RT-qPCR-HRM detection primer and detection method for identifying five different subtype avian influenza viruses

Abstract

The invention discloses RT-qPCR-HRM (real-time quantitative polymerase chain reaction-high-resolution melting) detection primers and a detection method for identifying five different subtype avian influenza viruses, and belongs to the technical field of biology. The invention discloses an RT-qPCR-HRM detection method for identifying five different subtypes of avian influenza viruses, which comprises the following steps: designing a specific primer based on a highly conserved region of an AIV M gene, and simultaneously carrying out genetic typing on five subtypes of AIV strains H3, H5, H6, H7 and H9 in combination with an HRM technology; by comparing melting curve characteristics of M gene segments of different subtypes of AIV, an AIV detection method with good sensitivity and specificity is established. According to the method, the five AIVs of H3, H5, H6, H7 and H9 can be accurately typed, the defect of missing detection of a traditional AIV detection method is overcome, and the method has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically to an RT-qPCR-HRM detection primer and detection method for identifying five different subtypes of avian influenza virus. Background Technology

[0002] Avian influenza virus (AIV) belongs to the family Orthomyxoviridae and the genus *Influenzavirus*. Its viral genome consists of eight segmented, single-stranded, negative-sense RNA molecules. Based on the antigenic characteristics of the viral surface glycoproteins hemagglutinin (HA) and neuraminidase (NA), type A influenza viruses can be classified into 18 HA subtypes (H1–H18) and 11 NA subtypes (N1–N11). H17N10 and H18N11 have only been reported in bats, while the other 16 HA (H1–H16) and 9 NA (N1–N9) subtypes of avian influenza can be isolated from poultry. According to their pathogenicity in chickens, AIV can be divided into highly pathogenic avian influenza virus (HPAIV) and low pathogenic avian influenza virus (LPAIV). HPAIV, such as H5 and H7 subtypes of AIV, can cause systemic infection in poultry, resulting in high mortality rates. LPAIV, such as H3, H6, and H9 subtypes of AIV, usually cause mild clinical symptoms in poultry and have a lower mortality rate, but they are prone to secondary infections with other viral or bacterial diseases, increasing the harm to poultry. Furthermore, these low-pathogenic strains often provide internal fragments to highly pathogenic avian influenza strains, leading to gene rearrangement and the formation of novel recombinant strains, thus promoting the genetic diversity of avian influenza viruses. Avian influenza not only harms the healthy development of the poultry industry but also poses a significant threat to public health security. Currently, the WHO (World Health Organization) has reported 954 cases of human infection with H5 subtype AIV and 1568 cases of human infection with H7N9 subtype AIV, including fatal cases. In addition, low-pathogenic strains such as H3N2, H3N8, and H9N2 have also been reported to be associated with H3 and H9 subtype influenza viruses that infect humans. Therefore, continuous monitoring of avian influenza viruses is necessary to prevent public health emergencies.

[0003] Avian influenza (AIV) primarily causes respiratory diseases in poultry, resulting in significant economic losses for the poultry industry. Furthermore, the AIV genome is prone to mutation, leading to numerous viral genotypes and poor cross-protection between subtypes, posing a significant challenge to AIV diagnosis and control. Currently, avian influenza detection methods mainly include virus isolation and identification, serological testing, and molecular biological testing. Virus isolation and identification is the "gold standard" for avian influenza virus identification; it is accurate and reliable, but time-consuming, complex, and costly, making it unsuitable for large-scale clinical typing and diagnosis. Serological testing is commonly used for population screening; it is simple to operate and relatively inexpensive, but it cannot provide early diagnosis and has poor sensitivity. Molecular biological testing has the advantages of high sensitivity, strong specificity, and speed, but it requires sophisticated experimental equipment and is costly. In addition, there is currently no detection method capable of simultaneously detecting five different AIV subtypes (H3, H5, H6, H7, and H9), posing a challenge to epidemiological investigations and early diagnosis of avian influenza. Therefore, establishing a rapid diagnostic method capable of simultaneously identifying and detecting different circulating AIV subtypes has significant application value and practical significance.

[0004] Heterogeneous molecular regeneration (HRM) technology is a novel molecular biology detection method based on qPCR. It boasts advantages such as speed, sensitivity, and low cost, and has been widely used in the differential diagnosis of poultry diseases in recent years. The basic principle of HRM technology is to monitor the changes in fluorescence signal released by saturated fluorescent dyes during the amplification of double-stranded DNA (dsDNA) using a high-precision qPCR instrument, thereby enabling differential analysis of the target gene. During PCR amplification, dsDNA denatures and melts into single-stranded DNA (ssDNA) under high-temperature conditions. The melting temperature (Tm) of dsDNA is mainly related to factors such as the length of the target fragment and GC content. When the temperature reaches the Tm value, 50% of the dsDNA melts into ssDNA, and the Tm values ​​differ significantly for different nucleotide sequences. Before denaturation, the saturated fluorescent dye is highly intercalated and bound to dsDNA, resulting in a strong fluorescence signal. As the dsDNA denatures and melts into ssDNA, the dye dissociates, and the fluorescence signal gradually weakens. By using a high-precision qPCR instrument to monitor the fluorescence signal during this process in real time and analyzing the generated high-resolution melting curves, genotyping of the target viral nucleic acid can be achieved. This technology has high sensitivity and specificity, can accurately identify single base variations, is low in cost, and reduces contamination through closed-tube operation, making it widely used in fields such as medical diagnosis, agricultural breeding, and food safety testing.

[0005] qPCR typically uses unsaturated dyes, such as SYBR Green I and SYTO 9. These dyes have poor specificity, binding to any double-stranded DNA and failing to distinguish between target and non-specific products. Secondly, in the later stages of the PCR reaction, double-stranded DNA products accumulate in large quantities, and unsaturated dyes cannot completely bind to all newly bound double-stranded DNA. When the DNA concentration is too high, the increase in fluorescence signal is not proportional to the DNA content, affecting the accuracy of the results. Furthermore, the redistribution of fluorescent dyes during temperature increases distorts the fluorescence signal, failing to accurately reflect the differences in the original sequences. Unlike traditional qPCR, HRM technology uses specific saturated dyes, such as Eva Green and LC Green. These saturated fluorescent dyes have a stronger affinity for dsDNA, binding tightly to it at saturation concentrations with no free dye, resulting in a strong fluorescence signal. The dye concentration does not inhibit the PCR reaction. Moreover, subtle sequence differences during temperature increases can be observed through changes in fluorescence signal, thus enabling the identification of nucleic acid sequences from different genotypes.

[0006] In the differential diagnosis of pathogenic microorganisms, HRM technology has been widely used for the identification and typing of various pathogens, such as infectious bursal disease virus, avian leukosis virus, and goose parvovirus. However, there is currently no detection method that can simultaneously identify five different subtypes (H3, H5, H6, H7, and H9) of AIV.

[0007] Therefore, providing RT-qPCR-HRM detection primers and detection methods for identifying five different subtypes of avian influenza virus is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0008] In view of this, the present invention provides a detection method for identifying five different subtypes (H3, H5, H6, H7 and H9) of AIV based on HRM technology, aiming to achieve rapid identification and diagnosis of AIV and provide technical support for AIV epidemiological investigation and prevention and control strategy formulation.

[0009] This invention designs specific primers based on the highly conserved region of the AIV M gene and combines them with HRM technology to simultaneously genotype five AIV subtypes: H3, H5, H6, H7, and H9. By comparing the melting curve characteristics of the M gene fragments of different AIV subtypes, a method for AIV detection with good sensitivity and specificity was established. This method can accurately genotype the five AIV subtypes (H3, H5, H6, H7, and H9), overcoming the shortcomings of traditional AIV detection methods that often miss detections, and has broad application prospects.

[0010] To achieve the above objectives, the present invention adopts the following technical solution: A primer for RT-qPCR-HRM detection to identify five different subtypes of avian influenza virus, characterized in that the primer sequences are as follows: HRM-F: 5'-ATGCCTGATTAGTGGGTTGG-3'; HRM-R: 5'-GGNACAGTGACCACAGAAGT-3'. Furthermore, the five different subtypes of avian influenza virus are H3N2, H5N6, H6N1, H7N7 and H9N2.

[0011] Furthermore, an RT-qPCR-HRM detection method for identifying five different subtypes of avian influenza virus, not for the purpose of disease diagnosis, comprises the following steps: using the cDNA of the avian influenza virus to be detected as a template, amplification is performed using the RT-qPCR-HRM detection primers, and the five different subtypes of avian influenza virus are identified based on the melting curve.

[0012] Furthermore, the reaction system of the RT-qPCR-HRM is as follows: HRM Analysis PreMix 10µL, template 1µL, 0.3 µM HRM-F 0.6µL, 0.3 µM HRM-R 0.6µL, ddH2O 7.8µL; The reaction procedure was as follows: First, a pre-denaturation treatment was performed at 95℃ for 10 min, followed by a cyclic reaction stage. Each cycle consisted of denaturation at 95℃ for 10 s, annealing at 60℃ for 10 s, and extension at 72℃ for 20 s, for a total of 40 cycles. Simultaneously, the instrument was set to maintain the temperature at 65℃ for 1 min and then increase it to 95℃, with each temperature increase being 0.02℃. Fluorescence signals were collected during this process. After the HRM experiment was completed, the experimental results were analyzed using LightCycler 480 software.

[0013] As can be seen from the above technical solutions, compared with the prior art, the present invention discloses a primer and detection method for identifying five different subtypes of avian influenza virus (AIV) using RT-qPCR-HRM, which has the following beneficial effects: (1) The Tm values ​​of the melting curves of the M gene of the five different subtypes of AIV differ between 0.5 and 2.4℃, enabling simultaneous detection of the five different subtypes of AIV; (2) Good specificity, with no obvious cross-reaction with 12 common avian pathogens such as IBV, NDV, and MDV; (3) High sensitivity. The limits of detection for single standard plasmids of the M gene of AIV subtypes H3N2, H5N6, H6N1, H7N7 and H9N2 were relatively high, at 30.70 copies / µL, 34.80 copies / µL, 30.95 copies / µL, 39.65 copies / µL and 34.58 copies / µL respectively; (4) Good repeatability, with CV values ​​of less than 5% for both intra-batch and inter-batch repeatability tests; the R values ​​of the standard curves established for the five different AIV subtypes were relatively high. 2 The values ​​are all higher than 0.993, which can realize the quantitative detection of the sample; (5) The detection time is short. This method can complete the identification detection of the sample within 2 hours, providing technical support for early diagnosis. In summary, this invention has successfully established an RT-qPCR-HRM detection method that can identify five different subtypes of AIV. This method has good specificity, sensitivity and repeatability, and can be applied to the rapid clinical identification and quantitative detection analysis of AIV, with good clinical application potential. Attached Figure Description

[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0015] Figure 1 Standardized melting curves for five different subtypes of AIV.

[0016] Figure 2 The peak-shaped melting curves are for five different subtypes of AIV.

[0017] Figure 3 The standard curve for pMD18-T-H3N2.

[0018] Figure 4 The standard curve for pMD18-T-H5N6.

[0019] Figure 5 The standard curve for pMD18-T-H6N1.

[0020] Figure 6 The standard curve for pMD18-T-H7N7.

[0021] Figure 7 The standard curve for pMD18-T-H9N2.

[0022] Figure 8 This is the analysis result of the melting curve in the specific experiment.

[0023] Figure 9 This is the analysis result of gel electrophoresis in a specific experiment.

[0024] Where M: DL 500 Marker; 1-12 are IBV, NDV, aMPV, ILTV, IBDV, MDV, ALV, MS, CPs, MG, etc. Escherichia coli , Salmonella Nucleic acid; 13 is the negative control; 14-18 are AIV standard quality particles of H3N2, H5N6, H6N1, H7N7 and H9N2, respectively.

[0025] Figure 10 The amplification results are corresponding to the sensitivity curve of pMD18-T-H3N2.

[0026] Figure 11 The amplification results are corresponding to the sensitivity curve of pMD18-T-H5N6.

[0027] Figure 12 The amplification results are corresponding to the sensitivity curve of pMD18-T-H6N1.

[0028] Figure 13 The amplification results are corresponding to the sensitivity curve of pMD18-T-H7N7.

[0029] Figure 14 The amplification results are corresponding to the sensitivity curve of pMD18-T-H9N2.

[0030] Figures 10-14 In the amplification curve, the dilution gradient from left to right is 10. -1 ~10 -10 10 of them -10 The situation is gradually stabilizing.

[0031] Figure 15 Melting curves for pMD18-T-H3N2 sensitivity experiments.

[0032] Figure 16 Melting curves for sensitivity experiments of pMD18-T-H5N6.

[0033] Figure 17Melting curves for sensitivity experiments of pMD18-T-H6N1.

[0034] Figure 18 Melting curves for sensitivity experiments of pMD18-T-H7N7.

[0035] Figure 19 Melting curves for sensitivity experiments of pMD18-T-H9N2. Detailed Implementation

[0036] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0037] Based on the conserved regions of the AIV M gene, this study targeted five prevalent AIV subtypes (H3, H5, H6, H7, and H9) using sequence alignment analysis. Gene regions with significantly different GC content were selected as detection targets, and specific HRM amplification primers were designed. Standard high-performance liquids (SPLs) of the M gene for different AIV subtypes were constructed, reaction conditions were optimized, standard melting curves for different AIV subtypes were established, and specificity, sensitivity, and repeatability tests were performed.

[0038] Example 1: Establishment of a detection method for identifying five different subtypes of AIV based on HRM technology. 1.1 Test Materials 1.1.1 Virus strains and other avian pathogens The strains H3N2 subtype AIV, H9N2 subtype AIV, and other common avian pathogens, including infectious bronchitis virus (IBV), Newcastle disease virus (NDV), duck plague virus (DPV), infectious laryngotracheitis virus (ILTV), infectious bursal disease virus (IBDV), Marek's disease virus (MDV), avian leukosis virus (ALV), Mycoplasma synoviae (MS), Chlamydia psittaci (CPs), Mycoplasma gallisepticum (MG), and Escherichia coli (…). Escherichia coli ),salmonella( Salmonella The strains or nucleic acids of the virus were preserved by the Poultry Disease Research Laboratory of Guangxi University. The M gene fragments of the H5N6, H6N1 and H7N7 subtype AIVs were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0039] 1.1.2 Main Reagents DNA purification and recovery kit, ampicillin, and HRM analysis kit (EvaGreen) were purchased from Beijing Tiangen Biotechnology Co., Ltd.; plasmid extraction kit, 2×Es Taq MasterMix (Dye), RNA extraction kit, and quantitative reverse transcription kit were purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd.; DH5α competent cells, pMD18-T Vector Cloning Kit, and DL2000 DNA Marker were purchased from Baori Biotechnology (Beijing) Co., Ltd.

[0040] 1.1.3 Major Instruments and Manufacturers LightCycler® 480 Real-Time PCR System (Roche, Switzerland); Mini high-speed centrifuge (Eppendorf, Germany); 37°C incubator (Shanghai Boxun); Water bath (Jiangsu Jinyi Instruments); -80°C ultra-low temperature freezer (Zhongke Meiling Cryogenic Technology Co., Ltd.); DYY-6C electrophoresis apparatus (Beijing Liuyi Instruments); Platinum HD7 gel imaging system (Uvitec); Temperature-controlled shaker (Jintan Jinnan Instruments); Vortex shaker (Jiangsu Qilinbeier); SW-CJ-2F double-sided clean bench (Clean Air Group Suzhou Antai Air Technology Co., Ltd.)

[0041] 1.2 Test Methods 1.2.1 Total RNA extraction and reverse transcription Dissolve the positive virus solution on ice. After sterilizing the laminar flow hood with UV light, transfer 250 μL of the positive virus solution into a 2 mL EP tube, add 750 μL of RNAiso, shake vigorously, and incubate at room temperature for 5 min to fully lyse the tissue and release proteins. Add 200 μL of chloroform to the EP tube, immediately shake gently to mix, and incubate at room temperature for 1-2 min to denature the proteins. Centrifuge at 12000 rpm for 10 min in a low-temperature centrifuge. After centrifugation, the solution in the tube will be visibly divided into three layers. Carefully aspirate 500 μL of the upper RNA layer into a clean 1.5 mL EP tube, avoiding aspirating the middle and lower layers containing chloroform. Add 500 μL of isopropanol to the same tube in a 1:1 ratio, shake gently to mix, and place in a -20°C freezer for half an hour. After half an hour, remove the EP tube and centrifuge at 12000 rpm for 10 min in a low-temperature centrifuge to precipitate the RNA. Carefully aspirate and discard the supernatant. Gently pipette 1 mL of 70% ethanol into the tube, gently invert the EP tube twice to wash the precipitate, and centrifuge at 12000 rpm for 5 min in a low-temperature centrifuge. Carefully aspirate and discard the supernatant containing isopropanol and other impurities. After aspirating the supernatant, let it stand for several minutes to air dry any residual alcohol. Finally, add DEPC water according to the reverse transcription ratio, repeatedly pipetting to dissolve the precipitate and obtain viral RNA. Transfer the RNA to a new EP tube for reverse transcription or store at -80℃ for later use.

[0042] The reverse transcription system is shown in Table 1. Dissolve the RNA template, Primer Mix, dNTP Mix, DTT, RT Buffer, HiFiScript, and RNase-Free Water and keep them on ice. Prepare the reaction mixture according to Table 1, with a total volume of 20 μL. Vortex to mix, then briefly centrifuge to collect the solution on the tube wall to the bottom. cDNA synthesis reaction conditions: incubate at 42℃ for 50 min, then at 85℃ for 5 min. After the reaction, briefly centrifuge and cool on ice.

[0043] Table 1 RNA reverse transcription system

[0044] 1.2.2 Preparation of standard quality particles 1.2.2.1 Amplification of AIV M gene sequences of five different subtypes The M gene fragments of the H5N6, H6N1 and H7N7 subtypes of AIV (as shown in SEQ ID NO. 1-3) were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0045] The M gene fragment of H5N6 subtype AIV: ATGAGTCTTCTAACCGAGGTCGAAACGTACGTTCTCTCTATCATCCCATCAGGCCCCCTCAAAGCCGAGATCGCGCAGAAACTTGAGGATGTGTTTGCAGGAAAGAACGCTGATCTCGAGGCTCTCATGGAGTGGCTAAAGACAAGACCAATCCTGTCACCTCTGACTAAAGGAATTTTGGGATTTGTATTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGGTTTGTCCAGAATGCCCTAAATGGAAATGGAGATCCAAATAATATGGATAGGGCAGTTAAGCTATATAAGAAGCTGAAAAGAGAAATAACATTCCATGGAGCTAAGGAGGTCGCACTCAGTTACTCAACTGGTGCACTTGCCAGTTGCATGGGTCTCATATACAACAGAATGGGAACAGTGACTACAGAAGTGGCTTTTGGCCTAGTGTGTGCCACTTGTGAGCAGATTGCGGATTCACAGCATCGGTCTCACAGACAGATGGCAAACATCACCATCCACTAATCAGACATGAGAACAGAATGGTGCTGGCAGACACTACAGCTAAGGCTATGGAGCAGATGGCCGGATCAAGTGAGCAGGCAGCAGAAGCCATGGAGGTCGCCAATCAGGCTAGACAGATGGTGCAGGCAATGAGAACAATTGGGACTCATCCTAATTCTAGTACTGGTCTGAGAGACAATCTTCTTGAAAATTTGCAGGCCTACCAGAAACGGATGGGAGTGCAGATGCAGCGATTCAGGTGATCCTCTTGTTGTTGCCGCAAATATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTCTTTTCTTCAATGATTTATCGTCCGCTTAAATACGGTTTGAAAAGAGGGCCTTCTACGGGAGGAGTACCGGAGTCTATGAGGGAGAGTACCGGGAGGAACAGCAGAATGCTGTAGATGTTGACGATGGTCATTTTGTCAACATAGAGTTGGAGTAA;SEQ ID NO.1。

[0046] The M gene fragment of H6N1 subtype AIV:

[0047] The M gene fragment of H7N7 subtype AIV: ATGAGTCTTCTAACCGAGGTCGAAACGTACGTTCTCTCTATCGTCCCGTCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTTGAAGATGTCTTTGCAGGGAAGAACACCGATCTCGAGGCTCTCATGGAATGGCTAAAGACAAGACCAATCTTGTCACCTCTGACTAAGGGGATTTTAGGGTTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCAAAATGCTCTAAATGGAAATGGAGACCCAAACAACATGGACAGGGCAGTTAAACTGTACAGGAAATTGAAGAGAGAGATAACATTCCATGGGGCTAAAGAAGTTGCACTCAGTTACTCAACCGGTGCACTTGCCAGTTGTATGGGTCTCATATACAACAGGATGGGGACGGTGACCACAGAAGTGGCGTTTGGCCATGTGTGTGCCACCTGTGAGCAGATTGCTGATTCACAGCATCGATCTCACAGACAGATGGTAACCACCACCAACCCGCTAATCAGGCATGAAAACAGAATGGTGCTGGCCAGCACTACGGCTAAGGCTATGGAGCAGATGGCTGGATCGAGTGAGCAGGCAGCGGAGGCCATGGAGGTTGCTAGTCAGGCTAGGCAGATGGTGCAGGCGATGAGGACCATTGGAACTCACCCTAGCTCCAGTGCCGGTCTGAAAGATGATCTTCTTGAAAATTTGCAGGCCTACCAGAAACGGATGGGAGTGCAAGTGCAGCGATTCAAATGATCCTCTCGTTATTGCCGCAAGTATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTCTTTTCTTCAAATGCATTTATCGTCGCCTTTAAATACGGTTTGAAAAGAGGGCCTTCTACGGAAAGAGTGCTTGAGTCTATGAGGGAAGAGTATCGGCCAGGAACAGCAGAGTGCTGTGGATGTTGACGATGGTCATTTTGTCAACATAGAGCTGGAGTAA;SEQ ID NO.3。

[0048] Using AIV H3N2 and H9N2 cDNA as templates, the M gene sequence was amplified by PCR (M gene primer sequences: F: TTCTAACCGAGGTCGAAACGTA; SEQ ID NO.4; R: AAGCGGTCTACGCTGCAGTCCTCG; SEQ ID NO.5), and the PCR products were separated by agarose gel electrophoresis. The target fragment was purified and recovered using a DNA purification kit, and the recovered product was stored at -20℃ for later use.

[0049] 1.2.2.2 Ligation, transformation and identification of amplification products (1) The purified DNA was ligated with the pMD18-T vector. The specific 10 μL reaction system was prepared as follows: 0.3 μL pMD18-T cloning vector, 4.5 μL Solution I ligase and 5.2 μL purified DNA fragment. After vortexing and mixing, the mixture was briefly centrifuged and then transferred to a ligator. The ligation was carried out at 16 °C for 4 h. (2) Add 10 µL of ligation product to 30 µL of DH5α competent cells, incubate on ice for 5 min, heat shock in a 42℃ water bath for 90 s, and then immediately incubate on ice for 2-3 min. Add 500 µL of antibiotic-free LB culture medium, and incubate on a shaker at 37℃ for 45 min to revive the bacterial culture. Centrifuge the bacterial culture at 3000 r / min. Resuspend 100 µL of LB bacterial culture precipitate and spread it evenly on the surface of LB solid agar plates containing 100 μg / mL Amp. Incubate at 37℃ for 12-16 hours. (3) Randomly select 6-8 white single colonies from LB solid agar plates and culture them in 500 μL of liquid medium containing AmpLB. Culture them in a shaker at 37°C for 6 h. Identify positive clones by PCR (using the M gene primer sequence).

[0050] 1.2.2.3 Sequence determination and analysis of positive clones Recombinant plasmids that tested positive by bacterial culture PCR were selected and sent to Shanghai Sangon Biotech for M13 universal primers. The obtained sequences were assembled using DNAStar Lasergene software and compared with the M gene sequences of AIV reference strains (H3N2, H5N6, H6N1, H7N7, and H9N2) in GenBank. Nucleotide homology was analyzed using the Clustal Omega algorithm, and sequences with a similarity greater than 99% were considered correct recombinant plasmids. The sequencing results are as follows: H3N2 (RID-K048XBEP014, as shown in SEQ ID NO.6); H5N6 (RID-KFWSCY6E014, as shown in SEQ ID NO.7); H6N1 (RID-K046FTYA016, as shown in SEQ ID NO.8); H7N7 (RID-K01THDNS014, as shown in SEQ ID NO.9); H9N2 (RID-KD19CMAK014, as shown in SEQ ID NO.10).

[0051] H3N2--RID-K048XBEP014: TAGTTTTTTACTCCAGCTCTATGTTGACAAAATGACCATCGTCAACATCCACAGCACCCTCTTGCTCCTGCCGATATTCCTCCCTCATAGACCCAGGCACTCCTTCCGTAGAAGGCCCTCTTTTCAAACCGTATTTAAGGCGACGATAAATGCATTTGAAGAAAAGACGATCAAGAATCCACAATATCAAGTGCAAGATCCCAATGATACTTGCTGCAATAACGAGAGGATCACTTGAACCGTTGCATTTGCACTCCCATCCGTTTCTGGTAGGCCTGCAAATTTTCAAGAAGATCATCTTTCAGACCGGCACTGGAGCTAGGATGAGTCCCAATTGTCCTCATTGCCTGCACCATCTGCCTAGCCTGACTAGCAACTTCCATGGCTTCTGCTGCCTGCTCACTTGACCCAGCCATCTGCTCCATAGCTTTAGCTGTGGTGCTGGCCAGCACCATTCTGTTTTCATGCCTGATTAGTGGGTTGGTAGTAGTCACCATCTGTCTGTGAGACCGATGCTGTGAATCAGCAATCTGCTCACAGGTGGCGCATACTAGACCAAAAGCCACTTCTGTGGTCACTGTCCCCATCCTGTTGTATATGAGACCCATGCAACTGGCAAGTGCACCGGTTGAGTAACTGAGTGCAACCTCCTTAGCCCCATGGAATGTTATTTCCCTCTTCAATTTCCTGTATAGTTTAACTGCCCTATCCATGTTGTTTGGATCTCCATTTCCATTCAGAGCATTCTGAACA AAGCGTCTACGCTGCAGTCCTCG CTCACTGGGCACGGTGAGCGTGAACACAAATCCTAAAATCCCCTTAGTCAGAGGTGACAGGATTGGTCTTGTCTTTAGCCATTCCATGAGAGCCTCAAGATCGGTGTTCTTCCCTGCAAAAACATCTTCAAGTCTCTGCGCGATCTCGGCTTTGAGGGGGCCTGACGGAACGATAGAGAGAACG TACGTTTCGACCTCGGTTAG AA GACTCATC;SEQ ID NO.6。

[0052] H5N6--RID-KFWSCY6E014: ATGAGTC TTCTAACCGAGGTCGAAACGTA CGTTCTCTCTATCATCCCATCAGGCCCCCTCAAAGCCGAGATCGCGCAGAAACTTGAGGATGTGTTTGCAGGAAAGAACGCTGATCTCGAGGCTCTCATGGAGTGGCTAAAGACAAGACCAATCCTGTCACCTCTGACTAAAGGAATTTTGGGATTTGTATTCACGCTCACCGTGCCCAGTGAG CGAGGAC TGCAGCGTAGACGGTT TGTCCAGAATGCCCTAAATGGAAATGGAGATCCAAATAATATGGATAGGGCAGTTAAGCTATATAAGAAGCTGAAAAGAGAAATAACATTCCATGGAGCTAAGGAGGTCGCACTCAGTTACTCAACTGGTGCACTTGCCAGTTGCATGGGTCTCATATACAACAGAATGGGAACAGTGACTACAGAAGTGGCTTTTGGCCTAGTGTGTGCCACTTGTGAGCAGATTGCGGATTCACAGCATCGGTCTCACAGACAGATGGCAAACATCACCATCCACTAATCAGACATGAGAACAGAATGGTGCTGGCAGACACTACAGCTAAGGCTATGGAGCAGATGGCCGGATCAAGTGAGCAGGCAGCAGAAGCCATGGAGGTCGCCAATCAGGCTAGACAGATGGTGCAGGCAATGAGAACAATTGGGACTCATCCTAATTCTAGTACTGGTCTGAGAGACAATCTTCTTGAAAATTTGCAGGCCTACCAGAAACGGATGGGAGTGCAGATGCA;SEQ IDNO.7。

[0053] H6N1--RID-K046FTYA016: CAGCAAAAGCAGGTAGATGTTGAAAGATGAGTC TTCTAACCGAGGTCGAAACGTACGTTCTCTCTATCATCCCATCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTTGAGGATGTTTTTGCAGGGAAGAACACAGATCTTGAGGCTCTCATGGAATGGCTAAAGACAAGACCAATCCTGTCACCTCTGACTAAGGGGATTTTAGGGTTTGTGTTCACGCTCACCGTGCCCAGTGAG CGAGGACTGCAGCGTAGACGATT TGTCCAAAATGCCCTAAATGGGAATGGAGACCCAAACAACATGGACAGGGCAGTCAAACTATACAAGAAGCTGAAGAGGGAAATGACATTCCATGGAGCAAAGGAAGTTGCACTCAGTTACTCAACTGGTGCACTTGCCAGTTGCATGGGTCTCATATACAACCGGATGGGAACAGTGACCACAGAAGTGGCTCTTGGCCTAGTATGTGCCACTTGTGAGCAGATTGCTGATGCCCAACATCGGTCCCACAGGCAGATGGCGACTACCACCAACCCACTAATCAGGCATGAGAACAGAATGGTACTAGCCAGCACTACGGCTAAGGCCATGGAGCAGATGGCTGGATCAAGTGAGCAGGCAGCAGAAGCCATGGAAGTCGCAAGTCAGGCTAGGCAAATGGTGCAGGCTATGAGGACAATTGGGACTCATCCTAGCTCCAGTGCAGGTCTAAAAGATGATCTTATTGAAAATTTGCAGGCTTACCAG-AAACGGATGGGAGTGCAAATGCAGCGATTCAAGTGATCCTCTCGTTGTTGCAGCAAGTATCATTGGGATATTGCACTTGATATTGTGGATTCTTGATCGTCTTT;SEQ ID NO.8。

[0054] H7N7--RID-K01THDNS014: ATCCCAATGATACTTGCGGCAATAACGAGAGGATCACTTGAATCGCTGCATTTGCACTCCCATCCGTTTCTGGTAGGCCTGCAAATTTTCAAGAAGATCATCTTTCAGACCGGCACTGGAGCTAGGGTGAGTTCCAATGGTCCTCATCGCCTGCACCATCTGCCTAGCCTGACTAGCAACCTCCATGGCCTCCGCTGCCTGCTCACTCGATCCAGCCATCTGCTCCATAGCCTTAGCCGTAGTGCTGGCCAGCACCATTCTGTTTTCATGCCTGATTAGCGGGTTGGTGGTGGTTACCATCTGTCTGTGAGATCGATGCTGTGAATCAGCAATCTGCTCACAGGTGGCACACACTAGGCCAAACGCCACTTCTGTGGTCACCGTCCCCATCCTGTTGTATATGAGACCCATACAACTGGCAAGTGCACCGGTTGAGTAACTGAGTGCAACTTCTTTAGCCCCATGGAATGTTATCTCTCTCTTCAATTTCCTGTACAGTTTAACTGCCCTGTCCATGTTGTTTGGGTCTCCATTTCCATTTAGAGCATTTTGGACA AAGCGTCTACGCTGCAGTCCTCG CTCACTGGGCACGGTGAGCGTGAACACAAACCCTAAAATCCCCTTAGTCAGAGGTGACAAGATTGGTCTTGTCTTTAGCCATTCCATGAGAGCCTCGAGATCGGTGTTCTTCCCTGCAAAGACATCTTCAAGTCTCTGCGCGATCTCGGCTTGAGGGGGCCTGACGGGACGATAGAGAGAACG TACGTTTCGACCTCGGTTAGAA GACTCATGAATTCACTGGC;SEQ ID NO.9。

[0055] H9N2--RID-KD19CMAK014: CTAGATGCATTCGCGAGGTACCGAGCTCGCTAGCAGTAGAAACAAGGTAGTTTTTTACTCCAGCTCTATGTTGACAAAATGACCATCGTCAACATCCACAGCATTCTGCTGTTCCTGCCGATACTCTTCCCTCATAGACTCAGGCACTCCTTCCGTAGAAGGCCCTCTTTTCAAACCGTATTTAAAGCGACGATAAATGCATTTGAAGAAAAGACGATCAAGAATCCACAATATCAAGTGCAATATCCCAATGATACTTGCTGCAACAACGAGAGGATCACTTGAATCGCTGCATTTGCACTCCCATCCGTTTCTGGTAAGCCTGCAAATTTTCAATAAGATCATCTTTTAGACCTGCACTGGAGCTAGGATGAGTCCCAATTGTCCTCATAGCCTGCACCATTTGCCTAGCCTGACTTGCGACTTCCATGGCTTCTGCTGCCTGCTCACTTGATCCAGCCATCTGCTCCATGGCCTTAGCCGTAGTGCTGGCTAGTACCATTCTGTTCTCATGCCTGATTAGTGGGTTGGTGGTAGTCGCCATCTGCCTGTGGGACCGATGTTGGGCATCAGCAATCTGCTCACAAGTGGCACATACTAGGCCAAGAGCCACTTCTGTGGTCACTGTTCCCATCCGGTTGTATATGAGACCCATGCAACTGGCAAGTGCACCAGTTGAGTAACTGAGTGCAACTTCCTTTGCTCCATGGAATGTCATTTCCCTCTTCAGCTTCTTGTATAGTTTGACTGCCCTGTCCATGTTGTTTGGGTCTCCATTCCCATTTAGGGCATTTTGGAC AATCGTCTACGCTGCAGTCCTCG CTCACTGGGCACGGTGAGCGTGAACACAAACCCTAAAATCCCCTTAGTCAGAGGTGACAGGATTGGTCTTGTCTTTAGCCATTCCATGAGAGCCTCAAGATCTGTGTTCTTCCCTGCAAAAACATCCTCAAGTCTCTGCGCGATCTCGGCTTTGAGGGGGCCTGATGGGATGATAGAGAGAACG TACGTTTCGACCTCGGTTAGAA GACTCA; SEQ ID NO.10.

[0056] 1.2.2.4 Plasmid extraction from positive clones Selected positive clones with correct sequencing were inoculated into 200 mL LB liquid medium (containing 100 μg / mL Amp) for expansion culture and incubated at 37°C in a shaker for 12–16 h. Positive plasmids were extracted according to the plasmid extraction kit instructions and stored at -80°C.

[0057] 1.2.2.5 Plasmid detection of positive standards The concentration of recombinant plasmid was determined by ultraviolet spectrophotometry, and the plasmid copy number was accurately calculated using the following formula:

[0058] The formula for calculating the molecular weight of plasmids is as follows: Molecular weight = (vector length + insert fragment length) x 660 Da / bp.

[0059] Results: Sequencing verification showed that the constructed recombinant plasmids of each genotype had a sequence similarity greater than 99.0% with the corresponding reference strains H3N2, H5N6, H6N1, H7N7, and H9N2 in the NCBI database, indicating that the target gene was successfully cloned into the pMD18-T vector. The purified plasmids were named pMD18-T-H3N2, pMD18-T-H5N6, pMD18-T-H6N1, pMD18-T-H7N7, and pMD18-T-H9N2, respectively. The initial concentrations of the five standards were calculated based on the above formula, and the results are shown in Table 2.

[0060] Table 2 Initial concentrations of five standard quality particles

[0061] 1.2.2.6 Design of RT-qPCR-HRM identification primers The M gene sequences of AIV H3N2, H5N6, H6N1, H7N7, and H9N2 were downloaded from the NCBI database. The sequences were then aligned online using the MAFRT website (https: / / mafft.cbrc.jp / alignment / software / ). Based on HRM primer design principles, gene fragments exhibiting significantly different GC content in the M genes of the five different AIV subtypes were selected as target genes (668bp~1089bp). HRM amplification primers were designed based on the conserved regions of these gene fragments. The primer sequences are as follows: HRM-F: 5'-ATGCCTGATTAGTGGGTTGG-3'; SEQ ID NO. 11.

[0062] HRM-R: 5'-GGNACAGTGACCACAGAAGT-3'; SEQ ID NO. 12.

[0063] The amplified fragment size is 237bp.

[0064] 1.2.3 RT-qPCR-HRM amplification Using the standard quality plasmid prepared in 1.2.2 as the HRM amplification template, primer concentrations (0.1µM, 0.2µM, 0.3µM, 0.4µM, and 0.5µM, respectively) and annealing temperatures (55℃, 56℃, 57℃, 58℃, 59℃, 60℃, 61℃, and 62℃, respectively) were designed to optimize the reaction conditions. The optimal reaction system for RT-qPCR-HRM was finally determined (see Table 3) and the optimal reaction procedure (see Table 4).

[0065] Table 3 Optimal reaction system for RT-qPCR-HRM amplification

[0066] Table 4 RT-qPCR-HRM reaction procedure

[0067] RT-qPCR-HRM amplification results: Based on an optimized RT-qPCR-HRM reaction system and procedure, HRM melting curves for five different AIV subtypes were established. The results showed that the normalized melting curves of the H3N2, H5N6, H6N1, H7N7, and H9N2 AIV subtypes exhibited significant differences, and the M gene fragments of the five different AIV subtypes could be clearly distinguished. Figure 1 The peak-shaped melting curve results showed that the amplified products of different subtypes exhibited significant shifts in the characteristic peak positions (Tm values) within the temperature range of 80.4℃ to 82.4℃, with H3N2 and H6N1 showing the largest differences in Tm values. Tm is 2.0℃), while H3N2 and H9N2 Tm minimum (0.3℃) Figure 2 In summary, the RT-qPCR-HRM detection method established in this invention can simultaneously detect five different subtypes of AIVs.

[0068] 1.2.4 Establishment of Standard Curves for Five Different AIV Subtypes The standard quality particles in 1.2.2 were diluted in a 10-fold gradient, with 10 -2 ~10 -6The plasmids at different dilutions were used as templates, and each dilution was used in triplicate for RT-qPCR-HRM amplification. A standard curve equation was established, with the logarithm of the standard plasmid copy number (Log10) on the x-axis and the mean Cp value of each dilution gradient on the y-axis, to construct a quantitative detection standard curve for five AIV subtypes, including H3N2, H5N6, H6N1, H7N7, and H9N2.

[0069] At a dilution of 10 -2 ~10 -6 Using standard plasmids as templates, quantitative standard curves for five different subtypes of AIVs (H3N2, H5N6, H6N1, H7N7, and H9N2) were constructed. The results showed that... Figures 3-7 ), standard quality particle pMD18-T-H3N2 R 2 The R value of the standard quality particle pMD18-T-H5N6 is 0.9944. 2 The R value of the standard quality particle pMD18-T-H6N1 is 0.9939. 2 The R value of the standard quality particle pMD18-T-H7N7 is 0.9961. 2 The R of the standard quality particle pMD18-T-H9N2 is 0.9981. 2 The R-value is 0.9934. The standard curves for the five plasmids show an R-value of 0.9934. 2 All values ​​are greater than 0.99, indicating that the five established standard curve equations accurately describe the observed values ​​(R0.05). 2 =0.993~0.9981).

[0070] 1.2.5 Specificity Test The constructed RT-qPCR-HRM detection method was applied, using five standard quality plasmids of AIV (H3N2, H5N6, H6N1, H7N7, and H9N2), as well as IBV, NDV, aMPV, ILTV, IBDV, MDV, ALV, MS, CPs, MG, and other assays. Escherichia coli , Salmonella The specificity of the detection method was verified by using nucleic acids of common avian pathogens as templates.

[0071] Specificity test results: The established detection method was used to detect five different subtypes of AIVs (H3N2, H5N6, H6N1, H7N7, and H9N2), as well as IBV, NDV, aMPV, ILTV, IBDV, MDV, ALV, MS, CPs, and MG. Escherichia coli , SalmonellaCommon avian pathogens were detected. Results showed that only five different AIV subtypes (H3N2, H5N6, H6N1, H7N7, and H9N2) exhibited specific melting curves; agarose gel electrophoresis analysis revealed a clear target band at approximately 237 bp, consistent with the expected size. Figure 8 and Figure 9 The above results indicate that the detection method established in this invention has good specificity and no significant cross-reaction with other avian pathogens.

[0072] 1.2.6 Sensitivity Test The standard quality particles from section 1.2.2 were diluted in 10-fold increments. At a dilution of 10... -1 ~10 -10 Using the standard quality plasmid as the detection template, the sensitivity test of the RT-qPCR-HRM detection method was carried out according to the reaction procedure and reaction system in step 1.2.3.

[0073] Sensitivity test results: Standard plasmids of five different AIV subtypes were serially diluted 10-fold, and sensitivity tests were performed on each. The amplification curves are shown in the diagrams from left to right, with each dilution representing a different subtype. -1 ~10 -10 10 of them -10 The curve tends to flatten out, and the amplification curve ( Figures 10-14 ) and melting curve ( Figures 15-19 The results showed that the five different subtypes of AIVs standards were serially diluted 10 times. -1 ~10 -10 The method exhibits a single amplification curve within the range. The limits of detection for H3N2, H5N6, H6N1, H7N7 and H9N2 subtypes of AIVs are 30.70 copies / µL, 34.80 copies / µL, 30.95 copies / µL, 39.65 copies / µL and 34.58 copies / µL, respectively, indicating that the method has high sensitivity.

[0074] 1.2.7 Repeatability Test The stability and repeatability of this method were evaluated by conducting intra-batch and inter-batch repeatability tests. A dilution of 10 was selected. -2 ~10 -6 The standard quality particles were used as the detection template. The reaction system and procedure were strictly carried out according to steps 1.2.3. The Cp values ​​of the detection results were statistically analyzed, and the standard deviation (SD) and coefficient of variation (CV) of samples with different degrees were calculated.

[0075] Repeatability test results: The repeatability and stability of the established detection method were verified through intra-batch and inter-batch repeatability tests. The results are shown in Tables 5-9. The highest coefficient of variation (COP) for the standard quality grain pMD18-T-H3N2 was 2.49% for intra-batch repeatability and 2.69% for inter-batch repeatability; for pMD18-T-H5N6, the highest COP was 1.29% for intra-batch repeatability and 2.61% for inter-batch repeatability; for pMD18-T-H6N1, the highest COP was 2.87% for intra-batch repeatability and 2.27% for inter-batch repeatability; for pMD18-T-H7N7, the highest COP was 1.26% for intra-batch repeatability and 2.87% for inter-batch repeatability; and for pMD18-T-H9N2, the highest COP was 1.22% for both intra-batch and inter-batch repeatability. The above results indicate that the detection method has good repeatability and stability, with values ​​all below 5%, meeting the technical requirements for repeatability of molecular diagnostic methods.

[0076] Table 5. Intra-batch and inter-batch repeatability tests of pMD18-T-H3N2

[0077] Table 6. Intra-batch and inter-batch repeatability tests of pMD18-T-H5N6

[0078] Table 7. Intra-batch and inter-batch repeatability tests of pMD18-T-H6N1

[0079] Table 8. Intra-batch and inter-batch repeatability tests of pMD18-T-H7N7

[0080] Table 9. Intra-batch and inter-batch repeatability tests of pMD18-T-H9N2

[0081] AIV has numerous subtypes, a wide host range, and can generate novel recombinant viruses through continuous mutation or gene reassortment. These novel viruses can breach species barriers, acquiring the ability to infect and transmit in mammals (including humans), posing a risk of zoonotic transmission. Therefore, global AIV epidemic surveillance and evolutionary analysis are crucial for the prevention and control of this disease. However, the continuous evolution and recombination of different AIV subtypes present significant challenges to disease surveillance. Currently, detection methods for AIV include commonly used virus isolation and identification and molecular biological detection, but these methods require specialized personnel and are time-consuming. Other novel detection methods established in the field of molecular diagnostics include CRISPR technology, isothermal amplification technology, and multiplex qPCR. Among these, CRISPR detection technology is known for its high sensitivity and specificity, but it is costly and carries the risk of off-target effects and immune responses in its application to avian disease surveillance, leading to false positive results. Common isothermal amplification techniques include LAMP, RPA, and NEAR. Taking LAMP as an example, this method is simple to operate and suitable for rapid on-site detection, but primer design is complex, the risk of false positives is high, and the multiplex detection capability is poor. Multiplex qPCR is a mature and stable technique with advantages such as high throughput and high efficiency, but it is susceptible to interference from primers and probes, making design optimization complex and resulting in low sensitivity. Compared with the above-mentioned novel AIV detection methods, this invention establishes an RT-qPCR-HRM detection method for five different subtypes of AIV strains currently prevalent in China: H3N2, H5N6, H6N1, H7N7, and H9N2. This method has the following advantages: First, specificity, sensitivity, and repeatability tests show that this method can amplify five different subtypes of prevalent AIV strains. Furthermore, significant differences exist in both the standard melting curve and the peak-shaped melting curve, indicating that this method can simultaneously distinguish five different subtypes of AIV strains. This method exhibits good specificity, showing no cross-reactivity with 12 common avian pathogens, including IBV and NDV; its sensitivity is significantly higher than that of conventional PCR methods; and it demonstrates good repeatability, with CV values ​​below 5% in both intra- and inter-batch repeatability tests. Standard curves for five different subtype strains were established, and R... 2 The values ​​are all higher than 0.993, which enables quantitative detection of the samples.

[0082] In summary, this invention establishes a detection method based on HRM that can identify five different subtypes of AIVs: H3, H5, H6, H7, and H9. This method has good specificity, high sensitivity, good repeatability, and short detection time, enabling simultaneous differential diagnosis of five different subtypes of AIVs, and providing technical support for rapid early diagnosis and prevention of AIVs.

[0083] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A primer for identifying five different subtypes of avian influenza virus using RT-qPCR-HRM, characterized in that, The primer sequences are as follows: HRM-F: 5'-ATGCCTGATTAGTGGGTTGG-3'; HRM-R: 5'-GGNACAGTGACCACAGAAGT-3'.

2. The RT-qPCR-HRM detection primers for identifying five different subtypes of avian influenza virus according to claim 1, characterized in that, The five different subtypes of avian influenza virus are H3N2, H5N6, H6N1, H7N7 and H9N2.

3. An RT-qPCR-HRM detection method for identifying five different subtypes of avian influenza virus not for disease diagnosis, characterized in that, The specific steps are as follows: using the cDNA of the avian influenza virus to be detected as a template, amplification is performed using the RT-qPCR-HRM detection primers described in claim 1, and the five different subtypes of avian influenza virus are determined based on the melting curve.

4. The detection method according to claim 3, characterized in that, The reaction system for RT-qPCR-HRM is as follows: HRMAnalysis PreMix 10µL, template 1µL, 0.3 µM HRM-F 0.6µL, 0.3 µM HRM-R 0.6µL, ddH2O 7.8µL; The reaction procedure was as follows: First, a pre-denaturation treatment was performed at 95℃ for 10 min, followed by a cyclic reaction stage. Each cycle consisted of denaturation at 95℃ for 10 s, annealing at 60℃ for 10 s, and extension at 72℃ for 20 s, for a total of 40 cycles. Simultaneously, the instrument was set to maintain the temperature at 65℃ for 1 min and then increase it to 95℃, with each temperature increase being 0.02℃. Fluorescence signals were collected during this process. After the HRM experiment was completed, the experimental results were analyzed using LightCycler 480 software.

Images