Phage therapy for alcohol-associated hepatitis

Abstract

Provided herein are therapeutic agents and compositions for treating infections associated with alcohol-associated hepatitis. Also provided herein are methods of expanding the host range of an Enterococcus faecalis, E. faecalis bacteriophage for the treatment of an alcohol-associated hepatitis associated infection.

Description

priority

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 467,265, filed May 17, 2023, and U.S. Provisional Patent Application No. 63 / 467,525, filed May 18, 2023, the respective priority interests of which are hereby declared and are incorporated herein by reference in their entirety.

[0002] By referencing and incorporating into the sequence list This application contains a sequence list submitted electronically in ST26 format, the entire contents of which are incorporated herein by reference. The ST26 file, created on May 12, 2024, is named 1133117WO1.xml and is 317,597 bytes in size. Technical Field

[0003] This invention generally relates to therapeutic agents and compositions for treating infections associated with alcohol-related hepatitis. Furthermore, this invention relates to *Enterococcus faecalis* (…). Enterococcus faecalis, E. faecalis The host range of bacteriophages as a method for treating alcohol-related hepatitis-associated infections. Background Technology

[0004] Chronic liver disease due to alcohol use disorders significantly increases the global disease burden and mortality (Lozano et al., 2010; Lee et al., 2019; Rehm et al., 2014). Alcoholic liver disease affects millions of people in the United States. Chronic alcoholic liver disease can progress from simple hepatic steatosis to steatohepatitis and cirrhosis, and in 15–40% of patients, it can develop into cirrhosis, an end-stage disease and a leading cause of morbidity and mortality worldwide.

[0005] Alcoholic hepatitis (AH) is a serious and life-threatening alcohol-related liver disease. AH is a distinct entity characterized by cholestasis, jaundice, and liver failure, typically occurring decades after heavy alcohol consumption. Recovery from AH depends on abstinence from alcohol, the presence of mild clinical symptoms, and appropriate treatment. Unfortunately, despite optimal medical management, the mortality rate for patients with severe AH remains as high as approximately 40% to 50%. A significant proportion of patients die from infections, with infection-related mortality rates ranging from 12% to 54%, highlighting the disruption of the intestinal barrier and subsequent bacterial translocation to extraintestinal sites. Summary of the Invention

[0006] Evolved phages that expand the bioactivity of Enterococcus faecalis phages were identified, determined by their host range relative to the well-defined Enterococcus faecalis reference set (EF01-EF16), and the phages were also identified as genetically different from their parental counterparts. For example, the evolved phage Φ2.3N15D5 was found to infect both EF06 and EF15, indicating an expanded range of host infection for Enterococcus faecalis strains.

[0007] This disclosure provides a method for evolving an Enterococcus faecalis phage, comprising infecting one or more Enterococcus faecalis strains with one or more parental phages, and determining whether one or more evolved phages are generated. In some embodiments, infecting one or more Enterococcus faecalis strains with one or more parental phages comprises co-culturing one or more parental phages with one or more Enterococcus faecalis strains. In other embodiments, determining whether one or more evolved phages are generated comprises monitoring the optical density (OD) value of the co-culture. In other embodiments, the method further comprises obtaining the one or more evolved phages, repeatedly infecting one or more Enterococcus faecalis strains with the one or more evolved phages, and determining whether one or more further evolved phages are generated. In some embodiments, determining whether one or more further evolved phages are generated comprises detecting mutations in the sequence of the evolved phage. In a further embodiment, the method comprises detecting one, two, three, four, five, six, seven, eight, nine, ten or more mutations in the sequence of the evolved phage. In other embodiments, determining whether one or more further evolved phages are produced includes detecting mutations in the evolved phage genome sequence encoding tail fibers, endolysins, or single-stranded DNA-binding proteins compared to the parental phage sequence. In a particular embodiment, the mutation includes an amino acid substitution of E to K at position 1287 of the tail fibrin encoded by SEQ ID NO:2, an amino acid substitution of E to K at position 1559 of the tail fibrin encoded by SEQ ID NO:2, an amino acid substitution of V to A at position 226 of the endolysin protein encoded by SEQ ID NO:2, an amino acid substitution of F to S at position 260 of the endolysin protein encoded by SEQ ID NO:2, an amino acid substitution of P to L at position 25 of the single-stranded DNA binding protein encoded by SEQ ID NO:2, an amino acid substitution of N to D at position 83 of the single-stranded DNA binding protein encoded by SEQ ID NO:2, an amino acid substitution of M to T at position 150 of the single-stranded DNA binding protein encoded by SEQ ID NO:2, an amino acid substitution of Q to R at position 240 of the single-stranded DNA binding protein encoded by SEQ ID NO:2, or any combination thereof. In one embodiment, the *Enterococcus faecalis* is cytolysin positive. In one embodiment, the host range of the *Enterococcus faecalis* includes one or more bacteriophages. In one embodiment, the host range of the *Enterococcus faecalis* does not include one or more bacteriophages. In one embodiment, at least one strain is susceptible to infection by the parent bacteriophage.In one embodiment, at least one of the strains is not readily infectable by the parental bacteriophage. In some embodiments, the one or more parental bacteriophages include bacteriophage strains Φ2.3 or Φ2.3N13D5, wherein representative samples of the bacteriophages have been deposited with IDAC accessions 060423-03 and 060423-04, respectively. In other embodiments, the one or more parental bacteriophages include phiEF24C, ECP3, IME-EF1, SAP6, BC611, EfaCPT1, EFDG1, EFLK1, Q69 Phi4D, IME_EF3, PhiFL2B, PhiFL3A, PhiFL3B, PhiFL4A, EFC-1, or any combination thereof.

[0008] Furthermore, isolated phages capable of infecting multiple strains of Enterococcus faecalis, produced by the methods provided herein, are provided, thereby having a wider host range than the one or more parental phages or isolated phages capable of infecting phage-resistant Enterococcus faecalis strains produced by the methods provided herein. In one embodiment, the provided isolated infectious phage comprises SEQ ID NO: 2 or a nucleotide sequence having at least 80%, 82%, 84%, 85%, 86%, 88%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% nucleic acid sequence identity therewith. In some embodiments, the isolated phage contains mutations in its genomic sequence encoding tail fibers, endolysins, or single-stranded DNA-binding proteins compared to the parental phage sequence. In a particular embodiment, the mutation includes an amino acid substitution of E to K at position 1287 of the tail fibrin encoded by SEQ ID NO:2, an amino acid substitution of E to K at position 1559 of the tail fibrin encoded by SEQ ID NO:2, an amino acid substitution of V to A at position 226 of the endosomal protein encoded by SEQ ID NO:2, an amino acid substitution of F to S at position 260 of the endosomal protein encoded by SEQ ID NO:2, an amino acid substitution of P to L at position 25 of the single-stranded DNA binding protein encoded by SEQ ID NO:2, an amino acid substitution of N to D at position 83 of the single-stranded DNA binding protein encoded by SEQ ID NO:2, an amino acid substitution of M to T at position 150 of the single-stranded DNA binding protein encoded by SEQ ID NO:2, an amino acid substitution of Q to R at position 240 of the single-stranded DNA binding protein encoded by SEQ ID NO:2, or any combination thereof. In other embodiments, the isolated bacteriophage comprises bacteriophage strains Φ2.3, Φ2.3N13D5 or bacteriophage strains derived therefrom, wherein representative samples of bacteriophage strains Φ2.3 and Φ2.3N13D5 have been deposited with IDAC accession numbers 060423-03 and 060423-04, respectively.

[0009] This disclosure also provides a method for treating alcoholic hepatitis, NASH, cirrhosis, or liver failure in mammals. The method includes administering an effective amount of a composition to the mammal, the composition comprising one or more inhibitors of Enterococcus faecalis (…). Enterococcus faecalis The composition comprises bacteriophages with specific lytic evolution. In one embodiment, the mammal is a human. In one embodiment, the composition comprises Myotail bacteriophages ( Myoviridae ), Short-tailed bacteriophages ( Podoviridae ), SpounaviridaeOr Longtail Phage Family ( Siphoviridae The bacteriophage or any combination thereof. In one embodiment, one or more of the bacteriophages are isolated from the mammal and optionally amplified prior to administration. In one embodiment, one or more of the bacteriophages have broad host specificity and / or are genetically modified bacteriophages. In one embodiment, after administration of the composition, Enterococcus (…) is monitored. Enterococcus The level of cytolysin or cytolytic enterococci. In one embodiment, a mixture of lysing phages is administered. In one embodiment, the composition is administered orally. In one embodiment, the composition is a tablet. In one embodiment, the composition is a sustained-release formulation. Attached Figure Description

[0010] Figure 1A-1G Phage therapy against cytolytic Enterococcus faecalis alleviates ethanol-induced liver disease in gnotobiotic mice. (AG) C57BL / 6 germ-free mice were colonized with fecal samples from two different patients with cytolytic-positive alcoholic hepatitis. Mice were placed on an isocaloric (control) or chronic alcoholic diet and administered a carrier (PBS) and a control phage against C. crescentus (10 μg / mL) one day prior to alcohol consumption. 10 PFU or a mixture of 3 or 4 different phages targeting cytolytic Enterococcus faecalis (10 10 PFU (Probiotic Fuel) was administered by gavage. (A) Serum ALT levels. (B) Hepatic triglyceride content. (C) Representative Oil Red O stained liver sections. (DF) mRNA levels encoding inflammatory cytokines in the liver. (G) Proportion of cylLS detected in the liver, measured by qPCR (Control diet: Patient #5: C. crescentus phage, n=5; Enterococcus faecalis phage, n=5; Patient #2: C. crescentus phage, n=5; Enterococcus faecalis phage, n=5; Ethanol diet: Patient #5: C. crescentus phage, n=14; Enterococcus faecalis phage, n=16; Patient #2: C. crescentus phage, n=16; Enterococcus faecalis phage, n=15). Scale bar = 100 μm. Results are expressed as mean ± sem (AF). The p-value was determined by one-way ANOVA combined with Tukey's post-hoc test (AF) or Fisher's exact test, followed by the FDR procedure (G). P<0.05, P<0.01, P<0.001.

[0011] Figure 2A-2KIn Atp4a Sl / Sl In mice, bacteriophages reduced the translocation of cytolysin to the liver and alleviated ethanol-induced liver disease. (AK) compared wild-type (WT) and its Atp4a... Sl / Sl Litterctile pups were fed the same caloric diet (control) or a diet for those with chronic alcoholism, and were administered a carrier (PBS) and a control phage against C. crescentus (10) one day before the alcoholism. 10 PFU) or a mixture of three different phages targeting cytolytic Enterococcus faecalis (10 10 PFU) administered by gavage. (A) Serum ALT levels. (B) Hepatic triglyceride content. (C) Representative Oil Red O stained liver sections. (DF) mRNA levels encoding inflammatory cytokines in the liver. (G) Proportion of cylLS detected in the liver, measured by qPCR (control diet: WT mice: PBS, n=7; C. crescentus phage, n=6; Enterococcus faecalis phage, n=5; Atp4a Sl / Sl Mice: PBS, n=6; C. crescentus phage, n=8; Enterococcus faecalis phage, n=7; Ethanol diet: WT mice: PBS, n=14; C. crescentus phage, n=12; Enterococcus faecalis phage, n=13; Atp4a Sl / Sl Mice: PBS, n=15; C. crescentus phage, n=15; Enterococcus faecalis phage, n=15). (H) Fecal CFU of Enterococcus faecalis. (I) Fecal samples were collected and the 16S rRNA gene was sequenced. Principal coordinate analysis based on the Jaccard dissimilarity matrix revealed no significant differences in fecal microbiota among mice given PBS, control phage, or phage targeting cytolytic Enterococcus faecalis in each group (control diet: WT mice: PBS, n=6; C. crescentus phage, n=6; Enterococcus faecalis phage, n=5; Atp4a Sl / Sl Mice: PBS, n=6; C. crescentus phage, n=8; Enterococcus faecalis phage, n=7; Ethanol diet: WT mice: PBS, n=14; C. crescentus phage, n=12; Enterococcus faecalis phage, n=13; Atp4a Sl / SlMice: PBS, n=9; C. crescentus phage, n=9; Enterococcus faecalis phage, n=14. Following ethanol feeding (J and K), serum ethanol levels and hepatic Adh1 and Cyp2e1 mRNA levels did not differ significantly among colonized mice. Scale bar = 100 μm. Results are expressed as mean ± sem (AF, H, J, K). P-values ​​were determined by one-way ANOVA combined with Tukey's post-hoc test (AF, H, J, K), Fisher's exact test, followed by FDR (G) or PERMANOVA, followed by FDR (i). P<0.05, P<0.01, P<0.001.

[0012] Figures 3A-3B Isolation and amplification of bacterial phages from *Enterococcus faecalis* isolated from patients with alcoholic hepatitis. (A) BHI agar plates showing the morphology of bacterial phage plaques. (B) Transmission electron microscopy showing that the isolated bacterial phages were either siphophages (5_2, 5_4, 5_5, 5_6, and 2_6) or myophages (2_1 and 2_8). A specific phage of *Enterococcus faecalis* strains isolated from the feces of cytolysin-positive patients with alcoholic hepatitis was named *Ef*. And the patient number plus a digit (Ef indicates Enterococcus faecalis, (This indicates the bacteriophage; the last digit indicates the isolation order). Transmission electron microscopy images of bacterial bacteriophages 2_1 and 2_8 stained with phosphotungstic acid show their contracted tails. Scale bar = 50 nm.

[0013] Figures 4A-4D Phages targeting *Enterococcus faecalis* alleviated ethanol-induced liver disease in gnotobiotic mice. (AD) C57BL / 6 germ-free mice were colonized with feces from two different patients with cytolysin-positive alcoholic hepatitis. Mice were then fed an isocaloric (control) or chronic alcoholic diet and administered a carrier (PBS) containing a control phage targeting *C. crescentus* (10 μg / mL) one day prior to alcohol consumption. 10 PFU or a mixture of 3 or 4 different phages targeting cytolytic Enterococcus faecalis (10 10(PFU) gavage. (A) Fecal CFU of Enterococcus faecalis. (B) Collection of fecal samples and sequencing of the 16S rRNA gene. Principal coordinate analysis based on the Jaccard dissimilarity matrix revealed no significant difference in fecal microbiota between mice gavaged with either control phage or phage targeting cytolytic Enterococcus faecalis in each group (control diet: Patient #5: C. crescentus phage, n=5; Enterococcus faecalis phage, n=5; Patient #2: C. crescentus phage, n=4; Enterococcus faecalis phage, n=5; ethanol diet: Patient #5: C. crescentus phage, n=14; Enterococcus faecalis phage, n=16; Patient #2: C. crescentus phage, n=16; Enterococcus faecalis phage, n=15). (C and D) Following ethanol feeding, there were no significant differences in serum ethanol levels or hepatic Adh1 and Cyp2e1 mRNA levels among colonized mice. Results are expressed as mean ± sem (A, C, D). P-values ​​were determined by one-way ANOVA combined with Tukey post-hoc test (A, D, D) or PERMANOVA followed by FDR procedure (b). P<0.05.

[0014] Figures 5A-5C Isolation and amplification of bacterial phages targeting non-cytolytic Enterococcus faecalis isolated from patients with alcoholic hepatitis. (A) BHI agar plates showing the morphology of bacterial phage plaques. (B) Transmission electron microscopy showing that the isolated bacterial phages were either short-tailed phages (6_1, 6_2, 6_3, 7_2, 7_3, and 7_4) or long-tailed phages (6_4 and 7_1). The phage specific to non-cytolytic Enterococcus faecalis strains isolated from the feces of cytolysin-negative patients with alcoholic hepatitis was named Ef. And the patient number plus a digit (Ef indicates Enterococcus faecalis, (Represents bacteriophage; the last digit indicates the isolation order). Scale bar = 50 nm. (C) Evolutionary tree of all bacteriophages used in this study.

[0015] Figure 6A-6K Phages targeting non-lysed Enterococcus faecalis did not alleviate ethanol-induced liver disease in gnotobiotic mice. (AK) C57BL / 6 germ-free mice were colonized using fecal samples from two different patients with cytolysin-negative alcoholic hepatitis. Transplanted gnotobiotic mice were fed an isocaloric (control) or chronic alcoholic diet and were given a carrier (PBS) and a control phage targeting C. crescentus (10 μg / mL) one day before alcohol consumption. 10 PFU or a mixture of four different phages targeting non-lytic Enterococcus faecalis (10 10(PFU) administered by gavage. (A) Serum ALT levels. (B) Hepatic triglyceride content. (C) Representative Oil Red O stained liver sections. (DF) mRNA levels encoding inflammatory cytokines in the liver. (G) Proportion of cylLS detected in the liver, measured by qPCR (control diet: patient #6: C. crescentus phage, n=6; Enterococcus faecalis phage, n=6; patient #7: C. crescentus phage, n=5; Enterococcus faecalis phage, n=6; ethanol diet: patient #6: C. crescentus phage, n=14; Enterococcus faecalis phage, n=15; patient #7: C. crescentus phage, n=13; Enterococcus faecalis phage, n=13). (H) Fecal CFU of Enterococcus faecalis. (I) Collection of fecal samples and sequencing of the 16S rRNA gene. Principal coordinate analysis based on the Jaccard dissimilarity matrix revealed no significant differences in fecal microbiota among mice administered either control phage or phage targeting *Enterococcus faecalis* via gavage in each group (control diet: Patient #6: *C. crescentus* phage, n=5; *Enterococcus faecalis* phage, n=6; Patient #7: *C. crescentus* phage, n=4; *Enterococcus faecalis* phage, n=6; ethanol diet: Patient #6: *C. crescentus* phage, n=13; *Enterococcus faecalis* phage, n=14; Patient #7: *C. crescentus* phage, n=13; *Enterococcus faecalis* phage, n=13). Following ethanol feeding (J and K), serum ethanol levels and hepatic Adh1 and Cyp2e1 mRNA levels did not differ significantly among colonized mice. Scale bar = 100 nm. Results are expressed as mean ± sem (AF, H, J, K). The p-value was determined by one-way ANOVA combined with Tukey's post-hoc test (AF, H, J, K) and Fisher's exact test, followed by FDR procedure (G) or PERMANOVA, followed by FDR procedure (i). P<0.0.

[0016] Figure 7 OD over time of a reference set of 16 different clinical Enterococcus faecalis isolates (susceptible and non-susceptible strains) infected with parental bacteriophages. 600 .

[0017] Figure 8 In co-culture, plaque-forming units (PFU / mL) per milliliter.

[0018] Figure 9 The reference set included the susceptibility of 16 different clinical Enterococcus faecalis isolates to evolutionary phages with single mutations.

[0019] Figure 10 Exemplary parental phage sequence (SEQ ID NO: 1). SEQ ID NO: 1 - Genome sequence of Enterococcus faecalis phage Ef2.3 (also known as vB_EfaM_Ef2.3).

[0020] Figure 11 Exemplary evolutionary phage sequence (SEQ ID NO:2). SEQ ID NO:2 - Genome sequence of Enterococcus faecalis phage Ef2.3v1 (also known as Φ2.3N13D5).

[0021] Figure 12 Evolutionary bacteriophage activity against bacterial bacteriophage insensitive mutants (BIM).

[0022] Figure 13 .from Figure 7 The mutations obtained in the evolutionary bacteriophages described in the experiment. Φ2.3N03D5=Ev03, Φ2.3N05D5=Ev05, Φ2.3N06D5=Ev06, Φ2.3N08D5=Ev08, Φ2.3N10D5=Ev10, Φ2.3 N11D5=Ev11, Φ2.3N12D5=Ev12, Φ2.3N13D5=Ev13=Ef2.3v01, Φ2.3N14D5=Ev14 and Φ2.3N15D5=Ev15. (SEQ ID NOS: 14-17).

[0023] Figures 14A-14H (A) A scheme for inserting two or three mutations in Ef2.3. We use the same... Figure 7 Co-culturing was performed using the same method described in [the original text]. (BD) OD over time for a reference set of different clinical Enterococcus faecalis isolates (susceptible strain = EF13 and non-susceptible strains = EF06 and EF12) infected with evolutionary phages with single mutations. 600 (E) in Figure 14B - Plaque-forming units per milliliter (PFU / mL) in the co-cultures described in -D. (F) OD over time for a reference set of clinical Enterococcus faecalis isolates (EF06) infected with a double-mutant evolutionary phage. 600 (G) in Figure 14F The plaque-forming units per milliliter (PFU / mL) in the co-cultures described in (H) reference set are susceptibility of 16 different clinical Enterococcus faecalis isolates to evolutionary phages with double and triple mutations.

[0024] Figure 15 Mutations in evolutionary bacteriophages obtained from the experiments described in Figure 14.

[0025] Figure 16A-16F Comparative analysis of mutations across all evolutionary bacteriophages. (AC) Locations of all mutations in the Ef2.3 gene. (DF) BLAST analysis of these mutations (SEQ ID NOS: 18-35). Detailed Implementation

[0026] The number of patients with chronic liver disease is rapidly increasing—cirrhosis is now the 12th leading cause of death worldwide (Lozano et al., 2012), and more than 50% of cases are associated with chronic alcohol abuse (Rehm et al., 2013). Furthermore, alcohol-related liver disease has recently become a leading cause of liver transplantation in the United States (Lee et al., 2019). The most severe form of alcohol-related liver disease is alcoholic hepatitis; the mortality rate ranges from 20% to 40% within 1–6 months, and up to 75% of patients die within 90 days of diagnosis of severe alcoholic hepatitis (Thursz et al., 2015; Maddrey et al., 1978; Dominguez et al., 2008). Glucocorticoid therapy has limited effectiveness (Thursz et al., 2015), and early liver transplantation is the only curative treatment. However, liver transplantation is only available to specific patient groups in a limited number of centers (Mathurin and Lucey, 2012). Therefore, there remains a need in the field to develop new compositions and approaches to improve outcomes for patients with severe AH.

[0027] This disclosure overcomes the limitations of the prior art by providing novel bacterial phages and compositions and methods for producing and using them. These novel bacterial phages exhibit broader Enterococcus faecalis host specificity and provide protection against clinical isolates of Enterococcus faecalis known to be resistant to these bacterial phages. Therefore, the compositions and methods provided herein contribute to reducing the number of patients dying from AH-related infections.

[0028] This disclosure provides for the first time a bacteriophage capable of infecting clinical isolates of Enterococcus faecalis resistant to ΦEf2.3 infection, and a method for effectively identifying and isolating bacterial bacteriophages (phages) capable of infecting, replicating, and lysing Enterococcus faecalis resistant to ΦEf2.3 infection. This disclosure also provides a method for controlling Enterococcus faecalis infection. The bacterial bacteriophages described herein can precisely edit the gut microbiota and selectively target and eradicate specific bacterial strains, including cytolytic Enterococcus faecalis.

[0029] This disclosure also provides a method for evolving a virus (bacterial phage) virulence against Enterococcus faecalis. The method for evolving a bacterial phage may include, for example, any method capable of producing a bacterial phage with enhanced infectivity against clinical isolates of Enterococcus faecalis sufficient to treat AH-associated bacterial infections. In one embodiment, evolving a bacterial phage virulence against Enterococcus faecalis may include growing the bacterial phage in the presence of one or more clinical isolates of Enterococcus faecalis, causing the bacterial phage to proliferate, and isolating bacterial phage particles from the culture. In a particular embodiment, the method may include monitoring optical density over a period of time, e.g., over 5 days.

[0030] As described in this article, the mutations observed in evolutionary bacteriophages were identified in genomic regions encoding tail fibrin, endosomalin, single-stranded DNA-binding proteins, and combinations thereof. For example, referring to SEQ ID NO:2, such mutations can be further defined as lysine (K) at position 1287 corresponding to amino acid position 1287 of the tail fibrin encoded by SEQ ID NO:2; lysine (K) at position 1559 corresponding to amino acid position 1559 of the tail fibrin encoded by SEQ ID NO:2; alanine (A) at position 226 corresponding to amino acid position 226 of the endosomal protein encoded by SEQ ID NO:2; serine (S) at position 260 corresponding to amino acid position 260 of the endosomal protein encoded by SEQ ID NO:2; leucine (L) at position 25 corresponding to amino acid position 25 of the single-stranded DNA binding protein encoded by SEQ ID NO:2; aspartic acid (D) at position 83 corresponding to amino acid position 83 of the single-stranded DNA binding protein encoded by SEQ ID NO:2; threonine (T) at position 150 corresponding to amino acid position 150 of the single-stranded DNA binding protein encoded by SEQ ID NO:2; arginine (R) at position 240 corresponding to amino acid position 240 of the single-stranded DNA binding protein encoded by SEQ ID NO:2; or any combination thereof. As described herein, such amino acid substitutions are not well known in the art and have been observed to be associated with an expansion of the phage host range.

[0031] Due to the degeneracy of the genetic code, a wide variety of polynucleotide sequences can encode proteins, such as the tail fibroin, endosomalin, and single-stranded DNA-binding proteins disclosed herein. By introducing mutations into polynucleotide sequences encoding parental tail fibroin, endosomalin, and / or single-stranded DNA-binding proteins using methods known in the art, polynucleotide sequences encoding such proteins with the amino acid substitutions described herein can be produced. Those skilled in the art are fully capable of creating alternative polynucleotide sequences encoding the same or substantially the same mutant proteins described herein. These variants or alternative polynucleotide sequences are within the scope of the embodiments described herein.

[0032] The following definitions and methods are provided to better define the invention and to guide those skilled in the art in practicing it. Unless otherwise stated, those skilled in the art should understand the terminology according to its conventional usage.

[0033] definition The use of terms such as "an embodiment" or "implementation" in this specification indicates that the described embodiment may include a particular aspect, property, structure, part, or feature; however, not every embodiment must include that aspect, property, structure, part, or feature. Furthermore, these phrases may, but do not necessarily, refer to the same embodiment mentioned in other parts of this specification. Moreover, when a particular aspect, property, structure, part, or feature is described in connection with an embodiment, whether explicitly described or not, those skilled in the art will understand that such aspects, properties, structures, parts, or features will affect or relate to other embodiments.

[0034] Unless the context clearly specifies otherwise, the singular forms “a,” “an,” and “the” include plural references. Thus, for example, reference to “compound” includes multiple such compounds, therefore compound X includes multiple compounds X. It should also be noted that the claims may be drafted to exclude any optional elements. Therefore, this statement is intended as a premise for the use of exclusive terms (such as “alone,” “only,” etc.) related to any element described herein, and / or for stating a claim element or using a “negative” limitation.

[0035] The term “and / or” refers to any one, combination of, or all of the terms associated with it. Those skilled in the art will readily understand the phrase “one or more,” particularly when read in the context of its use. For example, one or more substitutions on the benzene ring refer to one to five, or one to four, for example, if the benzene ring is disubstituted.

[0036] As used herein, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when items are listed separately, “and / or” or “or” should be interpreted as an inclusive relationship, such as including at least one item, but also more than one of a plurality of items, and optionally, other items not listed. Only terms that explicitly indicate the opposite, such as “only one” or “exactly one”, or “consisting of” as used in the claims, refer to including exactly one element from one or more lists of elements. In general, as used herein, unless an exclusive term such as “either,” “one of,” “only one of,” or “exactly one of” appears preceding, the term “or” should only be interpreted as indicating an exclusive substitution (i.e., “one or the other, but not both”).

[0037] As used herein, the terms “including,” “includes,” “having,” “has,” “with,” or variations thereof are intended to include terms similar to “comprising.”

[0038] The term "about" can refer to a variation of ±5%, ±10%, ±20%, or ±25% of a specified value. For example, in some embodiments, "about 50%" can carry a variation from 45% to 55%. For integer ranges, the term "about" can include one or two integers greater than and / or less than the integer at each end of the range. Unless otherwise expressly stated herein, the term "about" is intended to include values ​​close to the range, such as weight percentages, that are equivalent in function of a single ingredient, composition, or embodiment. The term "about" may also modify the endpoints of the ranges discussed above in this paragraph.

[0039] Throughout this disclosure, various aspects of the invention may be presented in the form of scope. It should be understood that this scope-based description is merely for convenience and brevity and should not be construed as a rigid limitation on the scope of the invention. Therefore, a description of a scope should be considered as specifically disclosing all possible sub-scopes and the individual values ​​within those scopes. For example, a description of a scope such as 1 to 6 should be considered as specifically disclosing sub-scopes such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., and the individual numbers within those scopes, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the scope.

[0040] As used herein, the term "standard" refers to something used for comparison. For example, it can be a known standard reagent or compound that is applied when the test compound is administered and used to compare results, or it can be a standard parameter or function that is measured to obtain a control value when the effect of the reagent or compound on the parameter or function is measured. Standards can also be referred to as "internal standards," such as reagents or compounds added to a sample in a known amount that can be used to determine purification or recovery rates, etc., when processing or purifying or extracting a sample prior to measuring a marker of interest. Internal standards are typically labeled and purified markers of interest, such as those labeled with radioactive isotopes to make them distinguishable from endogenous markers.

[0041] As used herein, in the context of phages or cytolysins, the term "isolated" is intended to mean that the phage or cytolysin is present alone or in combination with other components, but not in its natural environment. As used herein, the term "isolated" is defined as the isolation and identification of an organism from a solution containing a mixed culture of organisms. Organisms capable of isolation may include viruses, bacteria, mammalian cells, etc. Bacterial phages can be isolated as described herein and as known in the art. In one embodiment, general laboratory methods for isolating phages may include, but are not limited to, growth in cultured cells, bacterial phage assays, double agar assays, and plaque assays. This disclosure provides a method for isolating bacterial phages, the method involving infecting one or more strains of Enterococcus faecalis with one or more parental phages; determining whether one or more evolved phages have been produced; and isolating evolved bacterial phages. In some embodiments, evolved phages (e.g., isolated phages produced by the methods described herein) may be further defined as having broad host specificity. As used herein, "broad host specificity," "broader host range," and similar terms refer to bacteriophages that are capable of infecting one or more additional bacterial strains compared to their parent bacteriophage.

[0042] As used herein, the term "virulence" refers to a virus (especially a bacterial phage) capable of infecting, replicating in, and lysing (killing) host cells. The term "temperate" refers to a bacterial phage capable of integrating into the host genome (lysogenicity) or lysing host cells.

[0043] In the context of bacterial bacteriophages, the term "purified" refers to bacteriophages that have undergone any purification process, including but not limited to separation from the environment or culture, such as separation from the culture after propagation and / or amplification, centrifugation, etc., to a measurably increase in concentration, thereby partially, substantially, almost completely or completely removing impurities such as host cells and host cell components.

[0044] As used herein, the term "therapeutic agent" refers to a medicine or agent that can be used to treat, manage, or control one or more symptoms of a disease or condition, such as a bacterial phage or a mixture of bacterial phages.

[0045] As used herein, the terms “treat,” “treatment,” and “treating” refer to the therapeutic benefit achieved in a subject receiving the pharmaceutical composition (e.g., a mammal, such as a human; a companion animal, such as a dog or cat); or a livestock, such as a cow, horse, pig, goat, or chicken). Regarding achieving a therapeutic benefit, the aim is to eliminate, alleviate, or reduce the severity of symptoms or underlying causes (e.g., bacterial infection) associated with a pathological condition or symptom, improve, or slow its progression. A “therapeuticly effective amount” refers to an amount of therapeutic agent (such as a phage mixture pharmaceutical composition) sufficient to achieve at least one therapeutic benefit in a subject receiving the composition. In one embodiment, the compositions, therapeutic agents, or formulations of this disclosure reduce the viability and / or replication capacity of Enterococcus faecalis in mammals by at least about 0.5%, or at least about 1%, or at least about 5%, or at least about 10%, or at least about 15%, or at least about 20%, or at least about 25%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 75%, or at least about 90%, compared to mammals under the same conditions but without treatment.

[0046] As used herein, the terms “prevent,” “prevention,” and “preventing” refer to obtaining a preventive benefit in a subject receiving a pharmaceutical composition. Regarding achieving a preventive benefit, the aim is to delay or prevent symptoms or underlying causes (e.g., bacterial infection) associated with a pathological condition or condition. “Preventive effective amount” refers to an amount of a preventive agent (such as a phage mixture composition) sufficient to achieve at least one preventive benefit in a subject receiving the composition. In some embodiments, the compositions, therapeutic agents, or formulations of this disclosure reduce the translocation of *Enterococcus faecalis* from the intestine to the liver by at least about 0.5%, or at least about 1%, or at least about 5%, or at least about 10%, or at least about 15%, or at least about 20%, or at least about 25%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 75%, or at least about 90%, compared to untreated mammals under the same conditions.

[0047] Diagnostic, predictive and detection methods The presence or amount of Enterococcus faecalis lysin or lysinic Enterococcus faecalis in physiological samples (such as fecal samples) can be used to predict whether a mammal will have a shorter life expectancy, for example, due to the severity of disease in mammals, including liver disease. The presence or amount of Enterococcus faecalis lysin or lysinic Enterococcus faecalis in physiological samples (such as fecal samples) may also help determine whether a mammal has liver failure, whether liver disease is progressing, whether intervention is needed, or whether treatment is effective.

[0048] The presence or amount of Enterococcus faecalis lysin or lysinic Enterococcus faecalis in a physiological sample can be detected by any direct or indirect method. For example, antibodies against lysin can be used to detect the presence or amount of the large or small subunit of Enterococcus faecalis lysin, or both. The presence or amount of Enterococcus faecalis lysin or lysinic Enterococcus faecalis in a physiological sample can be detected by detecting lanethionine. The presence or amount of Enterococcus faecalis lysin or lysinic Enterococcus faecalis in a physiological sample can be detected by detecting RNA encoding the large or small subunit of Enterococcus faecalis lysin, or both, or by detecting genomic DNA encoding the large or small subunit of Enterococcus faecalis lysin, or both. In one embodiment, the method detects Enterococcus faecalis lysin or lysinic Enterococcus faecalis, for example, bacteria found in the human gut, but does not detect lysin from closely related organisms, such as those found in the gut. E. lactis , E. caccae , E. avium , E. canis , E. durans , E. ratti Or other bacterial species.

[0049] In one embodiment, any primer can be used to detect Enterococcus faecalis lysinic nucleic acid, for example, nucleic acid encoding a large or small subunit. In one embodiment, one or more oligonucleotides are used as primers in the nucleic acid amplification reaction. In one embodiment, at least one oligonucleotide has a length of about 5 to about 50, about 10 to about 25, about 15 to about 40, or about 15 to about 25 nucleotides. In one embodiment, at least one oligonucleotide has about 70%, 72%, 75%, 77%, 80%, 82%, 85%, 88%, 89%, 90%, 92%, 95%, 98%, or higher nucleic acid identity with one of GTAAAATAAGTAAAATCAAGAAAACTATTACTC (SEQ ID NO: 10), CAAAAGAAGGACCAACAAGTTCTAATT (SEQ ID NO: 11), CTGTTGCGGCGACAGCT (SEQ ID NO: 12), CCACCAACCCAGCCACAA (SEQ ID NO: 13). Therefore, oligonucleotides within the scope of this disclosure include oligonucleotides having 1, 2, 3, 4, 5 or 6 nucleotide substitutions, which are shorter than one of SEQ ID NO: 10-13, for example, shorter than 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides, or longer, or combinations thereof.

[0050] Treatments can be administered to mammals in which cytolytic Enterococcus faecalis is detected in physiological samples, including phage therapy, to reduce the number of Enterococcus faecalis.

[0051] Phage therapy Bacteriophages, or simply phages, are viruses that infect bacteria and typically have a narrow host range. During bacterial infection, phages can enter two main life cycles—the lysis cycle and the lysogen cycle. Both cycles are initiated by structures on surfaces to which the phage attaches, and are often species- (or even strain-specific). After attachment, the phage injects its genetic material, which can be DNA or RNA. Following injection, the phage can enter several different life cycles, with the lysis and lysogen life cycles being the most common.

[0052] Although all bacteriophages can enter the lysis cycle (virulent bacteriophages), some bacteriophages (temperate bacteriophages) can also enter the lysogenous cycle. The lysis cycle leads to the production of bacteriophage particles; at the end of the cycle, the bacteriophage lysis cassette is expressed; this leads to bacterial lysis and ultimately the release of new mature bacteriophage progeny.

[0053] Naturally occurring lysing phages are known for their antibacterial potential. To utilize bacterial phages as therapeutic agents, naturally occurring bacterial phages capable of lysing / killing Enterococcus faecalis were isolated. Germ-free mice were colonized with feces from patients with acute liver disease (AH). Using a chronic alcoholic liver disease model, personalized medicine targeting Enterococcus faecalis can be used to improve AH. Phage therapy is safe and has been used in numerous clinical trials.

[0054] Exemplary phages that can be used for therapeutic purposes include, but are not limited to, any phage family that infects Enterococcus faecalis and optionally lyses or otherwise reduces its viability and / or replication capacity, such as EFDG1 (Khalifa et al., Appl. Environ. Microbiol., DOI: 10.1128 / AEM.00096.15), φEf11 or variants thereof (see Zhang et al., Microbiology, 159:1023 (2013)), IME-EF1 (Zhang et al., PloS One, doi.org / 10.1371 / journal.pone.0080435), including Myotail Phages ( Myoviridae (Non-enveloped, head-and-tail (neck-in) geometry, genome is linear, double-stranded DNA, approximately 33-244 kb in length), Short-tailed Phage Family ( Podoviridae (Non-enveloped, with icosahedral and head-tail geometry, in which the double-stranded DNA genome is linear and approximately 40-42 kb in length), Long-tailed Phage Family ( Siphoviridae (It is unenveloped, with an icosahedral and head-tail geometry or a flattened capsid; the genome is double-stranded or linear, and about 50 kb in length.)

[0055] The following table lists exemplary phages used in treatment methods:

[0056] Exemplary compositions and treatment methods Therefore, bacteriophages, particularly lysing phages, that possess the ability to infect host bacteria and reduce the population of their host (target) bacteria without affecting other non-target bacterial strains can be used in the compositions and methods described herein. By using a variety of phage isolates or strains with different specificities, the likelihood of resistance to phage combinations is lower. In one embodiment, phages binding to different receptors (e.g., using a mixture of phages) are used to reduce the risk of resistance.

[0057] In this disclosure, selecting lysing phages specifically targeting Enterococcus faecalis reduces the target bacterial population. Therefore, phages can be used to treat conditions associated with Enterococcus faecalis, such as liver diseases. For example, phages can be administered systemically or locally using delivery carriers (such as tablets).

[0058] In one aspect, a composition comprising a phage isolate is used. In another aspect, the composition comprises a phage mixture. In some embodiments, the composition comprises at least two different phage isolates. In another aspect, the composition comprises a phage mixture and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition is formulated for systemic or topical application. In some embodiments, the pharmaceutical composition comprises a sterile buffer, for example, a buffer comprising about 0.05 M Tris-HCl, about 0.1 M NaCl, and about 10 mM MgSO4. In some embodiments, the composition further comprises other agents, for example, agents selected from: antibiotics, anti-inflammatory agents, antiviral agents, local anesthetics, and corticosteroids. In some embodiments, the composition is used to treat bacterial infections, with each phage strain corresponding to 10 3 Up to 10 14 The amount of phage particles present in the composition. In one embodiment, the daily dose may be from 10 3 Up to 10 10 One phage particle, 10 5 Up to 10 10 One phage particle, 10 10 Up to 10 20 One phage particle, 10 15 Up to 10 20 One phage particle or 10 20 Up to 10 25 One phage particle. A daily dose can be administered once or multiple times. In some embodiments, each phage strain corresponds to 10 3 Up to 10 5 One bacteriophage, 10 5 Up to 10 8 One bacteriophage, 10 5 Up to 10 10 One bacteriophage, or 10 7 Up to 10 9 One bacteriophage, or 10 9 Up to 10 11 One bacteriophage, or 10 11 Up to 10 13 The amount of bacteriophage present in the composition. In some embodiments, the subject is a mammal, such as a human. In some embodiments, the treatment comprises administration of a tablet or other orally compatible delivery carrier having the composition.

[0059] In one aspect, a mixture of different phage strains is administered to a person suffering from liver disease (e.g., alcohol-related). The “mixture” may contain at least two different phage isolates, for example, two, three, four, five, six, seven, eight, nine, ten, or more different bacterial phage isolates. The mixture may be used alone or in further combinations with other therapies, such as antibiotics and / or growth factors. In some embodiments, the phage mixture contains at least two, three, four, five, six, seven, eight, nine, ten, or more phage strains. In some embodiments, the phage mixture contains 2-20, 2-15, 2-10, 3-8, or 4-6 phage strains. In other embodiments, in the presence of different bacterial phage strains, the combination does not impair or reduce (or substantially or significantly impair or reduce) the infectivity and / or lytic activity of individual bacterial phages.

[0060] Bacteriophages or mixtures of bacteriophages are incorporated into compositions for the treatment of diseases. Mixtures of different bacteriophage strains or single bacteriophage isolates can be combined with pharmaceutically acceptable carriers, such as excipients or stabilizers, for example, to form tablets. Examples of pharmaceutically acceptable carriers, excipients, or stabilizers include, but are not limited to, buffers such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid; low molecular weight peptides; proteins such as serum albumin and gelatin; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; sugar alcohols such as mannitol or sorbitol; and counterions that form salts, such as sodium.

[0061] Bacteriophage or phage mixture compositions can also be combined with one or more non-phage therapeutic and / or preventative agents for treating and / or preventing bacterial infections, such as those known in the art (e.g., one or more antibiotics). Other therapeutic and / or preventative agents that can be used in combination with phages or phage mixtures include, but are not limited to, antibiotics, anti-inflammatory agents, antiviral agents, and corticosteroids. In some embodiments, phages or phage mixtures are administered in the absence of non-phage-based antibiotics.

[0062] Standard antibiotics that can be used in pharmaceutical compositions containing phage mixtures include, but are not limited to, amikacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, rhodostreptomycin, streptomycin, tobramycin, apramycin, rifamycin, naphthomycin, mupirocin, geldanamycin, ansamitocin, carbacephems, imipenem, meropenem, ertapenem, and faropenem. openem, doripenem, panipenem / betamipron, biapenem, PZ-601, cephalosporins, cefacetrile, cefadroxil, cefalexin, cefaloglycin, cefalonium, cefaloridine, cefalotin, cefapirin, cefatrizine, cefadroxil ( Cefazaflur, cefazedone, cefazolin, cefradine, cefroxadine, ceftezole, cefaclor, cefonicid, cefprozil, cefuroxime, cefzonam, cefmetazole, cefotetan, cefoxitin, cefcapene, cefodazome (c efdaloxime), cefdinir, cefditoren, cefetamet, cefixime, cefmenoxime, cefteram, ceftibuten, ceftiofur, cefiolene, cefizoxime, ceftriaxone, cefoperazone, ceftazidime, latamoxefCefaclidine, cefepime, cefluprenam, cefoselis, cefozopran, cefpirome, cefquinome, flomoxef, ceftobiprole, azithromycin, clarithromycin, dirithromycin, erythromycin, roxithromycin, aztreonam, penicillin and penicillin derivatives, actinomycin, bacitracin, colistin, polymyxin B, cinoxacin, flumequine, nalidixic acid, oxolinic acid, piromidic acid, pipemidic acid (acid), rosoxacin, ciprofloxacin, enoxacin, fleroxacin, lomefloxacin, nadifloxacin, norfloxacin, ofloxacin, pefloxacin, rufloxacin, balafloxacin, gatifloxacin, grepafloxacin, levofloxacin, moxifloxacin, pazufloxacin, sparfloxacin, temafloxacin, tosufloxacin, clinafloxacin, garenoxacin, Jimmy Gemifloxacin, stifloxacin, trovalfloxacin, prulifloxacin, acetazolamide, benzolamide, bumetanide, celecoxib, chlorthalidone, clopamide, dichlorphenamide, dorzolamide, ethoxyzolamide, furosemide, hydrochlorothiazide, indapamide, mafendide, mefruside, metolazone, probenecid, sulfacetamide.Sulfadimethoxine, sulfadoxine, sulfanilamides, sulfamethoxazole, sulfasalazine, sultiame, sumatriptan, xipamide, tetracycline, chlortetracycline, oxytetracycline, doxycycline, lymecycline, meclocycline, methacycli The following are included in combination: minocycline, rolitetracycline, methicillin, nafcillin, oxacilin, cloxacillin, vancomycin, teicoplanin, clindamycin, co-trimoxazole, flucloxacillin, dicloxacillin, ampicillin, amoxicillin, and any combination thereof, in amounts that effectively additively or synergistically enhance the therapeutic effect of a phage-containing composition on a given infection.

[0063] In one embodiment, the composition may typically contain a sterile buffer, such as sterile PBS, water, or saline buffer. A particular buffer contains Tris-HCl, NaCl, and / or MgSO4·7H2O, for example, about 0.05 M Tris-HCl (pH 7.4-7.5), about 0.1 M NaCl, and / or 10 mM MgSO4·7H2O. In other embodiments, the formulation also contains a buffer and 10 mM MgCl2. In other embodiments, the phage-containing formulation also contains a buffer having about 5 mM to about 15 mM CaCl2, for example, about 10 mM CaCl2.

[0064] In some embodiments, the composition is provided in a sealed container.

[0065] In one embodiment, the bacteriophage is formulated into an aqueous solution or a gel. The composition may comprise water; esters, such as isopropyl myristate and isopropyl palmitate; ethers, such as dioctyl ether and isosorbide dimethyl ether; alcohols, such as ethanol and isopropanol; fatty alcohols, such as cetyl alcohol, cetearyl alcohol, stearyl alcohol, and biphenyl alcohol; isoparaffins, such as isooctane, isododecane, and isohexadecane; silicone oils, such as cyclomethicone, dimethicone, dimethicone crosspolymers, polysiloxanes, and their derivatives, for example, organically modified derivatives; polyols, such as propylene glycol, glycerol, butanediol, pentanediol, and hexanediol; or any combination or mixture of the foregoing. The aqueous carrier may include one or more water-miscible solvents, including lower alcohols such as ethanol, isopropanol, etc.

[0066] Formulations / Compositions Bacteriophages or mixtures thereof can be formulated into pharmaceutical compositions and administered to mammalian hosts (such as human patients) in various forms suitable for a chosen route of administration, such as oral or parenteral, intravenous, intramuscular, or subcutaneous routes. In one embodiment, bacteriophages or mixtures thereof may be administered in tablet form.

[0067] In one embodiment, the phage or a mixture thereof can be administered by infusion or injection. Solutions of the phage or mixture thereof can be prepared in water, optionally mixed with a non-toxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycol, glyceryl triacetate, mixtures thereof, and oils. Under normal storage and use conditions, these formulations contain preservatives to prevent microbial growth.

[0068] Suitable drug dosage forms for injection or infusion may include sterile aqueous solutions, dispersions, or sterile powders containing the active ingredient, suitable for immediate preparation of sterile injectable or infusionable solutions or dispersions, optionally encapsulated in liposomes. In all cases, the final dosage form should be sterile, fluid, and stable under the conditions of preparation and storage. Liquid carriers or loading agents may be solvents or liquid dispersion media, including, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), vegetable oils, non-toxic glycerides, and suitable mixtures thereof. Appropriate flowability can be maintained, for example, by forming liposomes, by maintaining the desired particle size in the case of dispersions, or by using surfactants. Microbial action can be prevented by incorporating various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbitol, thimerosal, etc. In many cases, the inclusion of isotonic agents may be useful, such as sugars, buffers, or sodium chloride. The absorption of injectable compositions can be prolonged by using agents that delay absorption, such as aluminum monostearate and gelatin.

[0069] In one implementation, in the presence of different bacterial phage strains, the combination of phages does not impair or reduce (or substantially or significantly impair or reduce) the infectivity and / or lytic activity of individual bacterial phages.

[0070] Bacteriophages or mixtures thereof, optionally combined with another active compound, can be administered parenterally, for example, intravenously, or orally, intraperitoneally, intramuscularly, or subcutaneously. Such administration can be a single bolus injection, multiple injections, or a short- or long-term infusion. An implantable device (e.g., an implantable infusion pump) can also be used to periodically deliver a specific formulation parenterally at equivalent or varying doses over a specific time period. For such parenterial administration, the compound (conjugate or other active agent) can be formulated into a sterile solution in water or other suitable solvents or solvent mixtures. The solution may contain other substances such as salts, sugars (especially glucose or mannitol) to make the solution isotonic with blood, buffers such as acetic acid, citric acid, and / or phosphate and their sodium salts, and preservatives.

[0071] Therefore, bacteriophages or mixtures thereof, or combinations thereof with another active agent, can be administered systemically, for example, orally, in combination with a pharmaceutically acceptable carrier (such as an inert diluent or an absorbable, edible carrier). They can be encapsulated in hard or soft-shell gelatin capsules, compressed into tablets, or directly incorporated into the patient's diet. For oral therapeutic administration, bacteriophages or mixtures thereof are optionally combined with an active compound, which may be combined with one or more excipients, and used in the form of ingestible tablets, lozenges, tablets, capsules, elixirs, suspensions, syrups, wafers, etc. Such compositions and formulations should contain at least 0.1% of the active compound. Of course, the percentage of the composition and formulation can vary and can conveniently be between about 2% by weight and about 60% by weight in a given unit dosage form. In such useful compositions, the amount of the conjugate and optionally other active compounds results in an effective dose level.

[0072] Tablets, lozenges, pills, capsules, etc., may also contain the following: binders, such as tragacanth gum, gum arabic, corn starch, or gelatin; excipients, such as dicalcium hydrogen phosphate; disintegrants, such as corn starch, potato starch, alginic acid, etc.; lubricants, such as magnesium stearate; and sweeteners, such as sucrose, fructose, lactose, or aspartame, or flavorings, such as peppermint, wintergreen oil, or cherry flavoring. When the unit dosage form is a capsule, in addition to the materials of the above types, it may contain a liquid carrier, such as vegetable oil or polyethylene glycol. Various other materials may be present in the form of coatings or otherwise alter the physical form of the solid unit dosage form. For example, gelatin, wax, shellac, or sugar may be used to coat tablets, pills, or capsules. Syrups or elixirs may contain active compounds, sucrose or fructose as sweeteners, methylparaben and propylparaben as preservatives, dyes, and flavorings, such as cherry or orange flavorings. Of course, any material used to prepare any unit dosage form is pharmaceutically acceptable and substantially non-toxic in the amount used. Furthermore, bacteriophages or mixtures thereof, optionally combined with another active compound, can be incorporated into sustained-release formulations and devices.

[0073] Bacteriophages or mixtures thereof may optionally be combined with another active compound, and may also be administered intravenously or intraperitoneally by infusion or injection. Solutions of bacteriophages or mixtures thereof, optionally combined with another active compound or its salts, may be prepared in water, optionally mixed with a non-toxic surfactant. Dispersions may also be prepared in glycerol, liquid polyethylene glycol, glyceryl triacetate, mixtures thereof, and oils. Under normal storage and use conditions, these formulations contain preservatives to prevent microbial growth.

[0074] Suitable drug dosage forms for injection or infusion may include sterile aqueous solutions, dispersions, or sterile powders containing the active ingredient, suitable for immediate preparation of sterile injectable or infusionable solutions or dispersions, optionally encapsulated in liposomes. In all cases, the final dosage form should be sterile, fluid, and stable under the conditions of preparation and storage. Liquid carriers or loading agents may be solvents or liquid dispersion media, including, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), vegetable oils, non-toxic glycerides, and suitable mixtures thereof. Appropriate flowability can be maintained, for example, by forming liposomes, by maintaining the desired particle size in the case of dispersions, or by using surfactants. Microbial action can be prevented by incorporating various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbitol, thimerosal, etc. In many cases, the inclusion of isotonic agents may be useful, such as sugars, buffers, or sodium chloride. The absorption of injectable compositions can be prolonged by using agents that delay absorption, such as aluminum monostearate and gelatin.

[0075] Preservation Information Representative bacterial phages of each of the strains Φ2.3 and Φ2.3N13D5 (Φ2.3v1) disclosed above and referenced in the claims have been deposited at the NRRL Culture Collection (USDA NRRL Agricultural Research Culture Collection, 1815 N. University St., Peoria, IL 61604). The deposit date is April 6, 2023. Following patent publication, all restrictions on the deposit will be removed, and the deposit is intended to meet all requirements of 37 CFR §1.801-1.809. The accession numbers for the deposited strains are IDAC accession numbers 060423-03 and 060423-04, respectively. The deposit will be held at the collection for 30 years, or 5 years after the last request, or the entire term of the patent, whichever is longer, during which time the material may be replaced if necessary.

[0076] Example The following embodiments are intended to illustrate implementation of the present invention. Those skilled in the art will recognize that the techniques disclosed in the following embodiments represent techniques discovered by the inventors that work well in the practice of the present invention, and therefore can be considered as exemplary patterns constituting its practice. However, based on this disclosure, those skilled in the art will understand that many changes can be made to the specific embodiments disclosed without departing from the spirit and scope of the invention, and similar or related results can still be obtained.

[0077] Example 1 Materials and methods for studying microorganisms and microbial factors that contribute to the progression of alcoholic liver disease. Patient cohort Twenty-six participants without alcohol use disorder (controls), 44 participants with alcohol use disorder, and 88 patients with alcoholic hepatitis were evaluated. Patients with alcohol dependence and voluntary drinking (self-reported >60 g / day) meeting the DSM IV criteria (Ball et al., 1997) were recruited at a clinic with an alcohol treatment program and compared with individuals without alcohol dependence (non-alcohol controls; social drinking less than 20 g / day). Non-alcohol controls and participants with alcohol use disorder had not taken antibiotics or immunosuppressive drugs within the two months prior to enrollment. Other exclusion criteria included diabetes, inflammatory bowel disease, known liver disease of any other cause, and clinically significant cardiovascular, pulmonary, or renal complications. Patients with alcoholic hepatitis were recruited from 12 participating centers in the InTeam consortium (ClinicalTrials.gov identifier: NCT02075918) in the United States, Mexico, Canada, the United Kingdom, France, and Spain. Inclusion criteria were: 1. Age > 18 years and ≤ 70 years; 2. Active alcohol abuse within the past 3 months (men > 50 g / day and women > 40 g / day); 3. Aspartate aminotransferase (AST) > alanine aminotransferase (ALT) and total cholesterol > 3 mg / dL within the past 3 months; 4. Liver biopsy and / or clinical presentation consistent with alcoholic hepatitis. Exclusion criteria were: 1. Autoimmune liver disease (ANA > 1 / 320); 2. Chronic viral hepatitis; 3. Hepatocellular carcinoma; 4. Total portal vein thrombosis; 5. Extrahepatic end-stage disease; 6. Pregnancy; and 7. Failure to obtain informed consent (Brandl et al., 2018). In all patients, clinical presentation was consistent with alcoholic hepatitis, and in patients who underwent liver biopsy, histological findings were consistent with the diagnosis of alcoholic hepatitis. For the three patients who received liver transplants, the transplant date was considered the date of death. Baseline characteristics of the alcoholic hepatitis cohort are shown in Figures 18A-B. Fecal 16S rRNA sequencing, enterococcal culture, and qPCR targeting cytolysin were performed. MELD scores were calculated for all patients based on available bilirubin, INR, and creatinine levels. The protocol was approved by the ethics committees of each participating center, and patients were enrolled after obtaining written informed consent from each patient.

[0078] mice C57BL / 6 mice were purchased from Charles River. C57BL / 6 germ-free mice were bred at UCSD. Sublytic variants in the C57BL / 6 background have been described. Atp4a Sl / Sl Mice (Llorente et al., 2017; Krieg et al., 2011), heterozygous mice were used for breeding; sub-soluble mice were used. Atp4a Sl / Sl Litter mice and their wild-type littermates.

[0079] Female and male mice (9–12 weeks old) were placed in a chronic alcoholism diet (NIAAA model), as described (Bertola et al., 2013). Mice were fed Lieber-DeCarli diets with 0% ethanol calorie intake from day 1 to day 5, and 36% from day 6 to the end of the study. On day 16, mice were given a single dose of ethanol (5 g / kg body weight) by gavage in the early morning and sacrificed 9 hours later. Paired control mice received a calorie-replacing diet of glucose and other sources.

[0080] Fecal samples from patients with alcoholic hepatitis were used for fecal transplantation in germ-free mice. Starting at 5–6 weeks of age, mice were administered 100 μl of fecal sample via gavage (1 g of feces dissolved in 30 ml of Luria-Bertani (LB) medium containing 15% glycerol under anaerobic conditions), and this was repeated after two weeks. Two weeks after the second gavage, mice were placed on either an ethanol or control (isocaloric) diet.

[0081] In the study of cytolysin activity, mice were administered 5 × 10⁵ ethanol via gavage every three days from day 6 to day 15 of ethanol feeding (see above). 8 The study used cytolysin-containing *Enterococcus faecalis* strains with colony-forming units (CFU) of 10,000 (FA2-2 (pAM714)), cytolysin-deficient non-cytolysin *Enterococcus faecalis* strains (FA2-2 (pAM771)) (Ike et al., 1990) (E. faecalis Dcytolysin), or PBS (load control). To determine the therapeutic effect of bacterial phages, mice were administered 10,000 mg / L PBS via gavage 24 hours before alcohol consumption (day 16). 10 Enterococcus faecalis phage with plaque-forming units (PFU) (or C. crescentus phage phiCbK as a control) (Gill et al., 2012). All animal studies were reviewed and approved by the Laboratory Animal Use and Management Committee at the University of California, San Diego.

[0082] Isolation and purification of bacterial bacteriophages Enterococcus faecalis strains were isolated from mouse feces using a previous method (Llorente et al., 2017), and Enterococcus faecalis strains were isolated from human fecal samples using the method described below. All Enterococcus faecalis strains were statically cultured at 37°C in brain-heart infusion (BHI) broth or on BHI agar. C. crescentus phage phiCbK was purified as previously described (Gill et al., 2012).

[0083] Enterococcus faecalis phages were isolated from untreated raw wastewater obtained from the North City Water Recycling Plant in San Diego, California. Fifty mL of raw wastewater was centrifuged at 8,000 x g for 1 minute at room temperature (RT) to form large particles. The supernatant was passed through a 0.45 μm filter, then through a 0.2 μm syringe filter (Whatman, PES membrane). One hundred μL of clarified wastewater was mixed with 100 μL of overnight Enterococcus faecalis culture, then added to BHI broth top agar (0.5% agar) and poured onto BHI plates (1.5% agar). After incubation overnight at 37°C, the resulting plaques were recovered using a sterile pipette tip in 500 μL of PBS. The phages were inoculated three times on Enterococcus faecalis to ensure they were clonal isolates.

[0084] High-titer phage stocks were propagated by infecting 200 ml of exponentially growing *Enterococcus faecalis* in BHI broth containing 10 mM MgSO4 at a multiple of infection (MOI) of 0.1. Lysis was initiated by shaking at 37°C for up to six hours. The lysate was centrifuged at 10,000 x g for 20 min at RT to remove residual bacterial cells and debris. The supernatant was then vacuum filtered through a 0.2 μm membrane filter and maintained at 4°C until use.

[0085] Prior to gavage administration to mice, 10–20 mL of the lysate was concentrated to approximately 1 mL using a Corning Spin-X UF concentrator with a molecular weight cutoff (MWCO0) of 100,000. After concentration, the culture medium was replaced with PBS by perfiltration. The resulting lysate was further concentrated to a final volume of 0.5 mL and adjusted to the desired PFU level.

[0086] Whole genome sequencing of bacterial bacteriophages Ten mL of lysate was treated with 10 μg / mL DNase and RNase at 37°C for 1 hour. Phages were precipitated by adding 1 M NaCl and 10% (w / v) polyethylene glycol 8000 (PEG 8000) and incubated overnight at 4°C. The precipitated phages were then centrifuged at 10,000 xg for 10 minutes at 4°C to form clumps, and resuspended in 500 μL of resuspension buffer (5 mM MgSO4). Phage DNA was then extracted using the Promega Wizard DNA Clean-up Kit (Promega).

[0087] electron microscope Bacteriophage morphology was examined using transmission electron microscopy on negatively stained grids prepared with 2% uranyl acetate via the Valentine method (Valentine et al., 1968), and the examination was performed in a JEOL 1200 EX with an accelerating voltage of 100 kV. Phosphotungstic acid was used to confirm the contractile tail of myophage. Transmission electron microscopy was performed at the Microscopy and Imaging Center of Texas A&M University.

[0088] Bacterial DNA extraction and 16S rRNA sequencing As previously described (Llorente et al., 2017), DNA was extracted from human fecal samples, mouse liver sections, or bacterial cultures, and DNA was extracted from mouse feces using the QIAamp Fast DNA Fecal Kit (QIAGEN). 16S ribosomal RNA (rRNA) gene sequencing was performed as described (Llorente et al., 2017).

[0089] Real-time quantitative PCR Bacterial genomic DNA was extracted from human fecal samples and mouse liver (Llorente et al., 2017). RNA was extracted from mouse liver and cDNA was generated (Llorente et al., 2017). Primer sequences targeting mouse genes were obtained from NIH qPrimerDepot. The E. faecalis 16S rRNA gene and E. faecalis cylL gene have been previously described. S and cylL L Primer sequences for the genes were determined (Ryu et al., 2013; Haas et al., 2002). Mouse gene expression and bacterial gene amplification were determined using the ABI StepOnePlus real-time PCR system with Sybr Green (Bio-Rad Laboratories). qPCR values ​​for mouse genes were normalized to 18S.

[0090] Enterococcus faecalis whole genome sequencing To isolate Enterococcus faecalis strains from human subjects, 50–300 mg of human feces were resuspended in 500 μl of PBS, serially diluted, and 100 μl was placed on plates containing the selective medium BBL Enterococcus broth (Becton Dickinson). Enterococcus colonies were identified by the dark brown or black color produced by the hydrolysis of esculin to esculetin, which reacts with ferric ammonium citrate. Each Enterococcus colony was then picked, and qPCR was performed using primers specific to the E. faecalis 16S rRNA gene to identify Enterococcus faecalis (Ryu et al., 2013). For each subject, 1–6 Enterococcus faecalis colonies were analyzed, and bacterial genomic DNA was extracted as described in the previous section. DNA sequencing was performed on an Illumina HiSeq X, producing paired end reads (2 x 151 bp). The bacterial genome was assembled and annotated using the pipeline described previously (Page et al., 2016). For the phylogenetic tree of *Enterococcus faecalis*, the genome assemblies of British clinical isolates (Raven et al., 2016) were merged with those of the isolates in this study, annotated using Prokka (Seemann, 2014), and the pan-genome was estimated using Roary (Page et al., 2016). Core genes were defined as those present in 99% of isolates using a 95% identity cutoff. Maximum likelihood trees of SNPs in the core genes were constructed using RaxML (Stamatakis, 2014) and a 100-guideline program. The resulting trees were visualized using Microreact (Argimon et al., 2016).

[0091] Culture of Enterococcus faecalis All Enterococcus faecalis strains were statically cultured at 37°C on Brain Heart Infusion (BHI) broth or BHI agar plates. Erythromycin was used at 50 μg / ml.

[0092] Fecal Enterococcus Level Measurement To determine the levels of fecal enterococci in mice, 10–30 mg of mouse feces were resuspended in 500 μl PBS and serially diluted. Five μL of each dilution from each sample was spotted onto plates containing the selective medium BBL Enterococcal Broth (Becton Dickinson). Enterococcal colonies were identified by the dark brown or black color produced by the hydrolysis of esculin to esculetin, which reacts with ferric ammonium citrate. The number of colonies for each sample was then counted, and CFU were calculated.

[0093] Expression and purification of cytolysin To purify bioactive CylLL "and CylL S Using E. coli ( E. coli Heterologous expression system. In short, Hisx6-CylL... L Or Hisx6-CylL S CylM (an enzyme that dehydrates and cyclizes cytolysin) was co-expressed in *E. coli* to produce a fully dehydrated and cyclized full-length peptide. The His tag and leader peptide were then cleaved using recombinant CylA (27-412), a soluble domain of the native peptidase used in cytolysin maturation, to produce the biologically active CylL. L "or CylL" S The obtained core peptide was further purified by reversed-phase HPLC.

[0094] cylL L and cylL S The gene had previously been cloned into the pRSFDuet-1 backbone vector in MCSI, which contains the cylM gene in MCSI (Tang and van der Donk, 2013). CylA (27-412) genes had previously been cloned into the MCSI of the pRSFDuet-1 backbone vector (Tang et al., 2018). Chemical transformation with 100 ng of KCM was performed. cylL L _cylM: pRSFDuet、 cylL S _cylM: pRSFDuet or cylA (27 - 412): pRSFDuet plasmid transformation E. coli BL21 Star™ (DE3) cells (50 µl). Cells were seeded on LB agar plates supplemented with kanamycin (50 µg / ml) and incubated overnight at 37°C. One colony was picked and inoculated into 15 mL of LB broth supplemented with kanamycin at 37°C and incubated overnight. The culture was then used to inoculate 1.5 liters of terrific broth supplemented with kanamycin. The culture was incubated with shaking at 37°C until OD (dose elapsed). 600 The concentration was set to 0.8. The incubator temperature was lowered to 18°C, and isopropyl β-D-thiogalactoside was added to a final concentration of 0.3 mM to induce expression. The culture was incubated at 18°C ​​for 18 hours. Cells were collected by centrifugation at 5000 xg for 12 minutes. The cell paste was collected and frozen at -70°C.

[0095] To purify the protease CylA (27-412), the cell paste was thawed and resuspended in 50 ml LanP buffer (20 mM HEPES, 1 M NaCl, pH 7.5). The cell suspension was lysed by homogenization. The lysate was clarified by centrifugation at 13,000 xg for 45 min and filtered through a 0.45 µm centrifuge filter (Thermo Scientific). The clarified lysate was loaded onto a pre-equilibrated HisTrap HP 5 ml column (GE Healthcare) using a peristaltic pump. The column was connected to an ÄKTA pure25 M system. The protein was eluted using a linear gradient of LanP buffer and elution buffer (20 mM HEPES, 1 M NaCl, 500 mM imidazole, 10% glycerol, pH 7.5). The purest fractions, determined by 4%–20% SDS-PAGE, were pooled, concentrated to 1 mg / mL using an Amicon ultracentrifuge filter (30 kDa MWCO), and the buffer was exchanged for stock buffer (20 mM HEPES, 300 mM KCl, 10% glycerol, pH 7.5) using a PD-10 desalting column (GE Healthcare). Protein concentration was determined by absorbance at 280 nm.

[0096] In order to purify CylL L and CylL SPeptides were used to thaw the cell paste and resuspend it in 50 ml of LanA buffer B1 (6 M guanidine hydrochloride, 20 mM NaH2PO4, 500 mM NaCl, 0.5 mM imidazole, pH 7.5). The cell suspension was lysed by sonication (pulse on for 2 sec, pulse off for 5 sec, total pulse on time 7 min). The cell lysate was clarified by centrifugation at 13,000 xg for 45 min. The clarified cell lysate was filtered through a 0.45 µm centrifuge filter and loaded by gravity flow into a pre-equilibrated 2 ml bed volume of His60 Ni Superflow Resin (Clonetech). After loading the lysate, the resin was washed with 15 ml of LanA buffer B2 (4 M guanidine hydrochloride, 20 mM NaH2PO4, 500 mM NaCl, 30 mM imidazole, pH 7.5). The resin was washed again with 15 ml of LanA washing buffer (20 mM NaH2PO4, 500 mM NaCl, 30 mM imidazole, pH 7.5) to remove guanidine hydrochloride. The peptide was washed with 10 ml of LanA elution buffer (20 mM NaH2PO4, 500 mM NaCl, 500 mM imidazole, pH 7.5). A final concentration of 0.02 mg / ml of CylA (27-412) was added to the elution fraction, and the mixture was incubated overnight at room temperature to remove the leader peptide.

[0097] Digestion was quenched by adding 2% (v / v) trifluoroacetic acid to a final concentration. The solution was centrifuged at 4500 xg for 10 min and filtered through a 0.45 µm syringe filter (Thermo Scientific). The core peptide was purified by semi-preparative reversed-phase HPLC using a Phenomenex Jupiter Proteo column (10 mm x 250 mm, 4 µm, 90 Å) connected to an Agilent 1260 Infinity II HPLC system. The peptide was separated using a linear gradient of solution A (water + 0.1% trifluoroacetic acid) containing 3% (v / v) solution B (acetonitrile + 0.1% trifluoroacetic acid). The fraction was spotted onto a MALDI target plate by mixing 1 µl of the sample with 1 µl of 25 mg / mL Super-DHB (Sigma) in 80% acetonitrile / water + 0.1% trifluoroacetic acid. The fractions were analyzed by MALDI-TOF MS on a Bruker UltrafleXtreme MALDI-TOF / TOF operating in positive ionization and reflection modes.

[0098] Primary mouse hepatocytes Hepatocytes were isolated from female C57BL / 6 mice fed a chronic alcoholism diet (NIAAA model) (Bertola et al., 2013). The livers were perfused in situ with a calcium-free salt solution containing 0.5 mM EGTA, followed by perfusion with a solution containing 0.02% (w / v) collagenase D (Roche Applied Science). The livers were then carefully minced and filtered through a 70 μm nylon cell filter. After washing three times, the hepatocytes were centrifuged at 50 x g for 1 minute. Hepatocyte viability was assessed using trypan blue (Thermo Fisher Scientific). 1.5 × 10⁶ cells were... 5 Hepatocytes were seeded in 12-well DMEM-F12 (Thermo Fisher Scientific) plates coated with rat type I collagen, containing insulin-transferrin-selenium (1% v / v) (Thermo Fisher Scientific) and 40 ng / ml dexamethasone (MP Biomedicals), along with 10% (v / v) fetal bovine serum (FBS; Gemini Bio-Products) and antibiotics. After 4 hours, the cultures were washed with DMEM-F12 medium and replaced with the same supplemental medium without FBS (Iwaisako et al., 2012). Then, after 16 hours, the hepatocytes were cultured with 0 or 25 mM ethanol and in the same FBS-free medium with 0, 200, or 400 nM CylL. S "and / or CylL L "Stimulation. After 3 hours of stimulation, hepatocyte cytotoxicity was assessed using the Pierce LDH Cytotoxicity Assay Kit (Thermo Fisher Scientific). After 6 hours of stimulation, hepatocyte viability was determined by incubation in DMEM-F12 medium containing 10% (v / v) FBS with 0.3 mg / ml 3-(4,5-dimethylthiazolyl-2-yl)-2,5'-diphenyltetrazolium bromide solution (MTT; Sigma-Aldrich) at 37°C for 1 hour. The medium was then removed, and dimethyl sulfoxide (Sigma-Aldrich) was added to dissolve formazan. Formazan concentration was determined by absorbance at 550 nm, and the survival percentage was calculated accordingly (hepatocytes not stimulated with cytolysin peptides were set as 100% viable).

[0099] Biochemical analysis Serum ALT levels were determined using the Infinity ALT kit (Thermo Scientific). Liver triglyceride levels were measured using the Triglyceride Liquid Kit (Pointe Scientific). Serum LPS and fecal albumin levels were determined using ELISA kits (Lifeome Biolabs and Bethyl Labs, respectively). Serum ethanol levels were measured using the Ethanol Assay Kit (BioVision).

[0100] Staining procedure To measure lipid accumulation, liver sections were embedded in an OCT complex. 8 μm frozen sections were then cut and stained with Oil Red O (Sigma-Aldrich). Representative images of each group of mice are shown in the respective figures.

[0101] Statistical analysis Results are expressed as mean ± sem (unless otherwise stated). Univariate Cox regression analysis was used to detect the association between cytolysin and MELD with overall mortality. Univariate logistic regression analysis was performed on laboratory and clinical parameters associated with cytolysin. Multivariate logistic regression models were performed, controlling for MELD and platelet count. Multicollinearity was tested using the variance inflation factor (VIF). Kaplan-Meier curves were used to compare survival between patients with cytolysin-positive and cytolysin-negative alcoholic hepatitis. The Kruskal-Wallis test combined with the Dunn post-hoc test was used to compare fecal Enterococcus faecalis, bacterial diversity, and abundance in controls and patients. Fisher's exact test was used, followed by the false discovery rate (FDR) procedure to compare the percentage of subjects with positive fecal Enterococcus faecalis and cytolysin in fecal samples. The Jaccard dissimilarity matrix was used for principal coordinate analysis (PCoA), p-values ​​were determined by permutation multivariate ANOVA, and multiple comparisons were corrected using the FDR procedure.

[0102] For mouse and cell culture studies, one-way or two-way ANOVA combined with Tukey's post-hoc test was used to evaluate the significance of multiple groups. Fisher's exact test was applied to liver cylL. SAnalysis. Fisher's exact test p-values ​​were corrected using the Free Decision Model (FDR) to correct for multiple comparisons. Kaplan-Meier curves were used to compare survival between mouse groups. PCoA based on the Jaccard dissimilarity matrix was performed between mouse groups, p-values ​​were determined by PermanoVA, and then FDR was performed to correct for multiple comparisons. Statistical analysis was performed using R statistical software (R version 3.5.1, 2018 the R Foundation for Statistical Computing) and GraphPad Prism v6.01. A p-value < 0.05 was considered statistically significant.

[0103] Example 2 Investigating the mechanism of cytolysin-related liver injury Alcohol-associated liver disease can be transmitted via fecal microbiota. Colonization of germ-free mice with feces from patients with alcoholic hepatitis exacerbates ethanol-induced liver disease compared to colonization with feces from conventionally colonized mice (Llopis et al., 2016). The microorganisms and microbial factors contributing to this transmissible phenotype and the progression of alcohol-associated liver disease need to be investigated.

[0104] To determine whether chronic alcohol consumption and alcoholic hepatitis are associated with alterations in gut microbiota composition, changes in fecal microbiota were analyzed using 16S ribosomal RNA (rRNA) gene sequencing. The fecal microbiota composition of patients with alcohol use disorder or alcoholic hepatitis was altered compared to subjects without alcohol use disorder (controls). A significant change was observed in the composition of Enterococcus spp. (…). Enterococcus The proportion of fecal bacteria (SPP) increases. In patients with alcoholic hepatitis, approximately 5% of fecal bacteria are Enterococcus spp. Enterococcus Enterococci (spp.) were present in fecal samples from patients with alcohol use disorder, but were almost absent in those with alcohol use disorder or in the control group. Enterococci (spp.) were measured by quantitative PCR (qPCR) in fecal samples from patients with alcoholic hepatitis. E. faecalis The proportion of Enterococcus faecalis was approximately 2700 times that of the control group, consistent with 26S rRNA sequencing results. However, the proportion of Enterococcus faecalis was not associated with the severity of disease in patients with alcoholic hepatitis (data not shown).

[0105] Through an unknown mechanism, *Enterococcus faecalis* colonization in mice induces mild hepatic steatosis and exacerbates ethanol-induced liver disease (Lorente et al., 2017). Cytolysin is a bacterial exotoxin or bacteriocin produced by *Enterococcus faecalis* (Huycke et al., 1991) containing two post-translational modified peptides, CylL... L "and CylL S(Tang and van der Donk, 2013). Cytolysins not only have lytic activity against Gram-positive bacteria but also against eukaryotic cells (Cox et al., 2005). cylL was detected in fecal samples from 30% of patients with alcoholic hepatitis by qPCR. L and cylL S Genomic DNA (cytolysin positive); no cytolysin positive control stool samples were found, and only one sample from a patient with alcohol use disorder (out of a total of 38) was cytolysin positive. After this patient participated in a physician-supervised abstinence program, the cytolysin in their stool sample became negative (not shown). Importantly, 78% of patients with cytolysin-positive alcoholic hepatitis died within 180 days of admission.

[0106] The correlation between fecal cytolysin detection and the following laboratory and clinical parameters was examined using univariate logistic regression: international normalized ratio (INR), platelet count, MELD (Medium-End-Stage Liver Disease) score, MELD sodium (MELDNa) ​​score, and mortality. Cytolysin detection was associated with overall mortality in patients with alcoholic hepatitis, with a hazard ratio of 22.24 (95% CI, 5.136–96.3). P =3e–09), while the hazard ratio for the MELD score used to predict mortality in clinical practice was 1.068 (95% CI, 1.009–1.13); P =0.02). When we performed receiver operating characteristic (ROC) curve analysis, the area under the curve (AUC) for MELD was 0.7, while the AUC for cytolysin detection was 0.81. Whole-genome sequencing of 148 Enterococcus faecalis isolates revealed phylogenetic diversity of cytolysin-positive Enterococcus faecalis in patients with alcohol-related hepatitis. Based on our findings, cytolysin detection is a prognostic factor for worsening liver-related outcomes and death.

[0107] To determine whether cytolysin contributes to Enterococcus faecalis-mediated liver injury, mice were administered either an isogenetic Enterococcus faecalis strain (FA2-2 (pAM714)) or a cytolysin-deficient Enterococcus faecalis strain (FA2-2 (pAM771)) by gavage (Ike et al., 1990) (non-cytolysin); the mice were then placed on a chronic alcoholic diet (Bertola et al., 2013). Mice fed ethanol after colonization with Enterococcus faecalis showed more severe liver injury, characterized by higher alanine aminotransferase (ALT) levels and hepatic steatosis, compared to mice given phosphate-buffered saline (PBS). Mice fed ethanol after colonization with Enterococcus faecalis also exhibited greater liver inflammation, encoding inflammatory cytokines and chemokines, compared to mice given PBS. Il1b , Cxcl1 and Cxcl2 The mRNA expression level of ) was higher. Compared with mice colonized with cytolytic Enterococcus faecalis and then fed ethanol, mice colonized with non-cytolytic Enterococcus faecalis and then fed ethanol showed significantly reduced ethanol-induced liver injury, steatosis, and inflammation, and had longer survival time.

[0108] To investigate the mechanism of cytolysin-related liver injury, we measured cytolysin levels in the liver. Following chronic ethanol administration, cytolysin was measured in the livers of mice colonized with *Enterococcus faecalis*. CylL S A significant increase was observed, but not in mice not given Enterococcus faecalis or mice colonized with non-cytolytic Enterococcus faecalis. Cytolysin was not detected in the livers of mice fed an isocaloric (control) diet, indicating that ethanol-induced changes in the intestinal barrier are necessary for the translocation of cytolytic Enterococcus faecalis from the intestine to the liver. Increased intestinal permeability was observed in ethanol-fed mice compared to mice fed an isocaloric diet, but no significant difference was observed between mice not given Enterococcus faecalis and mice colonized with cytolytic or non-cytolytic Enterococcus faecalis after chronic ethanol administration, suggesting that cytolysin does not affect intestinal barrier function.

[0109] Based on 16S rRNA gene sequencing, colonization of mice with either lysed or non-lysed Enterococcus faecalis did not significantly alter the composition of the gut microbiota. This was based on serum ethanol levels and liver... Adh1 or Cyp2e1 The mRNA levels (encoding enzymes that metabolize ethanol in the liver) of *Enterococcus faecalis* did not affect the intestinal absorption or hepatic metabolism of ethanol. These results suggest that *Enterococcus faecalis* producing cytolysin promotes ethanol-induced liver disease in mice.

[0110] Germ-free mice were colonized with feces from patients with cytolysin-negative and cytolysin-positive alcoholic hepatitis. Consistent with findings from mice colonized with Enterococcus faecalis, cytosin C57BL / 6 mice colonized with feces from two different cytolysin-positive patients exhibited more severe ethanol-induced liver injury, steatosis, and inflammation compared to mice given feces from two different cytolysin-negative patients. Fecal transplantation from cytolysin-positive patients after ethanol administration shortened mouse survival and increased the translocation of Enterococcus faecalis to the liver. According to 16S rRNA gene sequencing, there was no difference in gut microbiota composition between mice colonized with feces from cytolysin-positive or cytolysin-negative alcoholic hepatitis donors after a control diet. Mice transplanted with feces from a cytolysin-positive alcoholic hepatitis patient (#2) showed a significantly different microbiota from other mouse groups after ethanol administration. Mice fed ethanol with feces from cytolysin-positive patients showed higher levels of Enterococcus in their feces than those from cytolysin-negative patients, but no significant difference was observed when they were fed a control diet. Interestingly, fecal samples from donors of cytolysin-positive Enterococcus faecalis appeared to be devoid of cytolysin-negative Enterococcus faecalis. Mice colonized with feces from cytolysin-positive patients showed no difference in intestinal absorption or hepatic metabolism of ethanol compared to mice colonized with feces from cytolysin-negative patients. These results further provide evidence that cytolysin promotes ethanol-induced liver disease.

[0111] To determine the mechanism by which cytolysin increases liver disease, we isolated hepatocytes from mice fed ethanol or a control diet and used purified bioactive cytolysin peptide (CylL) to treat the liver disease. L and CylL S (Tang and van der Donk, 2013). Incubation of primary mouse hepatocytes with two cytolysin subunits resulted in a dose-dependent increase in cell death compared to incubation with a carrier or with a single subunit alone. Interestingly, when hepatocytes were isolated from ethanol-fed mice and then incubated with ethanol, no increase in cytolysin-induced cell death was observed compared to hepatocytes isolated from control-diet mice. The cytotoxic effect of cytolysin may be mediated by pore formation, leading to cell lysis (Van Tyne et al., 2013). These results suggest that ethanol-related intestinal barrier dysfunction and subsequent translocation of cytolysin-mediated Enterococcus faecalis from the gut to the liver contribute to hepatocyte injury.

[0112] To further demonstrate the pathogenic role of *Enterococcus faecalis* in the development of ethanol-induced steatohepatitis, the effect of reducing the naturally occurring *Enterococcus faecalis* in the gut was investigated. Bacterial phages, which are viruses that infect bacteria, exhibit high specificity for bacterial strains (Nobrega et al., 2018). Atp4a Sl / SlIn mice lacking gastric acid, enterococcal overgrowth in the gut is associated with increased susceptibility to alcohol-induced fatty liver disease (Llorente et al., 2017). Wild-type mice were administered Atp4a via gavage. Sl / Sl Enterococcus faecalis strains isolated from mice increased ethanol-induced steatohepatitis (Llorente et al., 2017). This Enterococcus faecalis strain was found to express cytolysin. Four distinct naturally occurring bacterial phages were isolated, with lysis occurring from Atp4a. Sl / Sl A cytolytic Enterococcus faecalis strain isolated from mice. The lytic bacterial phage belongs to the Podoviridae family. Then Atp4a... Sl / Sl Mice and their wild-type littermates were placed on a chronically alcoholic diet and administered a mixture of lysing bacterial phages via gavage. The mixture was targeted at *Sterilobacillus crescentis* (…). Caulobacter crescentus A bacterial phage of *C. crescentus* was used as a control. *C. crescentus* is a bacterium found in freshwater lakes and streams (Poindexter, 1964) but does not colonize humans or rodents (Shin et al., 2016). Following chronic ethanol feeding, the control bacterial phage or its carrier, Atp4a, was administered via gavage. Sl / Sl Compared to mice, mice administered Atp4a, a bacterial phage targeting cytolytic Enterococcus faecalis, via gavage showed better results. Sl / Sl Mice exhibited less liver damage, steatosis, and inflammation. Administration of Enterococcus faecalis bacterial phage significantly reduced the level of cytolysin in the liver (Figure 2) and the amount of Enterococcus faecalis in feces. Bacteriophage administration did not affect the overall composition of the fecal microbiome or intestinal absorption or hepatic metabolism of ethanol.

[0113] To develop a novel treatment for precisely editing the gut microbiota, bacterial phages targeting *Enterococcus faecalis* strains isolated from fecal samples of patients with alcoholic hepatitis were isolated and amplified. The lytic bacterial phages targeting *Enterococcus faecalis* originated from the families *Leptophageidae* or *Myotailophageidae*. These bacterial phages were patient-specific because they did not lyse *Enterococcus faecalis* from another patient with alcoholic hepatitis (data not shown). Gnospermia mice were colonized with feces from two different cytolysin-positive patients with alcoholic hepatitis and administered 3–4 different lytic bacterial phages targeting *Enterococcus faecalis*. Compared to mice administered a control bacterial phage (targeting *C. crescentus*), mice showed reduced ALT and hepatic triglyceride levels. Il1b , Cxcl1 and Cxcl2 Decreased liver levels of mRNA and cylLsThe liver levels were reduced, indicating that bacterial phages targeting *Enterococcus faecalis* alleviated ethanol-induced liver disease. The bacterial phages targeting *Enterococcus faecalis* also reduced the amount of fecal *Enterococcus* without affecting the overall composition of the gut microbiota. Intestinal absorption and hepatic metabolism of ethanol were similar across all groups.

[0114] To demonstrate that the efficacy of phage therapy is achieved by targeting lysing Enterococcus faecalis rather than reducing non-lysing Enterococcus faecalis, fecal samples from patients with cytolysin-negative alcoholic hepatitis were colonized in gnotobiotic mice. Bacteriophages targeting non-lysing Enterococcus faecalis from the patients, belonging to the families Long-tailed or Short-tailed bacteriophages, were isolated and amplified. Although fecal Enterococcus was reduced, these phages did not reduce the characteristics of ethanol-induced liver disease compared to control phages. These findings suggest that lysing phage therapy can reduce the characteristics of ethanol-induced liver disease caused by lysing Enterococcus faecalis.

[0115] These findings link an increase in specific bacterial strains to worse outcomes and mortality in patients with alcoholic hepatitis. Cytolysin is a virulence factor produced by *Enterococcus faecalis* that causes direct hepatocyte death and leads to liver disease. Cytolysin does not affect the intestinal barrier or promote its own translocation from the gut to the liver. During chronic ethanol administration, translocation of *Enterococcus faecalis* to the liver is essential for the development of liver disease, which may be promoted by ethanol-induced changes in the intestinal barrier (Schnabl and Brenner, 2014).

[0116] Bacterial phages targeting *Enterococcus faecalis* can be used to treat patients with alcoholic hepatitis, a life-threatening condition for which there is no effective treatment. Personalized diagnosis can identify patients with *Enterococcus faecalis* colonization who are expected to have worse clinical outcomes. Phages can precisely edit the gut microbiota and selectively target and eradicate specific bacterial strains. These types of phage-based therapies have been investigated primarily in trials in patients infected with multidrug-resistant bacteria (Schooley et al., 2014) or with gastrointestinal diseases (Marcuk et al., 1971; Sarker et al., 2016; Dalmasso et al., 2014). These trials have demonstrated that phage-based therapies are safe even with intravenous administration of bacterial phages (Schooley et al., 2014). The data in this article suggest that eradication of *Enterococcus faecalis* in patients with alcoholic hepatitis may produce better outcomes than current treatments.

[0117] Example 3 Bacterial phages with a broader host range for lysing Enterococcus faecalis and methods for their production. To expand the host range of bacterial bacteriophages for lysinic enterococci, natural selection of existing bacteriophages was used to broaden the host range and identify genetically differentiated bacteriophages.

[0118] Although about 40 species of Enterococcus faecalis have been isolated ( E. faecalis While there are bacteriophages, the *Enterococcus faecalis* bacteriophage targets approximately 60% of clinical isolates of cytolysin-positive *Enterococcus faecalis* (reference bacterial strains), which can cause alcoholic hepatitis. On the other hand, bacteriophages with a broader host range are needed for clinical applications.

[0119] method Of the Enterococcus faecalis phages isolated to date, ΦEf2.3 was used due to its broadest host range for reference bacterial strains. The phages were co-cultured with reference strains (16 Enterococcus faecalis strains) for 5 days to generate evolutionary phages, and on day 5, the "evolutionary phages" adapted to the host through co-culture were isolated from the culture supernatant. The obtained evolutionary phages were used to determine the host range. Furthermore, the obtained evolutionary phages were used in second and third rounds to insert additional mutations into their viral genomes. The presence of these mutations in known phages was verified by BLAST.

[0120] result ΦEf2.3 Host Scope Verification The infectivity of ΦEf2.3 against reference strains (16 Enterococcus faecalis strains) was determined. Infectivity was evaluated by plaque formation activity (spot assay) by adding 3 μL of phage solution to lawns containing each host. As shown in Table 1, ΦEf2.3 was active against 10 of the 16 strains, but inactive against 6 strains (EF02, 04, 06, 09, 12, and 15).

[0121] Table 1: Host range of ΦEf2.3 The susceptibility of 16 clinical isolates of Enterococcus faecalis to ΦEf2.3 was referenced.

[0122] +: Detection shows activity -: No activity detected Co-culture of ΦEf2.3 with reference strain To evolve ΦEf2.3, the phage was co-cultured with reference strains (16 Enterococcus faecalis strains). ΦEf2.3 with an MOI of 0.01 was inoculated into each reference strain in the logarithmic growth phase (OD = 0.2–0.4). ΦEf2.3 and the reference strains were co-cultured with shaking at 37 ± 2 °C, and 10% of the co-culture was subcultured into fresh BHI medium every 24 hours. This procedure was repeated for 5 days, and the phage lytic activity was determined by measuring the OD value.

[0123] As in Figure 7 As shown, in experiments with susceptible hosts of ΦEf2.3 (EF01, 03, 05, 07, 08, 10, 11, 13, 14, 16), the OD value of phage inoculation was lower than that of uninoculated strains for approximately 1-2 days after inoculation, indicating that the phage inhibited the growth of the reference strain. In experiments with EF01, 07, 08, 11, and 16, the OD value continuously increased, indicating the emergence of phage resistant variants; however, in experiments with EF03, 05, 10, 13, and 14, a phase of OD increase followed by a decrease was observed, suggesting that the supernatant may contain evolved phages capable of reinfecting phage resistant variants.

[0124] In experiments with non-susceptible hosts of ΦEf2.3 (EF02, 04, 06, 09, 12, 15), the growth curves were similar to those without phage inoculation, which is similar to the case of co-culturing with EF02, 04, and 09. On the other hand, in co-culturing with EF06, 12, and 15, decreased OD values ​​were observed on day 4 (EF15) and day 5 (EF06 and 12), indicating lysis caused by evolved phages adapted to the host.

[0125] Isolation of evolutionary bacteriophages The supernatant of the co-cultured sample on day 5 ( Figure 7 The bacterial strains used in the co-culture were used to isolate evolutionary phages. As a result, phages were isolated from the supernatants of phages co-cultured with EF03, 05, 06, 07, 08, 10, 11, 12, 13, 14, and 16. The phage titers against the co-cultured host strains were as follows: Figure 8 As shown in the image.

[0126] Validation of the host range of evolutionary bacteriophages Using isolated phages, a dot assay was performed to assess the host range of the evolved phages against non-susceptible reference strains. Figure 12As shown, phages co-cultured with EF06, 12, and 15 were infectious to the hosts EF06, EF12, and EF15 in the co-cultures, respectively. Furthermore, Φ2.3N15D5 infected EF06 and EF15, indicating an expanded host range. Additionally, Φ2.3N03D5, Φ2.3N13D5, and Φ2.3N14D5 infected phage resistant variants (RM1 and RM2: isolated from co-cultures of EF01 and ΦEf2.3).

[0127] Sequencing of the evolved bacteriophage Φ2.3N13D5 revealed differences in its genome compared to its parent bacteriophage Φ2.3.

[0128] In this way, evolutionary phages were identified as having an expanded host range, and genomic differences were identified after co-culture. Figure 13 In practical applications, this could lead to a single phage being used for more cases. This is because the strains used in this study were all clinical isolates from patients, particularly EF06, EF12, and EF15, which cannot be killed by naturally occurring environmental phages. Furthermore, the emergence of phage-resistant variants has been reported in past clinical trials of phage therapy; therefore, it would be very useful to prepare in advance evolved phages capable of killing even phage-resistant variants (such as those obtained in this experiment).

[0129] Starting from the first round, additional mutations are inserted into the evolutionary phage. Using isolated evolutionary phages Ev06, Ev12, and Ev13, which have Figure 13 The single mutations described in [the original text], as shown in Figure 14, were used to co-culture these phages again with reference strains (EF06, EF12, and EF13). Evolutionary phages with an MOI of 0.01 were inoculated into each reference strain in the logarithmic growth phase (OD = 0.2–0.4). The phages and reference strains were co-cultured with shaking at 37 ± 2 °C, and 10% of the co-culture was subcultured into fresh BHI medium every 24 hours. This procedure was repeated for 5 days, and the phage lytic activity was determined by measuring the OD value. [The remaining text appears to be incomplete and requires further context.] Figure 14B As shown in -D, a phase of OD decrease followed by an increase in OD was also observed, suggesting that the supernatant may contain further evolved phages that can re-infect phage-resistant variants. The supernatant of the co-cultured samples on day 5 ( Figure 14B -D) and the bacterial strains used in the co-culture were used to isolate evolutionary phages. As a result, phages were isolated from the supernatants of co-cultures of Ev06 with EF13, Ev12 with EF13, and Ev13 with EF12. The titers of the phages to the co-cultured host strains were as follows: Figure 14E As shown. (As in...) Figure 14AAs shown, second-round evolutionary phages with an MOI of 0.01 were inoculated into EF06 cells in the logarithmic growth phase (OD = 0.2–0.4) and co-cultured as described above. Figure 14F The supernatant of the co-cultured sample on day 5 ( Figure 14F EF06 was used to isolate evolutionary phages. As a result, phages were isolated from the supernatants of co-cultures of Ev12-13 with EF06 and Ev13-12 with EF06. The phage titers against the co-culture host strain (EF06) were as follows: Figure 14G As shown in the diagram. Using phage isolates from rounds 2 and 3, a dot assay was performed to assess the host range of the evolved phage against a non-susceptible reference strain. (See also...) Figure 14H As shown, it is noteworthy that the phages from the third round of co-culture were infectious against EF06, EF12, and EF15, as well as the phage resistant variants (RM1 and RM2). Figure 15 As shown, these evolved bacteriophages have double or triple mutations in their viral genome.

[0130] In short, all these mutations ( Figure 13 and Figure 15 These nonsynonymous substitutions can insert into two sites on the phage tail fibrils and endolysin, as well as four sites on the ssDNA-binding protein, suggesting that these substitutions contribute to expanding the phage host range. Furthermore, comparative BLAST analysis showed that, apart from a single amino acid mutation (E1287K) in the tail fibrils, no identical mutations are known in other phages. Figure 16D The -F mutation indicates that phages with similar mutations are extremely rare. In other words, the resulting evolved phage is one with an expanded host range, uniquely evolved in the in vitro co-culture system used in this experiment. Therefore, the method disclosed herein produces an evolved phage with broader host specificity compared to the corresponding parent phage. Furthermore, this evolved phage contains the unique mutations described herein, which confer broader host specificity.

[0131] Furthermore, mixing too many phages as a mixture can weaken the effectiveness of individual phages. For example, in the case of EF12, EF06, or phage resistant variants (RMs) that cannot be killed by the natural phage (parental ΦEf2.3), it would be necessary to prepare a mixture of at least three phages (such as Ev06, Ev12, and Ev13) if combining phages with only one mutation. However, if using evolved phages with three mutations, it is not necessary to prepare a phage mixture in the first place, and it is possible to treat more clinical cases using only one type of phage. This also helps to reduce the number of phages that make up the phage mixture.

[0132] Implementation 1. An evolved Enterococcus faecalis ( E. faecalis A method for using bacteriophages, comprising infecting one or more strains of Enterococcus faecalis with one or more parental bacteriophages and determining whether one or more evolved bacteriophages are produced.

[0133] 2. The method according to embodiment 1, wherein the Enterococcus faecalis is cytolysin positive.

[0134] 3. The method according to Embodiment 1 or Embodiment 2, wherein the host range of Enterococcus faecalis includes the one or more bacteriophages.

[0135] 4. The method according to Embodiment 1 or Embodiment 2, wherein the host range of the Enterococcus faecalis does not include the one or more bacteriophages.

[0136] 5. The method according to any one of embodiments 1 to 4, wherein at least one of the strains is susceptible to infection by the parent bacteriophage.

[0137] 6. The method according to any one of embodiments 1 to 4, wherein at least one of the strains is not susceptible to infection by the parent bacteriophage.

[0138] 7. The isolated bacteriophage produced by any one of embodiments 1 to 4 is capable of infecting a variety of Enterococcus faecalis strains, thereby having a wider host range than the one or more parent bacteriophages.

[0139] 8. An isolated phage produced by any one of embodiments 1 to 4, which is capable of infecting parental phage-resistant Enterococcus faecalis strains.

[0140] 9. An isolated infectious bacteriophage comprising SEQ ID NO: 2 or a nucleotide sequence having at least 80%, 82%, 84%, 85%, 86%, 88%, 90%, 92%, 94%, 95%, 96%, 97%, 98% or 99% nucleic acid sequence identity with it.

[0141] 10. A composition comprising one or more isolated bacteriophages or combinations thereof according to any one of embodiments 7 to 9.

[0142] 11. A method of treating a disease or condition comprising administering to a mammal in need an effective amount of the composition according to embodiment 10, wherein the disease or condition is alcoholic hepatitis, non-alcoholic steatohepatitis (NASH), cirrhosis, and / or liver failure.

[0143] 12. The method according to embodiment 11, wherein the mammal is a human.

[0144] 13. The method according to embodiment 11 or embodiment 12, wherein the composition comprises Myotail Phagesaceae ( Myoviridae ), Short-tailed bacteriophages ( Podoviridae ), Spounaviridae Or Longtail Phage Family ( Siphoviridae bacteriophage or any combination thereof.

[0145] 14. The method according to any one of embodiments 11 to 13, wherein the bacteriophage is isolated from the mammal and optionally amplified prior to application.

[0146] 15. The method according to any one of embodiments 11 to 14, wherein the bacteriophage has broad host specificity and / or is a genetically modified bacteriophage.

[0147] 16. The method according to any one of embodiments 11 to 15, wherein after the application of the composition, the level of enterococcal lysin or lysinic enterococcus faecalis is monitored.

[0148] 17. The method according to any one of embodiments 11 to 16, wherein a mixture of lysogenic bacteriophages is applied.

[0149] 18. The method according to any one of embodiments 11 to 17, wherein the composition is administered orally.

[0150] 19. The method according to any one of embodiments 11 to 18, wherein the composition is a tablet.

[0151] 20. The method according to any one of embodiments 11 to 19, wherein the composition is a sustained-release formulation.

[0152] References Argimon et al., Microb. Genom., 2:e000093 (2016).

[0153] Ball et al., J. Abnorm. Psychol., 106:545 (1997).

[0154] Bertola et al., Nat. Protoc., 8:627 (2013).

[0155] Brandl et al., J. Hepatol., 69:396 (2018).

[0156] Cox et al., Curr. Protein Pept. Sci., 6:77 (2005).

[0157] Dalmasso et al., Trends Microbiol., 22:399 (2014).

[0158] Dominguez et al., Am. J. Gastroenterology, 103:2747 (2008).

[0159] Gill et al., BMC Genomics, 13:542 (2012).

[0160] Haas et al., Nature, 415:84 (2002).

[0161] Huycke et al., Antimicrob. Agents Chemother., 35:1626 (1991).

[0162] Ike et al., J. Bacteriol., 172:155 (1990).

[0163] Iwaisako et al., Proc. Nat. Acad. Sci. USA, 109:E1369 (2012).

[0164] Krieg et al., Blood, 118:6418 (2011).

[0165] Lee et al., JAMA Intern. Med., 179:340 (2019).

[0166] Llopis et al., Gut, 65:830 (2016).

[0167] Llorente et al., Nature Commun., 8:837 (2017).

[0168] Lozano et al., Lancet, 380:2095 (2012).

[0169] Maddrey et al., Gastroenterology, 75:193 (1978).

[0170] Marcuk et al., Bull. World Health Organ., 45:77 (1971).

[0171] Mathurin and Lucey, J. Hepatol., 56:S39 (2012).

[0172] Nobrega et al., Nat. Rev. Microbiol., 16:760 (2018).

[0173] Page et al., Microb. Genom., 2:e000083 (2016).

[0174] Poindexter, Bacteriol. Rev., 28:231 (1964).

[0175] Raven et al., Nat. Microbiol., 1:15033 (2016).

[0176] Rehm et al., Clin. Exp. Res., 38:1068 (2014).

[0177] Rehm et al., J. Hepatol., 59:160 (2013).

[0178] Ryu et al., Appl. Environ. Microbiol., 79:196 (2013).

[0179] Sarker et al., EbioMedicine, 4:124 (2016).

[0180] Schnabl and Brenner, Gastroenterology, 146:1513 (2014).

[0181] Schooley et al., Antimicrob. Agents Chemother., 61:10 (2017).

[0182] Seemann, Bioinformatics, 30:2068 (2014).

[0183] Shin et al., Sci. Rep., 6:29681 (2016).

[0184] Stamatakis, Bioinformatics, 30:1312 (2014).

[0185] Tang and van der Donk, Nature Chem. Biol., 9:157 (2013).

[0186] Tang et al., J. Ind. Microbiol. Biotechnol., 46:537(2018).

[0187] The Human Microbiome Consortium, Nature, 486:207 (2012).

[0188] Thursz et al., N. Engl. J. Med., 373:282 (2015).

[0189] Valentine et al., Biochemistry, 7:2143 (1968).

[0190] Van Tyne et al., Toxins (Basel), 5:895 (2013).

[0191] All publications, patents and patent applications, Genbank series websites and other public materials cited in this disclosure are incorporated herein by reference to the same extent that each individual publication, patent or patent application, Genbank series, website and other public material is specifically and individually indicated to be incorporated herein by reference. In the event of any conflict between the definitions of terms incorporated by reference and those defined herein, this specification shall prevail.

[0192] Although the invention has been described in conjunction with certain embodiments thereof in the foregoing specification, and many details have been set forth for illustrative purposes, it will be apparent to those skilled in the art that the invention can be applied to other embodiments, and that some details herein may be varied considerably without departing from the basic principles of the invention.

Claims

1. A method to induce Enterococcus faecalis ( E. faecalis Methods for phage evolution include infecting one or more strains of Enterococcus faecalis with one or more parental phages and determining whether one or more evolved phages are produced.

2. The method according to claim 1, wherein the Enterococcus faecalis is cytolysin-positive.

3. The method according to claim 1, wherein the host range of Enterococcus faecalis includes the one or more bacteriophages.

4. The method according to claim 1, wherein the host range of the Enterococcus faecalis does not include the one or more bacteriophages.

5. The method according to claim 1, wherein at least one of the strains is susceptible to infection by the parent bacteriophage.

6. The method according to claim 1, wherein at least one of the strains is not susceptible to infection by the parent bacteriophage.

7. The isolated bacteriophage produced by the method of claim 1 is capable of infecting a variety of Enterococcus faecalis strains, thereby having a wider host range than the one or more parent bacteriophages.

8. The isolated phage produced by the method of claim 1, which is capable of infecting parental phage-resistant Enterococcus faecalis strains.

9. An isolated infectious bacteriophage comprising SEQ ID NO: 2 or a nucleotide sequence having at least 80%, 82%, 84%, 85%, 86%, 88%, 90%, 92%, 94%, 95%, 96%, 97%, 98% or 99% nucleic acid sequence identity with it.

10. A composition comprising one or more isolated bacteriophages according to claim 7, or a combination thereof.

11. A method of treating a disease or condition comprising administering an effective amount of the composition according to claim 10 to a mammal in need, wherein the disease or condition is alcoholic hepatitis, non-alcoholic steatohepatitis (NASH), cirrhosis, and / or liver failure.

12. The method of claim 11, wherein the mammal is a human.

13. The method of claim 11, wherein the composition comprises Myotail Phagesaceae ( Myoviridae ), Short-tailed bacteriophages ( Podoviridae ), Spounaviridae Or Longtail Phage Family ( Siphoviridae bacteriophage or any combination thereof.

14. The method of claim 11, wherein the bacteriophage is isolated from the mammal and optionally amplified prior to administration.

15. The method of claim 11, wherein the phage has broad host specificity and / or is a genetically modified phage.

16. The method of claim 11, wherein, after administration of the composition, the level of enterococcal lysin or lysinic enterococcus faecalis is monitored.

17. The method of claim 11, wherein the mixture of lytic phages is applied.

18. The method of claim 11, wherein the composition is administered orally.

19. The method of claim 11, wherein the composition is a tablet.

20. The method of claim 11, wherein the composition is a sustained-release formulation.

Images