KASP marker combination related to growth of black sea bream and application of KASP marker combination

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to a KASP marker combination related to growth of black sea bream and application of the KASP marker combination. The KASP marker combination related to the growth of the black sea bream, disclosed by the invention, comprises KASP739 (A / G) positioned in a chromosome 11 and KASP246 (A / G) positioned in a chromosome 18. By detecting the genotypes of the black sea bream individuals at the two sites and screening the individuals with the genotypes being GG-GA combinations, the individuals with higher growth speed can be effectively predicted and screened out. The KASP marker combination can achieve high-throughput genotyping without electrophoresis, genotype selection of the KASP marker combination has a synergistic effect, the breeding efficiency is remarkably improved, the breeding period is shortened, and the breeding cost is reduced.

Description

Technical Field

[0001] This invention belongs to the field of fish molecular breeding technology, specifically relating to a KASP marker combination related to the growth of black sea bream and its application. Background Technology

[0002] Black sea bream ( Acanthopagrus schlegelii Black sea bream is a valuable economic fish, and its aquaculture industry has already reached a considerable scale. However, this fish species suffers from a genetic weakness due to its slow growth rate, resulting in long farming cycles, high costs, and significant risks, severely hindering the further development of the industry. Genetic improvement of black sea bream is key to fundamentally overcoming its growth bottleneck.

[0003] The growth traits of black sea bream are typical quantitative traits, characterized by polygenic control and susceptibility to environmental factors. This characteristic makes traditional breeding methods relying on phenotypic selection not only slow but also inefficient. With the development of molecular biology techniques, marker-assisted selection (MAS) has become an important direction in breeding. This technology identifies molecular markers closely linked to target traits (such as growth rate), enabling precise selection at the gene level early in individual development. This overcomes the blindness of traditional breeding, significantly shortens the breeding cycle, and improves selection efficiency.

[0004] Kompetitive allele-specific PCR (KASP) is a highly efficient SNP genotyping technique, particularly suitable for MAS breeding due to its high accuracy, stability, and low cost. Currently, there is a lack of validated KASP markers strongly correlated with growth traits in black sea bream breeding. Therefore, developing KASP markers specifically for auxiliary selection of growth traits in black sea bream has become an urgent need to advance breeding techniques for this species. Summary of the Invention

[0005] To address the lack of molecular markers related to the growth of black sea bream in existing technologies that enable rapid breeding, this invention provides a KASP marker combination related to the growth of black sea bream and its application, specifically including the following technical solutions: This invention provides a KASP marker combination related to the growth of black sea bream, the KASP marker combination including KASP739 and / or KASP246; The KASP739 is located at 15024018 bp on chromosome 11 and is an A / G polymorphic site. The sequence containing the KASP739 is shown in SEQ ID NO:1. The KASP246 is located at 19429004 bp on chromosome 18 and is an A / G polymorphic site. The sequence containing the KASP246 is shown in SEQ ID NO:2.

[0006] The present invention also provides a primer combination for detecting the KASP marker combination as described above, the primer combination comprising a primer combination for amplifying KASP739 and / or a primer combination for amplifying KASP246; the primer combination for KASP739 comprises forward primer 1, forward primer 2 and reverse primer 1; the sequence of forward primer 1 is shown in SEQ ID NO:3; the sequence of forward primer 2 is shown in SEQ ID NO:4; the sequence of reverse primer 1 is shown in SEQ ID NO:5; the 5' ends of forward primer 1 and forward primer 2 are marked with different fluorescent labels; the primer combination for KASP246 comprises a first forward primer, a second forward primer and a first reverse primer; the sequence of the first forward primer is shown in SEQ ID NO:6; the sequence of the second forward primer is shown in SEQ ID NO:7; the sequence of the first reverse primer is shown in SEQ ID NO:8; the 5' ends of the first forward primer and the second forward primer are marked with different fluorescent labels.

[0007] The present invention also provides a kit for detecting the growth performance of black sea bream, the kit comprising the primer combination described above.

[0008] Preferably, the kit also includes other reagents necessary for PCR amplification.

[0009] The present invention also provides applications of the primer combinations or kits described above, the applications including any one or more of the following aspects: 1) Detect the genotype of the KASP marker combination associated with black sea bream growth as described in claim 1; 2) Detect or predict the growth traits of black sea bream; 3) Breeding or assisted breeding of black sea bream.

[0010] Preferably, the growth traits of the black sea bream include the weight and / or body length of the black sea bream.

[0011] This invention also provides a method for screening fast-growing black sea bream varieties, comprising the following steps: Genotypes of the KASP marker combinations described above were detected in black sea bream, and individuals with the KASP739 genotype of GG and / or the KASP246 genotype of GA were retained.

[0012] Preferably, the detection method includes PCR amplification of black sea bream genomic DNA using the KASP primer combination described in claim 2, genotyping the PCR amplification products using KASP genotyping technology, and determining the genotype of the black sea bream based on the fluorescence color of the genotyping results; for KASP739, if the genotyping result shows a fluorescence signal of FAM, the genotype is AA; if the fluorescence signal is HEX, the genotype is GG; if both signals are present, the genotype is GA; for KASP246, if the genotyping result shows a fluorescence signal of FAM, the genotype is GG; if the fluorescence signal is HEX, the genotype is AA; if both signals are present, the genotype is GA.

[0013] Preferably, the PCR amplification system includes 2.5 μL of KASP master mix, 2.3 μL of template DNA, and 0.2 μL of mixed primers; the mixed primers include two forward primers and one reverse primer in a volume ratio of 1:1:3, and the concentration of each of the two forward primers and the one reverse primer is 10 μM.

[0014] Preferably, the PCR amplification program includes 10 cycles of 95℃ for 15 min; 95℃ for 20 s; 61℃~55℃ for 60 s, -0.6℃ / cycle; 95℃ for 20 s, 55℃ for 60 s, 35 cycles; and 25℃ for 30 s.

[0015] The beneficial effects of this invention are as follows: This invention provides a KASP marker combination related to the growth of black sea bream, comprising KASP739 and / or KASP246. KASP739 is located at 15024018 bp on chromosome 11 and exhibits an A / G polymorphism; the sequence containing KASP739 is shown in SEQ ID NO:1. KASP246 is located at 19429004 bp on chromosome 18 and also exhibits an A / G polymorphism; the sequence containing KASP246 is shown in SEQ ID NO:2. This KASP marker combination allows for the detection of specific SNP sites within a population, achieving high-throughput genotyping using only a quantitative real-time PCR instrument, without electrophoresis. The application of KASP is most effective when the sample size is large and the number of SNP sites is small. The genotyping of the two marker sites mentioned in this invention has a synergistic effect, with the GG-GA genotype combination showing better selection results. After one generation of selection, the selected population can exhibit a growth advantage of more than 8% compared to the unselected population, significantly improving breeding efficiency. This invention also allows for the collection of a small number of fin samples for DNA extraction and testing during the early growth stage of black sea bream, eliminating the need to wait several months to two years after cultivation before selecting based on phenotype. This significantly shortens the breeding period and reduces breeding costs. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0017] Figure 1 Genetic linkage map of black sea bream; The scale on the left represents genetic distance, the black bars represent SNP markers, and the different colors on each linkage group represent different marker densities. Figure 2 QTL mapping and GWAS analysis results for growth traits of black sea bream; In each subplot, the upper half represents the LOD value obtained from QTL analysis, and the thin black dashed line and thick black dashed line represent the significance thresholds at the chromosome and genome levels, respectively; the lower half represents the -Log(p) value obtained from GWAS analysis. Figure 3 Venn plots are used to mark SNPs within the QTL location interval; Among them, T1 represents 8 months of age, T2 represents 20 months of age, and DT represents 8 to 20 months of age; Figure 4 The classification result for KASP739; Among them, the blue square represents the GG genotype, the yellow circle represents the AA genotype, the green triangle represents the GA genotype, and the black diamond represents the negative control; Figure 5 The classification results for KASP246; Among them, the blue square represents the AA genotype, the yellow circle represents the GG genotype, the green triangle represents the GA genotype, and the black diamond represents the negative control. Detailed Implementation

[0018] This invention provides a KASP marker combination related to the growth of black sea bream, the KASP marker combination including KASP739 and KASP246; The KASP739 is located at 15024018 bp on chromosome 11 and is an A / G polymorphic site. The sequence containing the KASP739 is shown in SEQ ID NO:1. The KASP246 is located at 19429004 bp on chromosome 18 and is an A / G polymorphic site. The sequence containing the KASP246 is shown in SEQ ID NO:2.

[0019] The present invention also provides a primer combination for detecting the KASP marker combination of claim 1, wherein the primer combination includes a primer combination for amplifying KASP739 and / or a primer combination for amplifying KASP246; The primer combination for KASP739 includes forward primer 1, forward primer 2, and reverse primer 1; the sequence of forward primer 1 is shown in SEQ ID NO:3; the sequence of forward primer 2 is shown in SEQ ID NO:4; the sequence of reverse primer 1 is shown in SEQ ID NO:5; the 5' ends of forward primer 1 and forward primer 2 are marked with different fluorescent labels; The primer combination of KASP246 includes a first forward primer, a second forward primer, and a first reverse primer; the sequence of the first forward primer is shown in SEQ ID NO:6; the sequence of the second forward primer is shown in SEQ ID NO:7; the sequence of the first reverse primer is shown in SEQ ID NO:8; the 5' ends of the first and second forward primers have different fluorescent labels.

[0020] In one embodiment, the fluorescent label at the 5' end of the forward primer 1 and / or the first forward primer includes a FAM fluorescent label. In another embodiment, the fluorescent label at the 5' end of the forward primer 2 and / or the second forward primer includes a VIC fluorescent label. In yet another embodiment, the fluorescent labels at the 5' ends of the forward primer 1, forward primer 2, the first forward primer, and the second forward primer can also be replaced with other different fluorescent labels commonly used in the art.

[0021] The present invention also provides a kit for detecting the growth performance of black sea bream, the kit comprising the primer combination described above.

[0022] In one embodiment, the kit also includes other reagents necessary for PCR amplification. In one embodiment, the reagents necessary for PCR amplification include KASP master mix and template DNA.

[0023] The present invention also provides applications of the primer combinations or kits described above, the applications including any one or more of the following aspects: 1) Detect the genotype of the KASP marker combination related to black sea bream growth as described above; 2) Detect or predict the growth traits of black sea bream; 3) Breeding or assisted breeding of black sea bream.

[0024] In one embodiment, the genotypes of the KASP marker combination related to black sea bream growth include the genotypes of KASP739 and KASP246. In one embodiment, the genotypes of KASP739 include GG, GA, and AA. In one embodiment, the genotypes of KASP246 include GG, GA, and AA. In one embodiment, the dominant genotype of KASP739 is GG, and the non-dominant genotypes are GA or AA. In one embodiment, the dominant genotype of KASP246 is GA, and the non-dominant genotypes are GG or AA.

[0025] In one implementation, the detection or prediction of black sea bream growth traits includes black sea bream weight and / or black sea bream body length.

[0026] In one implementation, the black sea bream breeding or assisted breeding includes breeding for black sea bream with a fast growth rate. In another implementation, the trait includes black sea bream weight and / or black sea bream body length.

[0027] This invention also provides a method for screening fast-growing black sea bream varieties, comprising the following steps: Genotypes of the KASP marker combinations described above were detected in black sea bream, and individuals with the KASP739 genotype of GG and the KASP246 genotype of GA were retained.

[0028] In one implementation method, the detection method includes PCR amplification of black sea bream genomic DNA using the aforementioned KASP primer combination, genotyping the PCR amplification products using KASP genotyping technology, and determining the genotype of the black sea bream based on the fluorescence color of the genotyping results. In one implementation method, for KASP739, if the genotyping result shows a fluorescence signal of FAM, the genotype is AA; if the fluorescence signal is HEX, the genotype is GG; if both signals are present, the genotype is GA. For KASP246, if the genotyping result shows a fluorescence signal of FAM, the genotype is GG; if the fluorescence signal is HEX, the genotype is AA; if both signals are present, the genotype is GA.

[0029] In one embodiment, the PCR amplification system includes 2.5 μL of KASP master mix, 2.3 μL of template DNA, and 0.2 μL of mixed primers; the mixed primers include two forward primers and one reverse primer in a volume ratio of 1:1:3, and the concentration of each of the two forward primers and the one reverse primer is 10 μM.

[0030] As one implementation method, the PCR amplification program includes 10 cycles of 95℃ for 15 min; 95℃ for 20 s; 61℃~55℃ for 60 s, -0.6℃ / cycle; 95℃ for 20 s, 55℃ for 60 s, 35 cycles; 25℃ for 30 s.

[0031] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, provides a KASP marker combination related to the growth of black sea bream and its application, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0032] Prior to this invention, the applicant constructed a high-density genetic linkage map of black seabream using 2b-RAD technology based on the F1 family population. The map contained 4212 markers with a total map distance of 1771.92 cM, and QTL mapping studies for growth-related traits in black seabream were conducted using this map. The results are detailed in "Jia, C., et al. (2025). Construction of the first high-density genetic linkage map and QTL mapping for growth traits in black seabream (…)". Acanthopagrus schlegelii (Aquaculture, 595, 741588. https: / / doi.org / 10.1016 / j.aquaculture.2025.741588). Subsequently, the applicant screened two growth-related SNP markers at two QTL loci, qTL2-1 and qTL1-3, and converted them into competitive allele-specific PCR (KASP) markers for use in marker-assisted selection breeding of black sea bream. KASP is a single SNP genotyping technique with high stability, accuracy, and low cost. It is widely used in high-throughput SNP genotyping and has become a global benchmark technique, widely used for genotyping SNP markers related to economic traits in aquatic animals.

[0033] Example 1: Screening process for KASP markers related to black sea bream growth Based on the high-density genetic linkage map of black sea bream constructed in "Jia et al., 2025" as described above, this invention performed QTL mapping analysis and screened two SNP molecular markers closely related to the growth of black sea bream. The specific experimental procedure is as follows: The parent stock used to construct the mapping population was wild black sea bream from Fujian and Shandong provinces collected by the Lvsi Base of the Jiangsu Provincial Marine Fisheries Research Institute. All parent stock were 3 years old. Parent stock from both populations with good gonadal development and relatively large individual differences were selected, and ten full-sib families (6 Fujian females × Shandong males and 4 Shandong females × Fujian males) were constructed using a one-to-one female-male hybridization method. The ten families were cultured in indoor cement ponds at the same density and under the same environmental conditions until 2 months of age. Then, 2000 individuals from each family were randomly selected and transferred to 10 three-m × six-m net cages in the same outdoor pond for further culture until 3 months of age. Finally, 1000 individuals were randomly selected and transferred to four-m × eight-m net cages for independent culture until 8 months of age. Subsequently, 60 individuals from each family were randomly selected to measure their body weight and calculate the coefficient of variation. The group with the highest coefficient of variation (Fujian females × Shandong males) was selected as the mapping population.

[0034] Caudal fins were harvested from individuals in the family and from parents, and genomic DNA was extracted using the TIANampmarine animals DNA kit. DNA quality was assessed using 1% agarose gel electrophoresis, and its concentration and purity were checked using a NanoDrop 2000 spectrophotometer. After passing quality control, sequencing libraries were constructed using 2b-RAD five-tag tandem technology. All samples were ligated with standard 5'-NNN-3' adapters and restriction enzyme tags. After library quality control, paired-end sequencing was performed on the Illumina Hiseq Xten platform.

[0035] The library construction process is as follows: First, ≥200 ng of genomic DNA is digested with type IIB restriction endonuclease (BsaXI). The digestion products are then added to 5 different adapters and ligated with T4 DNA Ligase. The ligation products are amplified by PCR. Then, according to the 5 adapter information, the 5 tags are tandemly linked in sequence. The ligation products are then barcode sequences added and mixed into a library. Finally, the high-quality libraries that pass quality control are sequenced.

[0036] To ensure the accuracy of the data analysis results, the original sequencing sequences need to be filtered. Reads containing adapter sequences are removed to obtain clean reads. Reads containing more than 8% N bases and low-quality reads (more than 15% of bases with a quality value below Q30) are also filtered out. The clean reads are then assembled in pairs using Pear (Version 0.9.6) software. Based on the location of each sample during library construction, the corresponding reads for each sample are extracted. Reads without restriction enzyme recognition sites are then filtered out to obtain high-quality sequencing reads for each sample, i.e., enzyme reads.

[0037] The enzyme reads of each sample were aligned to the black sea bream reference genome (reference version: ASM4175387v1) using SOAP (Version 2.21) software. The main parameters were -r 0, -M 4, and -v 2 (-r 0 indicates a unique alignment; -M 4 indicates the best alignment; -v 2 indicates that the alignment allows two mismatches). Unique tags were obtained by clustering identical reads. After removing unique tags with a sequencing depth of less than 3, the average number of unique tags, average sequencing depth, and unique tag alignment rate of all samples were obtained.

[0038] After aligning Enzyme reads to reference sequences, SNP genotyping was performed using the maximum likelihood (ML) method with RADtyping (Version 1.3) software. To ensure the accuracy of subsequent analyses, the genotyping results were further filtered using the following criteria: loci that could be genotyped in less than 80% of individuals across all samples, loci with MAF < 0.01, loci containing only one allele, loci containing four alleles, loci containing only one genotype, and loci with more than one SNP within the tag were removed.

[0039] To further improve the accuracy of genotyping, SNPs generated during the analysis process were screened: 1) the male and female offspring parents were determined according to the results of paternity testing; 2) the minimum allele frequency was 0.05; and 3) the maximum deletion rate was 0.2%. Based on the parental genotyping results, polymorphic markers between parents were developed. Parental polymorphic loci matching the mapping marker type for this population were screened, and loci lacking parental information were filtered out. Markers of types hk×hk, lm×ll, and nn×np were selected, i.e., polymorphic loci where one parent is heterozygous and the other is homozygous, or both parents are heterozygous, were used for F1 population mapping.

[0040] After developing markers among parents, genotyping was performed on progeny individuals at loci matching parental polymorphism in the population. Joinmap 5 software was used to calculate the number of individuals with abnormal bases at each locus, retaining only loci with zero abnormal bases. The number of progeny individuals with missing genotypes was calculated, and loci with a deletion rate of 10% or higher were removed. Partial segregation chi-square values ​​were calculated, and partial segregation markers were removed, retaining only those that were not found. P Sites with a similarity of <0.01 were removed; markers with a similarity of ≥1 were discarded.

[0041] Using Joinmap 5 software, linkage maps were constructed for eligible markers (with the mapping population being CP). Male maps were constructed by selecting heterozygous paternal, homozygous maternal, or heterozygous loci (nn×np and hk×hk); female maps were constructed by selecting heterozygous maternal, homozygous paternal, or heterozygous loci (lm×ll and hk×hk type markers). After obtaining the male and female maps, MergeMap software was used to merge the two maps to obtain a genetic linkage map. After marker filtering, linkage groups were divided, with a LOD value set to 8. Each linkage group was ranked using a regression algorithm, and the Kosambi function was used to convert recombination rate into genetic distance.

[0042] The plotting results are as follows Figure 1 As shown. By Figure 1 It can be seen that the number of markers on the 24 linkage groups of the black sea bream genetic linkage map ranges from 70 to 346, with a total of 4212 markers; the genetic distance between each linkage group ranges from 22.52 to 161.47 cM, and the total genetic distance of the map is 1771.92 cM; the average interval between markers on each linkage group ranges from 0.19 to 1.12 cM, and the average interval of the map is 0.42 cM.

[0043] The growth traits of 158 eight-month-old black sea bream (T1) were measured and PIT-tagged. After overwintering indoors, the tagged fish were placed in 4 m × 8 m net cages for continued culture in March of the following year. The growth traits of 20-month-old (T2) fish were measured at the end of December of the same year. The growth trait parameters from 8 to 20 months of age (DT) were the difference between the data measured for 20-month-old and 8-month-old fish.

[0044] Growth traits were determined according to the provisions of the People's Republic of China National Standard (GB / T 18654.3.2008) "Genomic Testing of Cultured Fish - Part 3: Trait Determination". After anesthetizing with MS-222, the body weight (BW), total length (TL), body length (BL), body height (BH), and body width (BD) of the experimental fish were measured. The body weights of the black sea bream at 8 months, 20 months, and 8–20 months of age were represented by BW1, BW2, and DBW, respectively. Other phenotypic representations followed the same method. Body weight was accurate to 0.01 g, total length, body length, and body height were accurate to 0.01 cm, and body width was accurate to 0.01 mm.

[0045] The Shapiro-Wilk test was used to determine whether the phenotypic data conformed to a normal distribution. For data that did not conform to a normal distribution, a Box-Cox transformation was performed before phenotypic correlation and QTL localization analysis.

[0046] Based on the mapped family phenotypic data and combined with the high-density linkage map, QTL analysis was performed on the traits using MapQTL (version: 6.0) software. First, a permutation test was performed with 1000 replicates to estimate the LOD threshold at the α=0.05 level within a single linkage group and the genome-wide (GW) region. Second, interval mapping (IM) was used for QTL analysis, scanning the probability of QTL presence every 1 cM on each linkage group. Finally, the LOD value at the α=0.05 level within a single linkage group (CW) was used as the threshold; a QTL was considered to exist at a locus when the LOD peak was greater than or equal to the threshold, and the location of the LOD peak was the most probable location of the corresponding QTL gene. The highest probability peak represents the phenotypic variance explained. Simultaneously, GWAS association analysis of individual SNP loci with six traits was performed using Plink (Version: 1.07) software. This analysis performed simple linear regression on the genotypes, with... P <0.01 and P <0.05 was used as the significance threshold for difference. The number of sites with significant differences before and after Bonferroni correction was counted, and sites related to traits were screened.

[0047] QTL localization and GWAS results are as follows: Figure 2 As shown. The Venn diagram results of SNP markers within the QTL location interval are as follows. Figure 3 As shown. Based on the above results, this embodiment screened out two SNP molecular marker sites, namely KASP739 and KASP246. The genomic version is ASM4175387v1. KASP739 is located at 15024018 bp on chromosome 11, with an A / G variant, and KASP246 is located at 19429004 bp on chromosome 18, with an A / G variant.

[0048] KASP primers were designed using 150 bp upstream and downstream sequences of KASP739 and KASP246. The two mutation sites and the upstream and downstream sequences are shown below (in the KASP739 and KASP246 sequences, the bolded mutation sites are the target sites, and in the KASP739 sequence, the underlined mutation sites are other mutation sites): KASP739: SEQ ID NO:1: 5'-CATATTTATTCATGATTCCTGAGCAGGGAGGGGCCGACTGTTAATGCTGGTTGACAGGGCCGACATATTTCTCTGTCTGGGAAGATTCTTCACGCCTTTGTTTGGTTATACAACTCTTACTGTGGCTCTGCACATGAGCAC CAGGGCTGT[A / G]GAAGACAGCCAGTGTCTTTATGAAATGAGGTAAAAAATGCCACTGAGACCATGTCAGGGGACATGTGACATATTTATGTACAGGTAAAGAGCAGGAGTAGGGCTTCGGCTTCTAGACAGGCCTTGTGAATATTCTT [T / G] GTAATTATGACTT-3'; KASP246: SEQ ID NO: 2: 5'-TCTCCACTCTCTCTCCGTCAGCTCCGCAACACCATCAGCTTGTCCAGCCCCCCCGTCCCTCTCACAGAGACGCCTCAAACGAAAGCAGAGGTCTAAAGGCAAGACTGACCCAGTGGAAATCATCACACTCACGTGACAAATGCTCCACGG [A / G]CTGTGTGAAAAACTGAGGCATTGCAAGAAATGTATTCTGAACTGGTTTTTATAAAATCTGTGTTATTATGAGACTGTCATCACTGTGAATGAGATGAAAGCAGCAGTGTGATCTAACACCCACCTCATTCAGTGCCTGTTCTCAGTTGAGT-3'.

[0049] Three primers were designed for each of the two SNP sites: two forward-specific primers with different fluorescent labels and one reverse universal primer. The primer sequences are shown in Table 1. Table 1 Primer sequences for SNP sites

[0050] Note: The primers for KASP246 were designed based on the reverse complementary sequence of the sequence shown in SEQ ID NO:2, with the primer orientation being 5'-3' of the reverse complementary sequence of the sequence shown in SEQ ID NO:2.

[0051] The forward primers F1 and F2 each have their own fluorescent adapters (FAM and VIC, which produce different colors of fluorescence in the amplification products and are displayed as different colors on the genotyping map). If the material being tested has a homozygous genotype, only one corresponding primer will be selected for amplification. The genotype of the tested material can be distinguished by the fluorescence difference. If the material being tested has a heterozygous genotype, both primers will amplify, producing a third fluorescent signal, thus enabling the differentiation of heterozygous genotypes.

[0052] 188 individuals were randomly selected from a 20-month-old black sea bream population raised under the same environmental conditions. Caudal fin rays were collected, and body weight (BW) and body length (BL) were measured. Genomic DNA was extracted from the black sea bream samples using the TIANampmarine animals DNA kit, following the instructions. DNA quality was assessed using 1% agarose gel electrophoresis, and its concentration and purity were checked using a NanoDrop 2000 spectrophotometer. After passing the tests, the DNA concentration was diluted to 50 ng / μL.

[0053] KASP genotyping was used to genotype the KASP739 and KASP246 loci in the population, and the results are shown in Table 2. Figures 4-5 As shown.

[0054] The detection primers were mixed in a ratio of forward primer F1:forward primer F2:reverse primer R = 1:1:3 (all primer concentrations were 10 μM), and a 5 μL PCR reaction system was constructed with the DNA template and KASP master mix (KASP master mix: 2.5 μL, template DNA: 2.3 μL; mixed primers: 0.2 μL).

[0055] The Touchdown PCR program is as follows: 95℃ for 15 min, (95℃ for 20 s, 61~55℃ for 60 s) for 10 cycles (-0.6℃ / cycle), (95℃ for 20 s, 55℃ for 60 s) for 35 cycles, 25℃ for 30 s.

[0056] Fluorescence signals were collected for genotyping. The detection instrument was a CFX Connect quantitative PCR instrument (Bio-Rad).

[0057] Table 2 Correlation analysis between SNP markers and growth traits of black sea bream

[0058] Note: In Table 2, different lowercase letters indicate significant differences. P <0.05); As shown in Table 2, the KASP739 genotype was significantly correlated with the body weight and body length traits of the black sea bream population. P <0.05), the KASP246 locus genotype showed a significant correlation with the body weight trait of black sea bream populations. P <0.05). The dominant genotype for KASP739 was GG, and the dominant genotype for KASP246 was GA. The average body weights of individuals with the dominant genotypes at the two loci were 465.46±57.21 g and 450.02±65.78 g, respectively, which were 6.05% and 2.54% higher than the average body weight of all individuals (438.91±61.93 g).

[0059] Table 3. Correlation between different genotype combinations of KASP739 and KASP246 markers and growth traits of black sea bream.

[0060] As shown in Table 3, this invention analyzed the correlation between different genotype combinations of the two markers KASP739 and KASP246 and the growth traits of black sea bream. The results showed that the individuals with the dominant genotype combination of the two markers (GG-GA) had the highest mean weight and body length, at 478.42±60.03 g and 254.31±9.85 g, respectively, which were 9.00% and 2.35% higher than the overall mean of 438.91±61.93 g, and also higher than the mean of individuals with either marker's dominant genotype alone. Individuals with the GA-GG genotype had the lowest mean weight and body length, which were 8.32% and 2.03% lower than the overall mean, respectively.

[0061] In summary, this invention provides a KASP marker combination related to the growth of black sea bream. The KASP marker combination of this invention can achieve high-throughput genotyping without electrophoresis, and the genotype selection of the KASP marker combination has a synergistic effect, which significantly improves breeding efficiency, shortens the breeding cycle, and reduces breeding costs.

[0062] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments without creative effort, as shown in these embodiments, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A KASP marker ensemble associated with black sea bream growth, characterized in that, The KASP tag combination includes KASP739 and / or KASP246; The KASP739 is located at 15024018 bp on chromosome 11 and is an A / G polymorphic site. The sequence containing the KASP739 is shown in SEQ ID NO:

1. The KASP246 is located at 19429004 bp on chromosome 18 and is an A / G polymorphic site. The sequence containing the KASP246 is shown in SEQ ID NO:

2.

2. A primer combination for detecting the KASP marker combination of claim 1, characterized in that, The primer combinations include primer combinations for amplifying KASP739 and / or primer combinations for amplifying KASP246; The primer combination for KASP739 includes forward primer 1, forward primer 2, and reverse primer 1; The sequence of the forward primer 1 is shown in SEQ ID NO:3; The sequence of the forward primer 2 is shown in SEQ ID NO:4; The sequence of the reverse primer 1 is shown in SEQ ID NO:5; The 5' ends of forward primer 1 and forward primer 2 are marked with different fluorescent labels; The primer combination for KASP246 includes a first forward primer, a second forward primer, and a first reverse primer; The sequence of the first forward primer is shown in SEQ ID NO:6; The sequence of the second forward primer is shown in SEQ ID NO:7; The sequence of the first reverse primer is shown in SEQ ID NO:8; The first and second forward primers have different fluorescent labels at their 5' ends.

3. A reagent kit for detecting the growth performance of black sea bream, characterized in that, The kit includes the primer combination as described in claim 2.

4. The kit according to claim 3, characterized in that, The kit also includes other reagents necessary for PCR amplification.

5. The application of the primer combination of claim 2 or the kit of claim 3 or 4, characterized in that, The application includes any one or more of the following aspects: 1) Detect the genotype of the KASP marker combination associated with black sea bream growth as described in claim 1; 2) Detect or predict the growth traits of black sea bream; 3) Breeding or assisted breeding of black sea bream.

6. The application as described in claim 5, characterized in that, The growth traits of the black sea bream include the weight and / or body length of the black sea bream.

7. A method for screening fast-growing black sea bream varieties, characterized in that, Includes the following steps: Genotypes of the KASP marker combination as described in claim 1 were detected in black sea bream, and individuals with the KASP739 genotype of GG and / or the KASP246 genotype of GA were retained.

8. The screening method as described in claim 7, characterized in that, The detection method includes PCR amplification of black sea bream genomic DNA using the KASP primer combination described in claim 2, genotyping the PCR amplification products using KASP genotyping technology, and determining the genotype of the black sea bream based on the fluorescence color of the genotyping results. If the KASP739 genotyping results show a fluorescence signal of FAM, the genotype is AA; if the fluorescence signal is HEX, the genotype is GG; if both signals are present, the genotype is GA. If the KASP246 genotyping results show a fluorescence signal of FAM, the genotype is GG; if the fluorescence signal is HEX, the genotype is AA; if both signals are present, the genotype is GA.

9. The screening method as described in claim 7, characterized in that, The PCR amplification system included 2.5 μL of KASP mastermix, 2.3 μL of template DNA, and 0.2 μL of mixed primers; The mixed primers consist of two forward primers and one reverse primer in a volume ratio of 1:1:3, and the concentration of each of the two forward primers and the one reverse primer is 10 μM.

10. The screening method as described in claim 7, characterized in that, The PCR amplification program includes 10 cycles of 95℃ for 15 min; 95℃ for 20 s; 61℃~55℃ for 60 s, -0.6℃ / cycle; 95℃ for 20 s, 55℃ for 60 s, 35 cycles; and 25℃ for 30 s.

Images