free of components typically associated with or reacting with the nucleic acid or polypeptide as found in their natural environment. Thus, when isolated or purified nucleic acids or polypeptides are produced using recombinant techniques, they are substantially free of other cellular material or culture media, or when isolated or purified nucleic acids or polypeptides are chemically synthesized, they are substantially free of chemical precursors or other chemicals. "Isolated" nucleic acids typically do not contain sequences (such as sequences encoding proteins) naturally flanking the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid may comprise a nucleotide sequence of less than about 0.5 kb naturally flanking the nucleic acid in the genomic DNA of the cell from which the nucleic acid is derived.

[0023] In this application, the terms "comprising," "including," or variations thereof should be understood to include other elements, numbers, or steps besides those described. "Test plant" or "test plant cell" refers to a plant or plant cell in which genetic modification has taken effect, or a progeny cell of such a modified plant or cell containing the modification. "Control," "control plant," or "control plant cell" provides a reference point for measuring phenotypic changes in the test plant or plant cell. Control plants or plant cells may include, for example: (a) wild-type plants or cells, i.e., plants or cells with the same genotype as the genetic modification starting material, the genetic modification producing the test plants or cells; (b) plants or plant cells with the same genotype as the starting material but transformed with an empty construct (i.e., a construct with no known effect on the target trait, such as a construct containing the target gene); (c) plants or plant cells that are non-transformed isomers of the test plants or plant cells; (d) plants or plant cells that are genetically identical to the test plants or plant cells but not exposed to conditions or stimuli that would induce the expression of the target gene; or (e) the test plants or plant cells themselves, which are under conditions where the target gene is not expressed.

[0024] Those skilled in the art will readily recognize that advances in molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, have provided a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequences and potential gene sequences of proteins of interest in agriculture.

[0025] In some embodiments, the nucleotide sequence of this application may be modified to perform conserved amino acid substitutions. Principles and examples of conserved amino acid substitutions are further described below. In some embodiments, the nucleotide sequence of this application may be substituted without altering the amino acid sequence according to disclosed monocotyledonous codon preferences; for example, a codon encoding the same amino acid sequence may be substituted with a codon preferred by monocotyledons without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application may be substituted with a different codon encoding the same amino acid sequence, thereby changing the nucleotide sequence without altering the encoded amino acid sequence. Conserved variants include those sequences that encode an amino acid sequence of one of the proteins of the embodiments due to genetic codon degeneracy. In some embodiments, a portion of the nucleotide sequence in this application may be substituted according to a codon preferred by monocotyledons. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of amino acid side-chain substituents, such as the hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituents having the various properties considered above are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conserved substitutions, such as replacing one amino acid with another amino acid having similar properties, can be performed. Sequence identity verification includes hybridization techniques. For example, a known nucleotide sequence, in whole or in part, can be used as a probe for selective hybridization with other corresponding nucleotide sequences present in cloned genomic DNA fragments or cDNA fragment groups (i.e., genomic libraries or cDNA libraries) from a selected organism.

[0026] In some embodiments, a fragment of a nucleotide sequence and the amino acid sequence it encodes is also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide of an embodiment or a portion of the amino acid sequence of a polypeptide. A fragment of the nucleotide sequence may encode a protein fragment that retains the biological activity of the native or corresponding full-length protein and thus has protein activity. Mutant proteins include biologically active fragments of native proteins containing consecutive amino acid residues that retain the biological activity of the native protein. Some embodiments also include transformed plant cells or transgenic plants containing a nucleotide sequence of at least one embodiment. In some embodiments, plants are transformed using an expression vector containing a nucleotide sequence of at least one embodiment and a promoter operatively linked thereto that drives expression in plant cells. Transformed plant cells and transgenic plants represent plant cells or plants whose genome contains a heteropolynucleotide. Generally, the heteropolynucleotide is stably integrated into the genome of the transformed plant cell or transgenic plant to pass the polynucleotide to offspring. The heteropolynucleotide may be integrated into the genome alone or as part of an expression vector. In some embodiments, the plants involved in this application include plant cells, plant protoplasts, plant cell tissue cultures capable of regenerating plants, plant callus, plant masses, and plant cells that are whole plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, kernels, ears, rachis, husks, straw, roots, root tips, anthers, etc. This application also includes plant cells, protoplasts, tissues, callus, embryos, flowers, stems, fruits, leaves, and roots derived from transgenic plants of this application or their progeny, and thus at least partially containing the nucleotide sequences of this application.

[0027] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance thereof are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: alaboratory manual, 2001), or according to the conditions recommended in the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available conventional reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

[0028] Example

[0029] Example 1: Maize RTCS1 gene

[0030] The maize RTCS1 gene (Zm00001eb003920) is located on chromosome 1, and its protein encodes the Lateral Organ Boundaries (LOB) domain. This invention designs editing sites based on a reference gene sequence and uses the CRISPR / Cas9 gene editing system to create edited mutant materials of the maize RTCS1 gene. The phenotypic traits of these edited materials are then investigated to clarify the function and regulatory traits of specific RTCS1 genes.

[0031] Example 2: Analysis of gene function from gene editing and knockout candidate genes.

[0032] This invention utilizes CRISPR-Cas9 gene editing technology to knock out the aforementioned genes. The implementation methods include the construction of a gene editing vector, genetic transformation of maize, and functional verification of the editing effect. Details are as follows:

[0033] 1. Construction of gene editing vectors

[0034] This invention involves digesting the pCXB053 backbone vector with BsaI to remove the ccdB sequence, and then ligating the target sequence (as shown in SEQ ID NO.4 and SEQ ID NO.5) between U6 and gRNA using T4 ligase. The specific construction process is as follows:

[0035] 1) Synthetic primers

[0036] Primer T1F: CAATGGTCTCAATTGCTCCATTGCCGCTGCACCAGTTTTAGAGCTAGAAATAG; Primer T2R: TTGGGGTCTCTAAACCCGCGCAGCCGGGCGCGTACAATTCGGTGCTTGCGGCTC. Synthesized at Shanghai Sangon Biotech, the mixture was dissolved in ultrapure water and then thoroughly mixed.

[0037] 2) PCR amplification

[0038] 50ul system

[0039]

[0040]

[0041] The PCR instrument runs the following series of reactions

[0042]

[0043] Use the DC301 kit (PCR gel recovery kit).

[0044] 3) Enzyme digestion treatment of PCR products

[0045] 50ul system

[0046]

[0047] The PCR product was digested with BsaI enzyme and incubated at 37°C for approximately 1 hour.

[0048] Use the DC301 kit (PCR gel recovery kit).

[0049] 4) The backbone vector was digested with BsaI restriction enzyme.

[0050] Enzyme digestion system:

[0051]

[0052]

[0053] After enzyme digestion at 37 degrees Celsius for 5 hours, the enzyme was directly recovered (using the Quangen recovery kit).

[0054] The recovered product was diluted with water to 50 ng / μL, then diluted with an equal volume of T4 Buffer and stored at -20°C.

[0055] 5) T4 enzyme-linked

[0056] Enzyme ligation system:

[0057]

[0058] Enzyme ligation procedure:

[0059] 16℃ for 2 hours (in PCR instrument)

[0060] 6) Transformation of Escherichia coli

[0061] Mix 10 μL of enzyme-linked immunosorbent assay (ELISA) solution with 100 μL of E. coli 5a competent cells, incubate strictly on ice for 30 min, heat shock at 42°C for 35 s, incubate on ice for 2 min, add 500 L of antibiotic-free LB medium, and incubate at 37°C with shaking for 1 h. Centrifuge at 3000g for 1 min, aspirate the supernatant, leaving 100 μL of liquid. After remixing the bacterial cells, plate the mixture onto a plate (solid medium containing 50 mg / L kanamycin), and incubate upside down at 37°C for 12 h.

[0062] Positive clones were selected for sequencing and plasmid extraction. Sequencing verification primers were used.

[0063] QC1: CTGGCGAAAGGGGGATGTGCTGCAA

[0064] QC4: CTTAGACATGCAATGCTCAT

[0065] 2. Maize genetic transformation

[0066] The vector was transferred into Agrobacterium EHA105 via electroporation, and identified by PCR. Using freshly peeled immature embryos (approximately 1 mm in diameter) of the maize inbred line KN5585 (bred by Weimi Biotechnology (Jiangsu) Co., Ltd.), approximately 150 immature embryos were processed within 30 minutes. The suspension was removed, leaving the remaining maize embryos in the tube. Then, 1.0 mL of Agrobacterium suspension was added, and the tubes were incubated for 5 minutes. The embryos were then resuspended in the centrifuge tubes and transferred to a co-culture medium. Excess Agrobacterium suspension was removed using a pipette, and the tubes were co-cultured in the dark at 23°C for 3 days. After co-culture, the embryos were transferred to resting medium and incubated in the dark at 28°C for 6 days. They were then transferred to selection medium containing 5 mg / L Bialaphos for 2 weeks of selection, followed by 2 weeks of selection culture on selection medium containing 8 mg / L Bialaphos. The resistant callus was transferred to differentiation medium 1 and cultured at 25°C, 5000 lx, under light for 1 week. The callus was then transferred to differentiation medium 2 and cultured under light for 2 weeks. The differentiated seedlings were transferred to rooting medium and cultured at 25°C, 5000 lx, under light until rooting occurred. The seedlings were then transferred to small pots for further growth. After a certain growth stage, they were transplanted into a greenhouse, and the offspring seeds were harvested after 3-4 months.

[0067] 3. Evaluation of the traits of gene-edited plants

[0068] DNA was extracted from seedlings of the T1 generation material to detect gene editing. Primers were designed to amplify the target editing segment. The amplification system was as follows: DNA: 3 μL, each of the bidirectional primers: 1 μL, 2×TaqMix: 7.5 μL, ddH2O: 2.5 μL, total volume: 10 μL. The PCR reaction conditions were as follows: (1) 94℃ for 5 minutes, (2) 94℃ for 40 seconds, (3) 57℃ for 30 seconds, (4) 72℃ for 60 seconds, (5) 35 cycles from step (2) to step (4), (6) 72℃ for 7 minutes, (7) stored at 4℃. The PCR products were sequenced. The sequencing results of the transformed strains were compared with the genome of wild-type KN5585. Materials with base substitutions, insertions, or deletions were positive editing materials, otherwise they were negative materials. After phenotypic identification of each gene-edited material, the inventors unexpectedly discovered that the plant height of the RTCS1 gene-edited plants changed. Figure 1 ).

[0069] Further analysis was conducted on the RTCS1 gene-edited plants. Two independent transformation events were observed. Sequence analysis of the target editing region revealed that the gene was edited in both transformation events (KO1 and KO2), with a 61 bp deletion between the 6th base of sgRNA1 and the 9th base of sgRNA2, and a 57 bp deletion between the 7th base of sgRNA1 and the 6th base of sgRNA2 (edited gene sequences are shown in SEQ ID NO. 8 and SEQ ID NO. 9; editing details are shown in Table 1). The deletion of these fragments led to premature termination of protein translation, and the protein structure was completely disrupted. An investigation of the plant height of the edited plants during the later stages of pollination revealed that the plant height of the edited plants was significantly lower than that of the unedited plants (data shown in Table 2), indicating that mutating this gene or inhibiting its encoded protein can reduce maize plant height and cultivate dwarf maize.

[0070] Table 1 Target editing status of RTCS1 gene-edited maize materials

[0071]

[0072] Table 2 Plant height data of RTCS1 gene-edited maize materials

[0073]

[0074] According to the reference genome database, the RTCS1 genome sequence is shown in SEQ ID NO.2. The cDNA sequence is shown in SEQ ID NO.3, and the encoded amino acid sequence is shown in SEQ ID NO.1.

[0075] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention.

Claims

1. The application of a protein in regulating maize plant height, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

1.

2. An application of a nucleic acid in regulating maize plant height, characterized in that: The nucleic acid encodes the protein of claim 1; optionally, the nucleotide sequence of the nucleic acid is as shown in SEQ ID NO.2 or SEQ ID NO.

3.

3. A method for reducing maize plant height, characterized in that: Inhibit the expression and / or activity of the protein described in claim 1 in maize, selecting maize plants with reduced plant height.

4. The method for reducing maize plant height according to claim 3, characterized in that: The methods for inhibiting protein expression and / or activity include any one of gene editing, RNA interference, and T-DNA insertion.

5. The method for reducing maize plant height according to claim 4, characterized in that: The gene editing was performed using the CRISPR / Cas9 method.

6. The method for reducing maize plant height according to claim 5, characterized in that: The DNA sequences of the genomic target regions in maize obtained by the CRISPR / Cas9 method are shown in SEQ ID NO.4 and SEQ ID NO.

5.

7. A kit for reducing maize plant height, characterized in that: Including any of the following: (1) An RNA molecule capable of recognizing the target sequence described in claim 6; (2) A DNA molecule encoding the RNA described in (1); (3) Vectors that express the RNA described in (1).

8. The reagent kit according to claim 7, characterized in that: The sequences of the RNA molecules are shown in SEQ ID NO.6 and SEQ ID NO.

7.

9. A maize mutant gene, characterized in that: The mutant gene sequence is shown in SEQ ID NO.8 or SEQ ID NO.

9.

10. The application of the mutant gene of claim 9 in reducing the height of maize plants.

Images