BHK-21 cell line capable of stably expressing human ENT1 gene as well as construction method and application of BHK-21 cell line
By constructing a BHK-21 cell line that stably expresses the human ENT1 gene, the problem of low replication efficiency of Newcastle disease virus was solved, resulting in a shorter vaccine production cycle and improved product quality stability.
Patent Information
- Application Number
- CN202511660135.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-13
- Publication Date
- 2026-02-27
AI Technical Summary
The lack of BHK-21 cell lines that can efficiently express the human ENT1 gene in existing technologies leads to low Newcastle disease virus replication efficiency, long vaccine production cycles, and unstable product quality.
A stable BHK-21 cell line expressing the human ENT1 gene was constructed by amplifying the human ENT1 gene and constructing a stable expression vector. The BHK-21 cells were then infected using a lentiviral packaging system and screened for puromycin to obtain a stable BHK-21 cell line expressing the human ENT1 gene.
It improved the replication efficiency of Newcastle disease virus in host cells, shortened the vaccine production cycle, improved the consistency of virus titer and product quality, and reduced batch-to-batch variability.
Smart Images
Figure CN121574900A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a BHK-21 cell line that stably expresses the human ENT1 gene, its construction method, and its application. Background Technology
[0002] Newcastle disease (ND), an acute and highly contagious infectious disease caused by Newcastle disease virus (NDV), not only causes enormous economic losses to the poultry industry but also poses a continuous threat to the global poultry industry. Against this backdrop, developing safe and effective new vaccines has become crucial for effectively controlling and blocking the spread of the virus. In recent years, cell vaccines, with their significant advantages in production safety, cost-effectiveness, and immunogenicity, have demonstrated great potential to replace traditional chicken embryo production methods and have become a key area of vaccine development. Therefore, establishing cell lines capable of efficiently supporting NDV replication is of paramount importance for improving vaccine production capacity and quality, strengthening epidemic prevention and control capabilities, and ultimately ensuring public health security.
[0003] Newcastle disease virus (NDV) hijacks and utilizes the host cell's nutrient resources, inducing profound metabolic reprogramming to create a unique virus-cell metabolic interaction pattern that supports its efficient replication. Nucleotides are not only the basic building blocks of nucleic acids but also the carriers of viral genetic information, forming the core components of the viral particle. The ENT1 protein helps the host cell efficiently take up nucleosides from the external environment, rapidly replenishing the cellular nucleotide pool through salvage synthesis pathways, providing ample raw materials for the high-speed synthesis of the viral genome. Previous studies have confirmed that Newcastle disease virus hijacks cellular nucleotide synthesis pathways for its own replication. Based on this theory, constructing cell lines with enhanced nucleoside transport functions is expected to increase the host cell's nucleotide salvage synthesis rate, thereby providing more abundant raw materials for NDV replication and ultimately increasing its viral yield.
[0004] The BHK-21 cell line is an ideal substrate for amplifying NDV, with advantages in three aspects: First, it is highly susceptible to NDV, enabling efficient viral replication and high-titer harvesting; second, it proliferates rapidly, significantly shortening the vaccine production cycle and improving efficiency; and third, the produced virus exhibits good genetic stability, accurately preserving the genetic characteristics of the original strain. Compared to traditional chicken embryos, BHK-21 cells provide viral antigens with better consistency and higher quality. Therefore, this cell line is not only of significant value to existing vaccine production but also points to new strategies and directions for vaccine development.
[0005] ENT1 is a key membrane transporter protein encoded by the SLC29A1 gene. Widely distributed across the cell membranes of various tissues throughout the body, its core function is to mediate the bidirectional transmembrane transport of nucleosides (such as adenosine) and nucleoside analogues. ENT1, by mediating the transmembrane transport of nucleosides, provides essential raw materials for the salvage synthesis of nucleotides, which is fundamental to maintaining normal cellular life activities and proliferation. Studies have shown that NDV hijacks cellular nucleotide synthesis pathways for its own replication.
[0006] Therefore, a BHK-21 cell line that stably expresses the human ENT1 gene, its construction method, and its applications are urgently needed. Summary of the Invention
[0007] To address the shortcomings of existing technologies, this invention provides a BHK-21 cell line that stably expresses the human ENT1 gene, its construction method, and its applications.
[0008] To solve the above-mentioned technical problems, the present invention provides the following technical solution:
[0009] The first objective of this invention is to provide a BHK-21 cell line that stably expresses the human ENT1 gene. The cell line is hamster kidney fibroblast BHK-ENT1, classified as Mesocricetus auratus, with accession number CCTCC NO: C2025343, accession date November 12, 2025, and deposited at the China Center for Type Culture Collection, located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, within the campus of Wuhan University.
[0010] Preferably, the nucleotide sequence of the human ENT1 gene is shown in SEQ ID No. 1.
[0011] The second objective of this invention is to provide an application of a BHK-21 cell line that stably expresses the human ENT1 gene in the proliferation of Newcastle disease virus.
[0012] A third objective of this invention is to provide a method for constructing a BHK-21 cell line that stably expresses the human ENT1 gene, comprising the following steps:
[0013] (A) Amplify the human ENT1 gene and construct a stable expression vector;
[0014] (B) The stable expression vector described in step (A) was co-transfected with psPAX2 and pMD2.G plasmids into HEK-293T cells to package and produce infectious lentiviruses;
[0015] (C) After infecting BHK-21 cells with the lentivirus obtained in step (B), puromycin drug screening and large-scale culture are performed to obtain the BHK-21 cell line that stably expresses the human ENT1 gene.
[0016] Preferably, in step (A), the primer sequences for the amplified human ENT1 gene are shown in SEQ ID No. 2 and SEQ ID No. 3.
[0017] Preferably, in step (A), the construction step of the stable expression vector is specifically performed as follows:
[0018] The amplified human ENT1 gene was ligated with the vector fragment, and the resulting ligation product was added to DH5α competent cells. After heat shock, the cells were added to culture medium for further cultivation. Single colonies were selected and plasmids were extracted.
[0019] Preferably, the vector fragment is a vector fragment digested by Phage plasmid.
[0020] Preferably, the heat shock is performed at 42°C for 45 seconds; the culture medium is LB solid culture medium containing ampicillin.
[0021] Compared with the prior art, the present invention has the following beneficial effects:
[0022] This invention provides a BHK-21 cell line that stably expresses the human ENT1 gene. The BHK-21 cell line is a hamster kidney fibroblast BHK-ENT1 cell line containing the human ENT1 gene, which can be hijacked by the virus to accelerate nucleoside transport in the host cell, promote nucleotide salvage synthesis, and increase the viral titer produced by Newcastle disease virus after infecting the host cell.
[0023] This invention provides a method for constructing a BHK-21 cell line stably expressing the human ENT1 gene. First, the human ENT1 gene is amplified and a stable expression vector is constructed. Then, the stable expression vector, along with psPAX2 and pMD2.G plasmids, is co-transfected into HEK-293T cells, packaging and generating infectious lentiviruses. Finally, the obtained lentiviruses are used to infect BHK-21 cells, followed by puromycin drug screening and large-scale culture to obtain the BHK-21 cell line stably expressing the human ENT1 gene. Cells successfully constructed using this method exhibit consistent activation of cell proliferation and protein synthesis pathways without significant increase in apoptosis or genetic instability, resulting in shorter culture cycles, reduced batch-to-batch variability, and the ability to maintain high yields even under low serum conditions. This enables higher titers and more uniform product quality in recombinant protein or virus production, significantly improving process scale-up and reproducibility.
[0024] Cell Preservation:
[0025] This invention provides a stable BHK-21 cell line expressing the human c-Myc gene. The cell line is hamster kidney fibroblast BHK-ENT1, classified as Mesocricetus auratus, which was obtained by the inventors through screening. The accession number is CCTCC NO: C2025343, the accession date is November 12, 2025, and the depositary institution is the China Center for Type Culture Collection, located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, within the campus of Wuhan University. Attached Figure Description
[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0027] Figure 1 This is a diagram showing the identification results of the RT-PCR amplification of the human ENT1 gene described in Example 1 of this invention;
[0028] Figure 2 This is the identification of BHK-ENT1 cell subclones obtained in Example 1 of the present invention. Mock is BHK-21 cell, 1 is subclone 1, 2 is subclone 2, 3 is subclone 3, and 4 is subclone 5.
[0029] Figure 3 This is a graph showing the stability test results of BHK-ENT1 cells obtained in Example 1 of this invention;
[0030] Figure 4 Example 4 of this invention promotes nucleoside transport in BHK-ENT1 cells, thereby promoting viral replication;
[0031] Figure 5 This refers to the TCID of Newcastle disease virus on BHK-21 (wild-type BHK-21 cell line in the figure) and BHK-ENT1 cells at different time points in Example 4 of the present invention. 50 . Detailed Implementation
[0032] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other implementation methods obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0033] The above technical solution will be described in detail below with reference to specific embodiments.
[0034] In the following examples, the plasmids psPAX2 and pMD2.G were purchased from addgene, and the DH5α competent cells were provided by Tiangen.
[0035] Example 1: Amplification of the human ENT1 gene and construction of a stable expression vector.
[0036] Step 1: Extract RNA from HeLa cells. Use the Total RNA Extraction Kit for HeLa Cells (catalog number: ET101-01-V2) and follow the instructions below:
[0037] (1) Cell samples were collected using Trans Zol lysis buffer. The lysis buffer was collected into 1.5 mL RNase-free EP tubes and shaken at room temperature for 5 min.
[0038] (2) For every 1 mL of Trans Zol used, add 0.2 mL of RNA Extraction Agent, shake vigorously for 15 seconds, and incubate at room temperature for 3 minutes.
[0039] (3) Centrifuge at 10000g at 4℃ for 15min. At this time, the sample is divided into three layers: colorless aqueous phase (upper layer), middle layer, and pink organic phase (lower layer).
[0040] (4) Transfer the colorless aqueous phase to a new centrifuge tube, add 0.5 mL of isopropanol, invert and mix well, and incubate at room temperature for 10 min.
[0041] (5) Centrifuge at 4℃ for 10 minutes with 10000g, remove the supernatant, and form a gel-like precipitate on the side and bottom of the tube.
[0042] (6) Add 1 mL of 75% ethanol (prepared with DEPC water), vortex vigorously, and centrifuge at 7500g at 4℃ for 5 min.
[0043] (7) Discard the supernatant, let stand at room temperature for 5 min, add 50 μL of RNA lysis solution, incubate at 55℃ for 10 min to obtain the RNA sample, and store at -80℃ for long-term use.
[0044] (8) Using the Yisheng Reverse Transcription Kit (catalog number: 11123ES60), follow the steps outlined in the product instructions as follows:
[0045] Reagent Name Dosage RNA 1-5μg Remove DNA enzymes 3μL RNase-free water To 15μL
[0046] Incubate at 42℃ for 2 minutes.
[0047] Reagent Name Dosage previous RNA reaction solution 15μL Premixed reverse transcriptase 5μL
[0048] First at 55℃ for 15 minutes; then at 85℃ for 5 seconds.
[0049] Step 2: Design primers for the human ENT1 gene.
[0050] Primers F and R were designed based on the predicted sequence of the human ENT1 gene (gene ID: 2030) from GenBank.
[0051] Primer F (endonuclease: EcoRI) is shown in SEQ ID No. 2:
[0052] TGGCCATGGAGGCCCGAATTCTAATGACAACCAGTCACCAGCC;
[0053] Primer R (endonuclease: Xho I) is shown in SEQ ID No. 3:
[0054] CCGCGGCCGCGGTACCTCGAGTCACACAATTGCCCGGAACAG.
[0055] Step 3: Amplify the human ENT1 gene and purify it using gel extraction.
[0056] The PCR system is as follows:
[0057]
[0058]
[0059] The PCR procedure is as follows:
[0060]
[0061] After electrophoresis on a 1% agarose gel, the results are as follows: Figure 1 As shown, the obtained human ENT1 gene sequence is shown in SEQ ID No. 1.
[0062] Step four: Connect and transform.
[0063] The connection system is as follows:
[0064] name Dosage DNA [0.04 × number of insertion fragment base pairs] / ng Phage plasmid digested vector fragment [0.02 × number of cloning vector base pairs] / ng Homologous recombinase Exnase II 5μl <![CDATA[ddH2O]]> to 20μl
[0065] The conversion steps are as follows:
[0066] (1) Add the ligation product to 50 μL of DH5α competent cells and incubate on ice for 30 min.
[0067] (2) Heat shock at 42℃ for 60 seconds;
[0068] (3) Add 1 mL of LB medium and incubate at 37°C and 200 rpm for 1 h.
[0069] (4) Coating the plate.
[0070] 5. Select bacteria and extract plasmid Phage-ENT1 to construct the stable expression vector.
[0071] Example 2: Packaging lentiviruses.
[0072] The stable expression vector was combined with psPAX2 and pMD2.G plasmids to form a three-plasmid system, which was then co-transfected into HEK-293T cells. After 60 hours, the supernatant was collected and centrifuged at 4000 rpm for 5 minutes to obtain the packaged lentivirus.
[0073] The specific composition of the three-plasmid system is shown in the table below. The three-plasmid system is obtained by mixing the reagents in tube A and tube B.
[0074]
[0075] Example 3: Lentiviral infection of cell lines.
[0076] Step 1: Seed BHK-21 cells at an appropriate density in 6-well plates. When the cell density reaches approximately 80%, replace the medium with a lentiviral transfection mixture. This mixture is prepared by mixing equal volumes of serum-free DMEM medium and lentiviral concentrate at a 1:1 ratio, with a total volume of 2 mL per well, and contains 2 μL of polybrene to enhance transfection efficiency.
[0077] Step 2: 12 hours after inoculation, replace the medium with DMEM containing 1% fetal bovine serum and continue culturing for 24 hours. Then add puromycin (antibiotic screening). After two screenings, the resulting cells are the BHK-21 cell line expressing the human ENT1 gene (BHK-ENT1 cells). A portion is expanded and frozen, while the other portion is limitedly diluted and plated into 96-well plates. Single subclones are selected and expanded.
[0078] Example 4: Identification.
[0079] Step 1: Western Blot identification.
[0080] (1) The single subclonal cells selected in step 2 of Example 3 were seeded into a 6-well plate. After the cells were confluent, they were lysed with 200 μL of 2×loading protein lysis buffer and placed in a centrifuge tube.
[0081] (2) The sample was placed at 100℃ and left to stand for 10 minutes.
[0082] (3) Gel running: Prepare 10% PAGE protein gel, add the sample, run at 80V for 120min.
[0083] (4) Transfer: Carefully remove the SDS-PAGE gel from the glass plate and place 4 layers of filter paper, PVDF membrane, gel layer and 4 layers of filter paper in the order from positive to negative electrode. After removing air bubbles from each layer, transfer it into the electrophoresis apparatus, pour in the pre-cooled transfer buffer (Tris-glycine-methanol buffer), and place the electrophoresis tank in an ice box. Transfer the membrane at 250mA for 95 minutes.
[0084] (5) Sealing: Prepare a 5% skim milk powder sealing solution and seal it in a shaker at room temperature for 1 hour.
[0085] (6) Primary antibody incubation: Prepare 5% BSA solution and dilute the primary antibody (homoENT1, rabbit antibody, abcam catalog number: ab182023) at a ratio of 1:1000, and incubate overnight at 4°C on a shaker. Rinsing: Rinse the PVDF membrane three times with TBST solution for 5 min each time.
[0086] (7) Secondary antibody incubation: Dilute the corresponding secondary antibody (rabbit secondary antibody, abclonal catalog number: AS014) with TBST at a ratio of 1:10000, place the PVDF membrane on the secondary antibody, and incubate on a shaker at room temperature for 1 hour. Rinsing: Rinse the PVDF membrane 3 times with TBST solution for 5 minutes each time.
[0087] (8) Chemiluminescence: Under light-protected conditions, mix the chemiluminescence developer in a 1:1 ratio, rinse the membrane, and then place it in a chemiluminescence developer to detect the results. Figure 2 As shown. Cells with high ENT1 gene expression levels after subcloning were cultured and preserved.
[0088] Step 2: qPCR was used to detect the stability of ENT1 gene expression in cell lines.
[0089] The cells constructed in step three of Example 1 were cryopreserved, thawed, and passaged for counting. RNA was extracted from the cells at passages 0, 10, 20, and 30. Quantitative reverse transcription (1 μg) was performed, followed by qPCR detection. Figure 3 As shown, the ENT1 gene can be stably inherited during cell passage, indicating that a BHK-21 cell line stably expressing the human ENT1 gene has been successfully constructed.
[0090] Step 3: Western blotting detects that ENT1 promotes nucleoside transport to facilitate viral replication.
[0091] (1) The single subclonal cells selected in step one of Example 4 were seeded into a 6-well plate. After the cells were confluent, they were treated with NMBPR (50 μM), an inhibitor of the nucleotide salvage synthesis pathway. After 18 h of NDV infection, the cells were lysed with 200 μL of 2×loading protein lysis buffer and placed in a centrifuge tube.
[0092] (2) The sample was placed at 100℃ and left to stand for 10 minutes.
[0093] (3) Gel running: Prepare 10% PAGE protein gel, add the sample, run at 80V for 120min.
[0094] (4) Transfer: Carefully remove the SDS-PAGE gel from the glass plate and place 4 layers of filter paper, PVDF membrane, gel layer and 4 layers of filter paper in the order from positive to negative electrode. After removing air bubbles from each layer, transfer it into the electrophoresis apparatus, pour in the pre-cooled transfer buffer (Tris-glycine-methanol buffer), and place the electrophoresis tank in an ice box. Transfer the membrane at 250mA for 95 minutes.
[0095] (5) Sealing: Prepare a 5% skim milk powder sealing solution and seal it in a shaker at room temperature for 1 hour.
[0096] (6) Primary antibody incubation: Prepare 5% BSA solution and dilute the primary antibody (NDV-NP, mouse antibody, laboratory prepared) at 1:1000, and incubate overnight at 4°C on a shaker. Rinsing: Rinse the PVDF membrane three times with TBST solution, 5 min each time.
[0097] (7) Secondary antibody incubation: Dilute the corresponding secondary antibody (mouse secondary antibody, abclonal catalog number: AS003) with TBST at a ratio of 1:10000, place the PVDF membrane on the secondary antibody, and incubate on a shaker at room temperature for 1 hour. Rinsing: Rinse the PVDF membrane 3 times with TBST solution for 5 minutes each time.
[0098] (8) Chemiluminescence: Under light-protected conditions, mix the chemiluminescence developer in a 1:1 ratio, rinse the membrane, and then place it in a chemiluminescence developer to detect the results. Figure 2 As shown. Cells with high ENT1 gene expression levels after subcloning were cultured and preserved.
[0099] like Figure 4 As shown: Western blot results showed that stable expression of ENT1 promoted the expression of viral protein NP after treatment with the addition of the salvage synthesis pathway inhibitor NMBPR.
[0100] Step 4: Newcastle disease virus growth curves on BHK-21 and BHK-ENT1 cells.
[0101] The single subclonal cells selected in step one of Example 4 were seeded into 6-well plates. When the cells reached 70% confluence, the cells in one well were digested for counting. The supernatant was collected at 6h, 18h, and 24h after BHK-21 and BHK-ENT1 cells were infected with 1 MOI of Newcastle disease virus and used to detect TCID. 50 .
[0102] The results are as follows Figure 5 As shown, Newcastle disease virus TCID on BHK-ENT1 cells 50 The titer was higher than that on BHK cells.
[0103] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A BHK-21 cell line stably expressing the human ENT1 gene, characterized in that, The cell line is hamster kidney fibroblast BHK-ENT1, classified as Mesocricetus auratus, with accession number CCTCC NO: C2025343, deposit date November 12, 2025, and deposited at the China Center for Type Culture Collection, located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, within the campus of Wuhan University.
2. The BHK-21 cell line stably expressing the human ENT1 gene according to claim 1, characterized in that, The nucleotide sequence of the human ENT1 gene is shown in SEQ ID No.
1.
3. The application of a BHK-21 cell line stably expressing the human ENT1 gene as described in any one of claims 1-2 in the propagation of Newcastle disease virus.
4. A method for constructing a BHK-21 cell line stably expressing the human ENT1 gene as described in any one of claims 1-2, characterized in that, Includes the following steps: (A) Amplify the human ENT1 gene and construct a stable expression vector; (B) The stable expression vector described in step (A) was co-transfected with psPAX2 and pMD2.G plasmids into HEK-293T cells to package and produce infectious lentiviruses; (C) After infecting BHK-21 cells with the lentivirus obtained in step (B), puromycin drug screening and large-scale culture are performed to obtain the BHK-21 cell line that stably expresses the human ENT1 gene.
5. The construction method according to claim 4, characterized in that, In step (A), the primer sequences for the amplified human ENT1 gene are shown in SEQ ID No. 2 and SEQ ID No.
3.
6. The construction method according to claim 4, characterized in that, In step (A), the construction of the stable expression vector is specifically performed as follows: The amplified human ENT1 gene was ligated with the vector fragment, and the resulting ligation product was added to DH5α competent cells. After heat shock, the cells were added to culture medium for further cultivation. Single colonies were selected and plasmids were extracted.
7. The construction method according to claim 6, characterized in that, The vector fragment is the vector fragment obtained after Phage plasmid digestion.
8. The construction method according to claim 6, characterized in that, The heat shock was performed at 42°C for 45 seconds; the culture medium was LB solid medium containing ampicillin.