Transaminase mutant and application thereof in oseltamivir synthesis

By performing directed evolutionary modification of transaminases and designing multi-site mutants to enhance catalytic activity, the problems of complex and high cost in the synthesis of oseltamivir phosphate have been solved, enabling efficient and low-cost industrial production.

CN121555459APending Publication Date: 2026-02-24杭州微远生物科技有限公司
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511901104.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-16
Publication Date
2026-02-24

AI Technical Summary

Technical Problem

The existing synthesis process of oseltamivir phosphate is complex, with low yield and high cost, making it difficult to meet industrial needs. In particular, the insufficient catalytic activity of transaminase limits the catalytic effect of high-concentration substrates.

Method used

A transaminase mutant was designed, and the transaminase was modified by directed evolution technology to enhance its catalytic activity. Multiple site mutants, such as TA-I17A-L89M-V147L-L182F-N245E, were used to improve catalytic activity, simplify the synthetic route, and reduce the use of chemical reagents.

Benefits of technology

It improved the catalytic activity of transaminase, reduced production costs, and enhanced the production efficiency and industrial application potential of oseltamivir phosphate, with a yield of 86%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121555459A_ABST
    Figure CN121555459A_ABST
Patent Text Reader

Abstract

The invention discloses a transaminase mutant and application thereof in oseltamivir synthesis, transaminase with an amino acid sequence as shown in SEQ ID NO.2 is taken as a parent and mutated through one or more sites, and the transaminase mutant is selected from one of the following mutants: a mutant TA-I17A, a mutant TA-I17A, a mutant TA-I17A, a mutant TA-I17B, a mutant TA-I17A, a mutant TA-I17B, a mutant TA-I17C A mutant TA-S56G; a mutant TA-L89M; the invention discloses a mutant TA-I17A-S56G and a mutant A mutant TA-S56G-L89M, and a mutant A mutant TA-I17A-L89M, and a mutant The mutant of TA-I17A-L89M-V147L has the following structural formula shown in the specification, the invention relates to a mutant TA-I17A-L89M-V147L-L182F, which has the following structural formula shown in the description The invention relates to a mutant TA-I17A-L89M-V147L-L182F-N245E, and the mutant has a structural formula shown in the specification. Compared with parent transaminase, the oseltamivir phosphate has higher catalytic activity, the production efficiency can be improved, the production cost is reduced, and the oseltamivir phosphate has a good application prospect in industrial production of oseltamivir phosphate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biosynthesis technology, and in particular to a transaminase mutant and its application in the synthesis of oseltamivir. Background Technology

[0002] Influenza (flu) is an acute respiratory infectious disease caused by the influenza virus, characterized by distinct seasonality and widespread susceptibility. Currently, oseltamivir phosphate is one of the first-line oral antiviral drugs for influenza, widely used to treat both influenza A and B due to its low toxicity, high target specificity, and good patient tolerability. In recent years, against the backdrop of the COVID-19 pandemic and the continued rise in influenza cases, oseltamivir phosphate has become one of the most watched antiviral drugs in my country, with huge market potential and broad application prospects.

[0003] However, oseltamivir phosphate has a complex molecular structure containing three chiral centers, making its synthesis process quite challenging. Currently, its industrial synthesis routes can be mainly divided into two categories: one is the asymmetric synthesis route based on achiral chemical raw materials; the other is the semi-synthetic route using natural chiral raw materials as starting materials. Although various synthetic methods have been reported, industrially feasible processes still mainly rely on natural chiral raw materials. This, while ensuring the stereoconfiguration of the product, also brings challenges in raw material sourcing and cost control. For example, Gilead Sciences was the first to develop an industrially producible route for oseltamivir phosphate using dextroquinic acid as a starting material, involving 12 steps with an overall yield of only 4.4%. In 1999, Gilead Sciences and Roche jointly developed an industrial route for synthesizing oseltamivir phosphate from shikimic acid, involving 13 steps with an overall yield of only 17.7%. In 2004, Roche developed a novel azide-free route, avoiding the introduction of sodium azide. Oseltamivir phosphate was synthesized from epoxy compounds via an eight-step reaction involving ring-opening of tert-butylamine, methanesulfonation-cyclization to aziridine, ring-opening of diallylamine, acetylation, hydrochloric acid salt formation, detert-butylation, dediallylation, and phosphoric acid salt formation, achieving an overall yield of 62%. However, the numerous steps, poor atom economy, and the large amount of waste generated during the multi-step reaction, which does not meet the requirements of green environmental protection, still limit its industrial production.

[0004] The combination of enzymatic and chemical processes has also provided new ideas for the production of oseltamivir phosphate. For example, using ethyl benzoate as a substrate, fermentation is carried out using a specific Escherichia coli strain, E. coli JM109, to produce cyclohexadiene-cis-diol, which is then converted into oseltamivir phosphate through multiple chemical transformations. The applicant has previously designed a novel synthetic route, but this route is still in the optimization stage. The transaminase activity used is not yet sufficient to catalyze high concentrations of substrate, which limits its industrialization process. Summary of the Invention

[0005] The purpose of this invention is to provide a transaminase mutant and its application in the synthesis of oseltamivir. Compared with the parental transaminase, it has higher catalytic activity, which can improve production efficiency and reduce production costs. It has good application prospects in the industrial production of oseltamivir phosphate.

[0006] The technical solution adopted by this invention to solve its technical problem is: A transaminase mutant, derived by mutation at one or more sites using the transaminase with the amino acid sequence shown in SEQ ID NO.2 as the parent, wherein the transaminase mutant is selected from one of the following: Mutant TA-I17A: The 17th I in the parental chromosome is mutated to A; Mutant TA-S56G: The parental S is mutated to G at position 56; Mutant TA-L89M: The 89th L position of the parental chromosome is mutated to M; Mutant TA-I17A-S56G: The parental I at position 17 is mutated to A and the S at position 56 is mutated to G; Mutant TA-S56G-L89M: The parental S at position 56 is mutated to G and the L at position 89 is mutated to M; Mutant TA-I17A-L89M: The parental I at position 17 is mutated to A and the L at position 89 is mutated to M; The mutant TA-I17A-L89M-V147L has the following mutations: the parental I at position 17 is mutated to A, the L at position 89 is mutated to M, and the V at position 147 is mutated to L. Mutant TA-I17A-L89M-V147L-L182F: The parental I at position 17 is mutated to A, L at position 89 is mutated to M, V at position 147 is mutated to L, and L at position 182 is mutated to F; The mutant TA-I17A-L89M-V147L-L182F-N245E has the following mutations: the parental I at position 17 is mutated to A, the L at position 89 is mutated to M, the V at position 147 is mutated to L, the L at position 182 is mutated to F, and the N at position 245 is mutated to E.

[0007] The transaminase with the amino acid sequence shown in SEQ ID NO.2 is derived from Aspergillus terreus.

[0008] In a previous application (application number 2025118047246), the applicant designed a novel synthetic route using the natural compound shikimic acid as a raw material. Through esterification-ketalization, oxidation, transaminase catalysis, and other steps, different chiral centers were synthesized, followed by phosphorylation to obtain oseltamivir phosphate. This route avoids the sodium azide step required in traditional routes, enhancing production safety and industrialization potential. Furthermore, by utilizing two different transaminases to construct different chiral centers, the traditional steps of protecting and deprotecting groups are eliminated. The overall route is concise, uses fewer chemical reagents, and achieves higher yields, better meeting the demands of green, environmentally friendly, and low-cost industrialization. However, this route is still in the optimization stage. The inventors discovered that the transaminase activity used in Step 7 was insufficient to catalyze high concentrations of substrate, limiting its industrialization. Therefore, this invention molecularly modifies transaminase 2 used in Step 7 to enhance its catalytic activity. This invention utilizes directed evolution technology to modify its activity, resulting in a transaminase mutant with catalytic activity 1.4 to 6.3 times that of the parent TA.

[0009] Conservative substitutions, additions or deletions of one or more amino acids, amino-terminal truncation, and carboxyl-terminal truncation of other amino acid sites of the above-mentioned transaminases are also included within the scope of this invention.

[0010] The parental transaminase TA (transaminase 2, application number 2025118047246) requires a cell concentration of 50 g / L to catalyze 40 g / L OS-07. Increasing the substrate concentration further prevents complete catalysis by OS-07, resulting in a large amount of residual substrate that not only reduces yield but also adds extra impurity removal steps, increasing production costs. The mutants TA-I17A, TA-S56G, TA-L89M, TA-I17A-S56G, TA-S56G-L89M, TA-I17A-L89M, TA-I17A-L89M-V147L, TA-I17A-L89M-V147L-L182F, and TA-I17A-L89M-V147L-L182F-N245E are also mentioned. The activity was increased to 1.4, 1.3, 1.5, 1.2, 1.3, 2.1, 3.2, 4.6 and 6.3 times that of the parent, and it can catalyze the synthesis of oseltamivir from 40-150g of OS-07 at a cell concentration of 20-100g, showing better potential for industrial application and economic benefits.

[0011] A polynucleotide sequence encoding the transaminase mutant described above.

[0012] A recombinant vector comprising the aforementioned polynucleotide sequence. The original vector is preferably pET28a.

[0013] A host cell comprising the recombinant vector. The host cell can be any conventional host cell in the art, with *Escherichia coli* BL21 being a preferred host cell.

[0014] The application of the transaminase mutant as an enzyme catalyst in the preparation of oseltamivir phosphate.

[0015] A chemical-enzymatic coupling synthesis method for oseltamivir phosphate, using shikimic acid OS-01 as a substrate, sequentially undergoes S1 esterification, S2 ketalization, S3 selective ring opening, S4 TEMPO oxidation, S5 primary transaminase reaction, S6 acetylation, S7 secondary transaminase reaction, and S8 phosphorylation reaction to obtain the final product oseltamivir phosphate OS-09. The S7 secondary transaminase reaction uses the aforementioned transaminase mutant as an enzyme catalyst. .

[0016] The steps S1-S6 and S8 of this invention are the same as those in the applicant's prior application (application number 2025118047246), with the core difference being the improvement to step S7, which involves transaminase 2.

[0017] Preferably, the transaminase mutant is added in the form of pure enzyme, immobilized enzyme, crude enzyme solution, or wet cells of recombinant genetically engineered bacteria.

[0018] As a preferred embodiment, the reaction system for the S7 secondary transaminase reaction has the following composition: The substrate OS-07 concentration is 40-150 g / L, the recombinant genetically engineered bacterial cells expressing the transaminase mutant are 20-100 g / L, pyridoxal phosphate is 0.5-2.0 mM / L, and isopropylamine is used, with the amount of isopropylamine being 1-2 times the molar amount of substrate OS-07. The reaction medium is triethanolamine buffer (concentration 20-100 mM) with a pH of 8-9. The wet bacterial cells contain 70-90% water by weight.

[0019] Preferably, the reaction temperature of the S7 secondary transaminase reaction is 5-40℃, and the reaction time is 2-24 hours.

[0020] The beneficial effects of this invention are: it has higher catalytic activity than the parental transaminase, which can improve production efficiency and reduce production costs, and has good application prospects in the industrial production of oseltamivir phosphate. Attached Figure Description

[0021] Figure 1 Catalytic activity of transaminase mutant TA-5t at different pH values; Figure 2 Catalytic activity of transaminase mutant TA-5t at different temperatures. Detailed Implementation

[0022] The technical solution of the present invention will be further described in detail below through specific embodiments.

[0023] In this invention, unless otherwise specified, all raw materials and equipment used are commercially available or commonly used in the field. The methods described in the following embodiments are conventional methods in the field, unless otherwise specified.

[0024] The culture medium used for the recombinant expression transformant can be any culture medium in the art that can enable the transformant to grow and produce the transaminase of the present invention, preferably LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.0. There are no special requirements for the culture method and conditions, as long as the transformant can grow and produce the transaminase.

[0025] Example 1: Construction of recombinant Escherichia coli containing transaminase mutant To obtain single-site mutants of transaminase TA-I17V (amino acid sequence SEQ ID NO.3), TA-S56G (amino acid sequence SEQ ID NO.4), and TA-L89M (amino acid sequence SEQ ID NO.5) by site-directed mutagenesis at positions 17, 56, and 89 in the parental amino acid sequence, and using recombinant plasmid pET28a-TA-I17V or TA-S56G as templates, single-site mutations were sequentially performed to obtain multiple mutants of transaminase TA-I17A-S56G (amino acid sequence SEQ ID NO.6), TA-S56G-L89M (amino acid sequence SEQ ID NO.7), TA-I17A-L89M (amino acid sequence SEQ ID NO.8), TA-I17A-L89M-V147L (amino acid sequence SEQ ID NO.9), and TA-I17A-L89M-V147L-L182F (amino acid sequence SEQ ID NO.8). The amino acid sequence is SEQ ID NO.10), and TA-I17A-L89M-V147L-L182F-N245E (amino acid sequence SEQ ID NO.11). Corresponding primers were designed, and the primer sequences are shown in Table 1.

[0026] The recombinant plasmid pET28a-TA containing the target gene fragment was used as a template. Its amino acid sequence is shown in SEQ ID NO.2 and its nucleotide sequence is shown in SEQ ID NO.1. The template was amplified in its entirety using the overlap extension PCR method.

[0027] The PCR amplification system was as follows (50µL): 1ng template DNA, 25µL 2×PhantaMax buffer (Nanjing Novizan), 1µL dNTPs (10mM each), 1µL upstream and downstream of the mutant primer, 1U PhantaMax high-fidelity DNA polymerase (Nanjing Novizan), and the remainder ddH2O was added to the total volume.

[0028] PCR reaction parameters: (1) 95 ℃ pre-denaturation for 30 s; (2) 95 ℃ denaturation for 30 s; (3) 65 ℃ annealing for 30 s; (4) 72 ℃ extension for 6 min, steps (2)-(4) were repeated 30 times; (5) 72 ℃ complete extension for 7 min, and stored at 16 ℃. After the PCR product was positive by 0.9% agarose gel electrophoresis, 20 µL of PCR reaction solution was taken, and 1 µL of restriction enzyme Dpn I was added for digestion at 37 ℃ for 3 h to remove template plasmid DNA, and inactivated at 65 ℃ for 10 min. The cells were heat-shocked and transformed into E. coli BL21(DE3) competent cells. After recovery, the cells were plated on LB plates containing kanamycin and cultured overnight. Each plate yielded a mutant library of about 300 clones. Subsequently, 4-5 clones were selected and cultured on LB medium at 37 ℃ for 8 h. The bacterial culture was then sequenced to obtain recombinant engineered bacteria with transaminase mutants: E. coli BL21(DE3) / pET28a-TA-I17A, E. coli BL21(DE3) / pET28a-TA-S56G, E. coli BL21(DE3) / pET28a-TA-L89M, E. coli BL21(DE3) / pET28a-TA-I17A-S56G, E. coli BL21(DE3) / pET28a-TA-S56G-L89M, E. coli BL21(DE3) / pET28a-TA-I17A-L89M, E. coli BL21(DE3) / pET28a-TA-I17A-L89M-V147L, and E. coli BL21(DE3) / pET28a-TA-I17A-L89M-V147L. BL21(DE3) / pET28a-TA-I17A-L89M-V147L-L182F and BL21(DE3) / pET28a-TA-I17A-L89M-V147L-L182F-N245E have amino acid sequences as shown in SEQ ID NO.3-SEQ ID NO.11.

[0029] Table 1: Primer Design Table .

[0030] Example 2: Preparation of recombinant Escherichia coli containing transaminase mutant The parental transaminase TA and the mutant obtained in Example 1 were inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C. Then, 2% (v / v) inoculation was carried out into LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C and 150 rpm until the bacterial cell concentration reached OD. 600 =Approximately 0.6, add IPTG to a final concentration of 0.1 mM, induce culture at 20℃ for 12 h, collect the cells by centrifugation at 4℃ and 12000 rpm for 10 min, wash the wet cells with 0.85% physiological saline, and store at -20℃ for later use (i.e., resting cells, used for the reaction).

[0031] Example 3: Assay of the activity of recombinant Escherichia coli with transaminase mutants Using the parental transaminase TA prepared in Example 2 and recombinant *E. coli* containing transaminase mutants TA-I17A, TA-I17A-L89M, TA-I17A-L89M-V147L, TA-I17A-L89M-V147L-L182F, and TA-I17A-L89M-V147L-L182F-N245E as catalysts, 40 g / L OS-07 (preparation method described in the applicant's prior application, application number 2025118047246) was catalyzed under the following conditions: 20 mL of triethanolamine buffer (100 mM, pH 9.0), 0.8 g... 1.0 g of each of the following recombinant Escherichia coli wet cells (OS-07, TA, TA-I17A, TA-S56G, TA-L89M, TA-I17A-S56G, TA-S56G-L89M, TA-I17A-L89M, TA-I17A-L89M-V147L, TA-I17A-L89M-V147L-L182F, and TA-I17A-L89M-V147L-L182F-N245E) were reacted with 1 mM / L pyridoxal phosphate, using isopropylamine at 2 times the substrate concentration as the amino donor, and the reaction was carried out at 35°C for 1 h to determine the transformation status of each mutant.

[0032] As shown in Table 2, after 1 h of reaction, the conversion rate of 40 g / L OS-07 catalyzed by 50 g / L parental transaminase TA was 11.4%. The three single mutants TA-I17A, TA-S56G, and TA-L89M all showed significant improvements, being 1.4 times, 1.3 times, and 1.5 times that of the parental mutants, respectively. Subsequently, the activities of the three sites were stacked as double mutants, and it was found that the activities of the mutants TA-I17A-S56G, TA-S56G-L89M, and TA-I17A-L89M were 1.2 times, 1.3 times, and 2.1 times that of the parental mutants, respectively. This indicates that the S56G site may not be able to form a positive synergistic effect with the other two sites. Therefore, TA-I17A-L89M was selected to continue stacking other mutations. The conversion rates of the mutants TA-I17A-L89M-V147L, TA-I17A-L89M-V147L-L182F, and TA-I17A-L89M-V147L-L182F-N245E were 36.5%, 48.4%, and 62.3%, respectively. The catalytic activity of each mutant was significantly improved, especially the five-mutant TA-I17A-L89M-V147L-L182F-N245E (hereinafter referred to as TA-5t), which showed the most significant improvement. TA-5t was used in subsequent experiments.

[0033] Table 2: Comparison of transaminase mutant activities .

[0034] Example 4: Optimization of reaction pH for transaminase mutant TA-5t Using recombinant *E. coli* containing the transaminase mutant TA-5t prepared in Example 2 as a catalyst (cell concentration reduced to 20 g / L to prevent excessive conversion), 40 g / LOS-07 was catalyzed in buffer solutions at pH 5.0, pH 6.0, pH 7.0, pH 8.0, pH 9.0, and pH 10.0. The reaction conditions were: 20 mL of buffer solutions of different pH (100 mM, pH 5.0-10.0), 0.8 g OS-07, 0.4 g of wet recombinant *E. coli* cells, 1 mM / L pyridoxal phosphate, and isopropylamine at twice the substrate concentration as the amino donor. The reaction was carried out at 35°C for 1 h, and the conversion at each pH was measured. The results are as follows: Figure 1 As shown, the catalytic activity of TA-5t showed an increasing trend between pH 5.0 and 9.0, reaching its highest value at pH 9.0, and then rapidly decreasing at pH 10.0. This may be because excessively high pH affects enzyme activity. Therefore, pH 9.0 was selected as the optimal reaction pH for the transaminase mutant TA-5t.

[0035] Example 5: Optimization of reaction temperature for transaminase mutant TA-5t Using recombinant *E. coli* containing the transaminase mutant TA-5t prepared in Example 2 as a catalyst (cell concentration reduced to 20 g / L to prevent excessive conversion), 40 g / LOS-07 was catalyzed at temperatures of 15, 20, 25, 30, 35, 40, 45, 50, and 55°C. The reaction conditions were: 20 mL triethanolamine buffer (100 mM, pH 9.0), 0.8 g OS-07, 0.4 g wet recombinant *E. coli* cells, 1 mM / L pyridoxal phosphate, and isopropylamine at twice the substrate equivalent as the amino donor. The conversion was measured after reacting at different temperatures for 1 h. Figure 2 As shown, at a bacterial cell concentration of 20 g / L, the transaminase mutant TA-5t exhibited higher catalytic activity between 15-35℃ with increasing temperature after 1 h of reaction. The conversion rate reached a maximum of 29.3% at 35℃, but decreased rapidly with further increases in temperature, reaching only about 1% at 55℃. It is speculated that excessively high temperatures affected the enzyme structure, leading to enzyme inactivation. Therefore, 35℃ was selected as the optimal reaction temperature for the transaminase mutant TA-5t.

[0036] Example 6: Optimization of cell and substrate concentrations in the transaminase mutant TA-5t catalyzed reaction Using recombinant Escherichia coli containing the transaminase mutant TA-5t prepared in Example 2 as a catalyst, 40-150 g / L OS-07 was catalyzed at a bacterial cell concentration of 20-100 g / L. The reaction conditions were as follows: 20 mL of triethanolamine buffer (100 mM, pH 9.0), 0.8 g-3.0 g OS-07, 0.4 g-2.0 g of wet recombinant Escherichia coli cells, 1 mM / L pyridoxal phosphate, and isopropylamine at 2 times the substrate concentration as the amino donor. The reaction was carried out at 35°C for 24-28 h, and samples were taken for detection.

[0037] The reactions catalyzed by the TA-5t mutant are shown in Table 3. The transaminase mutant TA-5t can catalyze 40-80 g / L of OS-07 in the wet cell concentration range of 20 g / L, but the conversion rate only reaches 91.2% when the substrate concentration is increased to 100 g / L. Therefore, when the cell concentration is increased to 30 g / L, complete conversion is found. Subsequently, catalytic reactions were carried out under the conditions of 120 g / L substrate and 40 g / L cell, 150 g / L substrate and 50 g / L cell, and 180 g / L substrate and 60 g / L cell, respectively. It was found that complete conversion can be achieved at the condition of 150 g / L substrate and 50 g / L cell. Therefore, this condition was selected as the condition for subsequent scale-up.

[0038] Table 3. Optimization of transaminase mutant TA-5t cell concentration and substrate concentration. .

[0039] Example 7: Synthesis of Oseltamivir using OS-07 catalyzed by recombinant Escherichia coli containing the transaminase mutant TA-5t. Oseltamivir was prepared using recombinant *E. coli* containing the transaminase mutant TA-5t (prepared in Example 2) as a catalyst in a 30 L large-scale reaction. The reaction system was as follows: 30 L of triethanolamine buffer (100 mM, pH 9.0), 4500 g of OS-07, 1500 g of wet recombinant *E. coli* cells, 1 mM / L pyridoxal phosphate, and isopropylamine at twice the substrate concentration as the amino donor. The pH was maintained at 9.0 during the reaction, and the reaction was carried out at 35 °C for 24-28 h before sampling and analysis.

[0040] After the catalytic reaction reached complete conversion at 35°C, the above reaction was terminated. The E. coli cells were removed by centrifugation at 12000 rpm for 10 min, and oseltamivir was extracted by conventional extraction. The organic phases after multiple extractions were combined and concentrated under reduced pressure to obtain 3842.7 g of product, with a yield of 86%.

[0041] Example 8: A chemical-enzymatic coupling synthesis method for oseltamivir phosphate, using shikimic acid OS-01 as a substrate, sequentially undergoes S1 esterification, S2 ketalization, S3 selective ring opening, S4 TEMPO oxidation, S5 primary transaminase reaction, S6 acetylation, S7 secondary transaminase reaction, and S8 phosphorylation reaction to obtain the final product oseltamivir phosphate OS-09. The S7 secondary transaminase reaction uses the aforementioned transaminase mutant as an enzyme catalyst. The steps S1-S6 and S8 of this invention are the same as those in the applicant's prior application (application number 2025118047246), and step S7 adopts one of the solutions in Embodiments 4-7.

[0042] Example 9 Using recombinant Escherichia coli containing the transaminase mutant TA-5t prepared in Example 2 as a catalyst, 40 g / L OS-07 was catalyzed at a bacterial cell concentration of 20 g / L. The reaction conditions were as follows: 20 mL system, triethanolamine buffer (20 mM, pH 8.0) as the reaction medium, 0.8 g OS-07, 0.4 g of wet recombinant Escherichia coli cells, 1 mM / L pyridoxal phosphate, and isopropylamine at 2 times the substrate concentration as the amino donor, and the reaction was carried out at 35 °C for 24-28 h.

[0043] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Other variations and modifications are possible without departing from the technical solutions described in the claims.

[0044] SEQ ID NO:1 ATGGCGTCTATGGACAAAGTGTTCGCTGGTTACGCTGCTCGTCAGGCTATTCTGGAATCTACCGAAACCACCAATCCGTTCGCGAAAGGTATCGCTTGGGTTGAAGGTGAACTGGTTCCACTTGCAGAAGCTCGTATCCCACTGCTGGATCAGGGTTTCATGCACTCTGACCTGACCTACGACGTTCCGTCTGTTTGGGATGGTCGTTTCTTCCGTCTGGATGACCACATCACTCGTCTGGAAGCGAGCTGCACCAAACTTCGTCTGCGTCTGCCATTGCCACGTGATCAGGTGAAACAGATTCTGGTTGAAATGGTTGCGAAATCCGGTATCCGTGACGCATTCGTTGAACTGATCGTTACTCGTGGTCTGAAAGGTGTTCGTGGTACTCGTCCAGAGGACATCGTTAACAACCTGTATATGTTCGTTCAGCCATACGTTTGGGTTATGGAACCGGACATGCAGCGTGTTGGTGGTTCTGCTGTTGTTGCACGTACCGTTCGTCGTGTACCACCAGGTGCAATCGATCCAACCGTTAAGAACCTGCAATGGGGTGATCTTGTGCGTGGTATGTTCGAGGCTGCTGATCGTGGTGCAACCTATCCGTTTCTGACTGACGGTGATGCTCACCTGACCGAAGGTTCTGGTTTCAACATCGTTCTGGTTAAAGACGGTGTTCTGTACACTCCAGACCGTGGTGTTCTTCAGGGTGTTACCCGTAAATCCGTTATCAACGCTGCTGAAGCGTTCGGTATCGAAGTTCGTGTTGAGTTCGTTCCGGTTGAACTGGCTTACCGTTGCGACGAAATCTTCATGTGCACTACCGCTGGTGGTATCATGCCGATCACTACTCTGGACGGTATGCCGGTTAACGGTGGTCAGATCGGTCCGATCACCAAGAAAATCTGGGACGGTTACTGGGCTATGCACTACGACGCAGCGTACAGCTTCGAGATCGACTACAACGAACGTAACCACCACCATCACCACCACTAA; SEQ ID NO:2 MASMDKVFAGYAARQAILESTETTNPFAKGIAWVEGELVPLAEARIPLLDQGFMHSDLTYDVPSVWDGRFFRLDDHITRLEASCTKLRLRLPLPRDQVKQILVEMVAKSGIRDAFVELIVTRGLKGVRGTRPEDIVNNLYMFVQPYVWVMEPDMQRVGGSAVVARTVRRVPPGAIDPTVKNLQWGDLVRGMFEAADRGATYPFLTDGDAHLTEGSGFNIVLVKDGVLYTPDRGVLQGVTRKSVINAAEAFGIEVRVEFVPVELAYRCDEIFMCTTAGGIMPITTLDGMPVNGGQIGPITKKIWDGYWAMHYDAAYSFEIDYNERNHHHHHH; SEQ ID NO:3 MASMDKVFAGYAARQAALESTETTNPFAKGIAWVEGELVPLAEARIPLLDQGFMHSDLTYDVPSVWDGRFFRLDDHITRLEASCTKLRLRLPLPRDQVKQILVEMVAKSGIRDAFVELIVTRGLKGVRGTRPEDIVNNLYMFVQPYVWVMEPDMQRVGGSAVVARTVRRVPPGAIDPTVKNLQWGDLVRGMFEAADRGATYPFLTDGDAHLTEGSGFNIVLVKDGVLYTPDRGVLQGVTRKSVINAAEAFGIEVRVEFVPVELAYRCDEIFMCTTAGGIMPITTLDGMPVNGGQIGPITKKIWDGYWAMHYDAAYSFEIDYNERNHHHHHH; SEQ ID NO:4 MASMDKVFAGYAARQAILESTETTNPFAKGIAWVEGELVPLAEARIPLLDQGFMHGDLTYDVPSVWDGRFFRLDDHITRLEASCTKLRLRLPLPRDQVKQILVEMVAKSGIRDAFVELIVTRGLKGVRGTRPEDIVNNLYMFVQPYVWVMEPDMQRVGGSAVVARTVRRVPPGAIDPTVKNLQWGDLVRGMFEAADRGATYPFLTDGDAHLTEGSGFNIVLVKDGVLYTPDRGVLQGVTRKSVINAAEAFGIEVRVEFVPVELAYRCDEIFMCTTAGGIMPITTLDGMPVNGGQIGPITKKIWDGYWAMHYDAAYSFEIDYNERNHHHHHH; SEQ ID NO:5 MASMDKVFAGYAARQAILESTETTNPFAKGIAWVEGELVPLAEARIPLLDQGFMHSDLTYDVPSVWDGRFFRLDDHITRLEASCTKLRMRLPLPRDQVKQILVEMVAKSGIRDAFVELIVTRGLKGVRGTRPEDIVNNLYMFVQPYVWVMEPDMQRVGGSAVVARTVRRVPPGAIDPTVKNLQWGDLVRGMFEAADRGATYPFLTDGDAHLTEGSGFNIVLVKDGVLYTPDRGVLQGVTRKSVINAAEAFGIEVRVEFVPVELAYRCDEIFMCTTAGGIMPITTLDGMPVNGGQIGPITKKIWDGYWAMHYDAAYSFEIDYNERNHHHHHH; SEQ ID NO:6 MASMDKVFAGYAARQAALESTETTNPFAKGIAWVEGELVPLAEARIPLLDQGFMHGDLTYDVPSVWDGRFFRLDDHITRLEASCTKLRLRLPLPRDQVKQILVEMVAKSGIRDAFVELIVTRGLKGVRGTRPEDIVNNLYMFVQPYVWVMEPDMQRVGGSAVVARTVRRVPPGAIDPTVKNLQWGDLVRGMFEAADRGATYPFLTDGDAHLTEGSGFNIVLVKDGVLYTPDRGVLQGVTRKSVINAAEAFGIEVRVEFVPVELAYRCDEIFMCTTAGGIMPITTLDGMPVNGGQIGPITKKIWDGYWAMHYDAAYSFEIDYNERNHHHHHH; SEQ ID NO:7 MASMDKVFAGYAARQAALESTETTNPFAKGIAWVEGELVPLAEARIPLLDQGFMHSDLTYDVPSVWDGRFFRLDDHITRLEASCTKLRMRLPLPRDQVKQILVEMVAKSGIRDAFVELIVTRGLKGVRGTRPEDIVNNLYMFVQPYVWVMEPDMQRVGGSAVVARTVRRVPPGAIDPTVKNLQWGDLVRGMFEAADRGATYPFLTDGDAHLTEGSGFNIVLVKDGVLYTPDRGVLQGVTRKSVINAAEAFGIEVRVEFVPVELAYRCDEIFMCTTAGGIMPITTLDGMPVNGGQIGPITKKIWDGYWAMHYDAAYSFEIDYNERNHHHHHH; SEQ ID NO:8 MASMDKVFAGYAARQAALESTETTNPFAKGIAWVEGELVPLAEARIPLLDQGFMHSDLTYDVPSVWDGRFFRLDDHITRLEASCTKLRMRLPLPRDQVKQILVEMVAKSGIRDAFVELIVTRGLKGVRGTRPEDIVNNLYMFVQPYVWVMEPDMQRVGGSAVVARTVRRVPPGAIDPTVKNLQWGDLVRGMFEAADRGATYPFLTDGDAHLTEGSGFNIVLVKDGVLYTPDRGVLQGVTRKSVINAAEAFGIEVRVEFVPVELAYRCDEIFMCTTAGGIMPITTLDGMPVNGGQIGPITKKIWDGYWAMHYDAAYSFEIDYNERNHHHHHH; SEQ ID NO:9 MASMDKVFAGYAARQAALESTETTNPFAKGIAWVEGELVPLAEARIPLLDQGFMHSDLTYDVPSVWDGRFFRLDDHITRLEASCTKLRMRLPLPRDQVKQILVEMVAKSGIRDAFVELIVTRGLKGVRGTRPEDIVNNLYMFVQPYLWVMEPDMQRVGGSAVVARTVRRVPPGAIDPTVKNLQWGDLVRGMFEAADRGATYPFLTDGDAHLTEGSGFNIVLVKDGVLYTPDRGVLQGVTRKSVINAAEAFGIEVRVEFVPVELAYRCDEIFMCTTAGGIMPITTLDGMPVNGGQIGPITKKIWDGYWAMHYDAAYSFEIDYNERNHHHHHH; SEQ ID NO:10 MASMDKVFAGYAARQAALESTETTNPFAKGIAWVEGELVPLAEARIPLLDQGFMHSDLTYDVPSVWDGRFFRLDDHITRLESCTKLRMRLPLPRDQVKQILVEMVAKSGIRDAFVELIVTRGLKGVRGTRPEDIVNNLYMFVQPYLWVMEPDMQRVGGSAVVARTVRRVPPGAIDPTVKNFQWGDLVRGMFEAADRGATYPFLTDGDAHLTEGSGFNIVLVKDGVLYTPDRGVLQGVTRKSVINAAEAFGIEVRVEFVPVELAYRCDEIFMCTTAGGIMPITTLDGMPVNGGQIGPITKIWDGYWAMHYDAAYSFEIDYNERNHHHHHH; SEQ ID NO:11 MASMDKVFAGYAARQAALESTETTNPFAKGIAWVEGELVPLAEARIPLLDQGFMHSDLTYDVPSVWDGRFFRLDDHITRLESCTKLRMRLPLPRDQVKQILVEMVAKSGIRDAFVELIVTRGLKGVRGTRPEDIVNNLYMFVQPYLWVMEPDMQRVGGSAVVARTVRRVPPGAIDPTVKNFQWGDLVRGMFEAADRGATYPFLTDGDAHLTEGSGFNIVLVKDGVLYTPDRGVLQGVTRKSVIEAAEAFGIEVRVEFVPVELAYRCDEIFMCTTAGGIMPITTLDGMPVNGGQIGPITKIWDGYWAMHYDAAYSFEIDYNERNHHHHHHH.

Claims

1. A transaminase mutant, characterized in that, The transaminase mutant is generated by mutating one or more sites using the amino acid sequence shown in SEQ ID NO.2 as the parent. The transaminase mutant is selected from one of the following: Mutant TA-I17A: The 17th I in the parental chromosome is mutated to A; Mutant TA-S56G: The parental S is mutated to G at position 56; Mutant TA-L89M: The 89th L position of the parental chromosome is mutated to M; Mutant TA-I17A-S56G: The parental I at position 17 is mutated to A and the S at position 56 is mutated to G; Mutant TA-S56G-L89M: The parental S at position 56 is mutated to G and the L at position 89 is mutated to M; Mutant TA-I17A-L89M: The parental I at position 17 is mutated to A and the L at position 89 is mutated to M; The mutant TA-I17A-L89M-V147L has the following mutations: the parental I at position 17 is mutated to A, the L at position 89 is mutated to M, and the V at position 147 is mutated to L. Mutant TA-I17A-L89M-V147L-L182F: The parental I at position 17 is mutated to A, L at position 89 is mutated to M, V at position 147 is mutated to L, and L at position 182 is mutated to F; The mutant TA-I17A-L89M-V147L-L182F-N245E has the following mutations: the parental I at position 17 is mutated to A, the L at position 89 is mutated to M, the V at position 147 is mutated to L, the L at position 182 is mutated to F, and the N at position 245 is mutated to E.

2. The transaminase mutant according to claim 1, characterized in that, The transaminase with the amino acid sequence shown in SEQ ID NO.2 is derived from Aspergillus terreus.

3. A polynucleotide sequence, characterized in that, It encodes the transaminase mutant as described in claim 1.

4. A recombinant vector, characterized in that, It contains the polynucleotide sequence as described in claim 3.

5. A host cell, characterized in that, It comprises the recombinant vector as described in claim 4.

6. The use of the transaminase mutant as described in claim 1 as an enzyme catalyst in the preparation of oseltamivir phosphate.

7. A chemical-enzymatic coupling synthesis method for oseltamivir phosphate, characterized in that, Using shikimic acid OS-01 as a substrate, the final product oseltamivir phosphate OS-09 was obtained by sequentially undergoing S1 esterification, S2 ketalization, S3 selective ring opening, S4 TEMPO oxidation, S5 primary transaminase reaction, S6 acetylation, S7 secondary transaminase reaction, and S8 phosphorylation reaction. The S7 secondary transaminase reaction uses the transaminase mutant described in claim 1 as an enzyme catalyst. 。 8. The chemical-enzymatic coupling synthesis method according to claim 7, characterized in that, The transaminase mutant was added in the form of pure enzyme, immobilized enzyme, crude enzyme solution, or wet cells of recombinant genetically engineered bacteria.

9. The chemical-enzymatic coupling synthesis method according to claim 7, characterized in that, The reaction system for the S7 secondary transaminase reaction consists of the following components: The concentration of substrate OS-07 is 40-150 g / L, the wet bacterial cells of recombinant genetically engineered bacteria expressing the transaminase mutant of claim 1 are 20-100 g / L, pyridoxal phosphate is 0.5-2.0 mM / L, isopropylamine is used, the amount of isopropylamine is 1-2 times the molar amount of substrate OS-07, and the reaction medium is triethanolamine buffer at pH 8-9.

10. The chemical-enzymatic coupling synthesis method according to claim 7, characterized in that, The reaction temperature for the S7 secondary transaminase reaction is 5-40℃, and the reaction time is 2-24 hours.