Alkaline protease mutant and application thereof
By mutating the specific amino acid sequence of Bacillus clausti alkaline protease AprE, the problem of poor stability of alkaline protease in liquid detergents was solved, its stability and enzyme activity in the presence of surfactants were improved, and its application in the detergent industry was promoted.
Patent Information
- Application Number
- CN202511923998.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-27
- Publication Date
- 2026-02-27
AI Technical Summary
Alkaline proteases in liquid detergents have poor stability, especially when they come into contact with surfactants, which can easily lead to deactivation and affect their washing performance.
By performing specific mutations in the amino acid sequence of Bacillus clausti alkaline protease AprE, and introducing substitutions such as T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G, and N232D, the stability and resistance of the enzyme can be enhanced.
It significantly improved the storage stability and enzyme activity residue of alkaline protease in liquid detergents, enhancing its application potential in the detergent industry.
Smart Images

Figure SMS_1 
Figure SMS_2
Abstract
Description
Technical Field
[0001] This invention relates to the field of protein engineering technology, specifically to an alkaline protease mutant with improved stability and its applications. Background Technology
[0002] Alkaline proteases can hydrolyze various protein-based stains, such as blood, sweat, and milk stains, and release protein-encapsulated stains or stains that have increased adhesion to the substrate due to protein. They also exhibit good synergistic cleaning power with surfactants. Unlike powdered detergents, liquid detergents are typical environments for enzyme inactivation and have complex compositions. In liquid detergents, alkaline proteases are exposed to the solution, directly contacting and interacting with surfactants, chelating agents, bleaching agents, and other additives. This makes the stability of proteases in detergents a challenge in the industry, and strategies to improve stability have become a research hotspot.
[0003] Surfactants are also the main active ingredients in synthetic detergents. They can significantly reduce the surface tension of liquids, making it easier for oily liquid dirt to detach from the fabric surface; and surfactants can adsorb solid insoluble substances. The surface of dirt is agitated, causing it to transfer from the substrate into the liquid, and subsequently removed by rinsing through agitation. In addition, surfactants also have solubilizing, emulsifying, dispersing, and flocculating effects. Nonionic surfactants are another class of widely used active substances, often used in combination with anionic surfactants. Anionic surfactants bind to the positively charged amino residues on the surface of proteases in detergents through electrostatic interactions, inhibiting their activity. A key indicator for assessing the potential of newly screened alkaline proteases for the detergent industry is determining their tolerance to anionic surfactants.
[0004] Adding stabilizers, such as boric acid, borates, and polyols, is the simplest and most common method to improve the stability of alkaline proteases in liquid detergents. However, the selection and dosage of stabilizers must fully consider compatibility with the detergent formulation and cost. Currently, the use of most chemical stabilizers still follows experience and requires further theoretical research for guidance. Chemical modification is also a commonly used method to improve enzyme stability. However, the amino acid residues that can cross-link with chemical reagents must be located on the enzyme surface and are affected by various factors, including the type of enzyme to be modified, the modification site, and the degree of modification. Therefore, not all amino acid residues can be chemically modified. Protein engineering involves the rational and semi-rational design of the primary amino acid sequence of enzyme proteins to obtain mutants with superior performance. Currently, most alkaline proteases used in liquid detergents are mutants modified by protein engineering. All 275 amino acid sites on the BPN of *Bacillus subtilis* amyloliquefaciens were saturated with mutations to compare the effects of different amino acids at each site on protease performance. Protein technology can also introduce chemical bonds to enhance the internal interactions of enzyme proteins, thereby improving enzyme stability. For example, introducing new disulfide bonds at two cysteine sites can improve the stability of the protease structure. Summary of the Invention
[0005] The purpose of this invention is to provide an alkaline protease mutant with improved stability. This mutant exhibits significantly improved enzyme activity stability in detergents compared to the wild type, thereby facilitating the widespread application of alkaline protease in the detergent industry.
[0006] The present invention relates to an alkaline protease mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, and comprising, compared with SEQ ID NO:1, at at least one position of an amino acid substitution selected from the group consisting of: 22, 99, 101, 127, 138, 172, 183, 197, 219, 226, 232.
[0007] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.
[0008] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.
[0009] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid from the following group: T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G, N232D.
[0010] In some embodiments of the present invention, the mutant comprises substitutions or combinations of substitutions selected from the following substitutions and combinations of substitutions: T22S; T22S / S99A; T22S / S101G; T22S / P127Q; T22S / N138Q; T22S / G172A; T22S / F183D; T22S / V197I; T22S / P219W; T22S / A226G; T22S / N232D; T22S / S99A / S101G; T22S / S101G / N138Q; T22S / P127Q / G172A; T22S / G172A / F183D; T22S / F183D / V197I / ; T22S / V197I / N232D; T22S / P219W / A226G; T22SA226G / N232D; T22S / S99A / S101G / P127Q; T22S / P127Q / N138Q / G172A; T22S / F183D / V197I / P219W; T22S / F183D / A226G / N232D; T22S / V197I / P219W / A226G; T22S / P219W / A226G / N232D; T22S / S99A / P127Q / N138Q / G172A; T22S / S101G / / N138Q / F183D / V197I; T22S / P127Q / G172A / V197I / P219W; T22S / N138Q / V197I / P219W / A226G; T22S / G172A / V197I / P219W / N232D; T22S / V197I / P219W / A226G / N232D; T22S / S99A / N138Q / F183D / V197I / A226G; T22S / S101G / P127Q / G172A / A226G / N232D; T22S / N138Q / F183D / V197I / A226G / N232D; T22S / F183D / V197I / P219W / A226G / N232D T22S / S99A / P127Q / N138Q / F183D / A226G / ; T22S / S101G / G172A / F183D / P219W / N232D; T22S / P127Q / F183D / V197I / P219W / A226G; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D; T22S / S101G / N138Q / G172A / V197I / A226G / N232D; T22S / P127Q / F183D / V197I / P219W / A226G / N232D; T22S / N138Q / G172A / F183D / V197I / P219W / A226G; T22S / G172A / F183D / V197I / P219W / A226G / N232D; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I; T22S / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G; T22S / P127Q / N138Q / G172A / F183D / V197I / P219W / N232D; T22S / N138Q / G172A / F183D / V197I / P219W / A226G / N232D; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W; T22S / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G; T22S / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G; T22S / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D; S99A; S99A / S101G; S99A / P127Q; S99A / N138Q; S99A / G172A; S99A / F183D; S99A / V197I; S99A / P219W; S99A / A226G; S99A / N232D; S99A / S101G / P127Q; S99A / N138Q / F183D; S99A / G172A / V197I; S99A / F183D / P219W; S99A / V197I / A226G; S99A / A226G / N232D; S99A / S101G / P127Q / N138Q; S99A / N138Q / G172A / F183D; S99A / F183D / V197I / P219W; S99A / V197I / P219W / A226G; S99A / P219W / A226G / N232D; S99A / S101G / P127Q / N138Q / G172A; S99A / F183D / V197I / A226G / N232D; S99A / S101G / N138Q / G172A / V197I / P219W; S99A / P127Q / F183D / V197I / P219W / N232D; S99A / G172A / F183D / V197I / P219W / A226G; S99A / S101G / N138Q / G172A / F183D / P219W / A226G; S99A / G172A / F183D / V197I / P219W / A226G / N232D; S99A / S101G / N138Q / G172A / F183D / V197I / P219W / A226G; S99A / P127Q / G172A / F183D / V197I / P219W / A226G / N232D; S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G; S99A / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D; S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D S101G; S101G / P127Q; S101G / N138Q; S101G / G172A; S101G / F183D; S101G / V197I; S101G / P219W; S101G / A226G; S101G / N232D; S101G / P127Q / N138Q; S101G / G172A / F183D; S101G / V197I / P219W; S101G / A226G / N232D; S101G / P127Q / N138Q / G172A; S101G / F183D / P219W / A226G; S101G / V197I / P219W / N232D; S101G / P127Q / N138Q / G172A / F183D; S101G / P127Q / N138Q / G172A / F183D; S101G / G172A / V197I / P219W / A226G; S101G / V197I / P219W / A226G / N232D; S101G / P127Q / N138Q / G172A / F183D / V197I; S101G / G172A / V197I / P219W / A226G / N232D; S101G / P127Q / F183D / V197I / P219W / A226G / N232D; S101G / G172A / F183D / V197I / P219W / A226G / N232D; S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G; S101G / N138Q / G172A / F183D / V197I / P219W / A226G / N232D; S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D; P127Q; P127Q / N138Q; P127Q / G172A; P127Q / F183D; P127Q / V197I; P127Q / P219W; P127Q / A226G; P127Q / N232D; P127Q / N138Q / G172A; P127Q / F183D / V197I; P127Q / P219W / A226G; P127Q / N138Q / G172A / F183D; P127Q / F183D / V197I / P219W; P127Q / P219W / A226G / N232D; P127Q / N138Q / G172A / F183D / V197I; P127Q / F183D / V197I / A226G / N232D; P127Q / N138Q / G172A / F183D / V197I / P219W; P127Q / F183D / V197I / P219W / A226G / N232D; P127Q / N138Q / G172A / F183D / V197I / P219W / A226G; P127Q / G172A / F183D / V197I / P219W / A226G / N232D; P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D; N138Q; N138Q / G172A; N138Q / F183D; N138Q / V197I; N138Q / P219W; N138Q / A226G; N138Q / N232D; N138Q / G172A / F183D; N138Q / V197I / P219W; N138Q / P219W / A226G; N138Q / A226G / N232D; N138Q / G172A / F183D / V197I; N138Q / V197I / P219W / A226G; N138Q / G172A / V197I / P219W / A226G; N138Q / F183D / P219W / A226G / N232D; N138Q / G172A / F183D / V197I / P219W / A226G; N138Q / F183D / V197I / P219W / A226G / N232D; N138Q / G172A / F183D / V197I / P219W / A226G / N232D; G172A; G172A / F183D; G172A / V197I; G172A / P219W; G172A / A226G; G172A / N232D; G172A / F183D / V197I; G172A / P219W / A226G; G172A / A226G / N232D; G172A / F183D / V197I / P219W; G172A / P219W / A226G / N232D; G172A / F183D / V197I / P219W / A226G; G172A / V197I / P219W / A226G / N232D; G172A / F183D / V197I / P219W / A226G / N232D; F183D; F183D / V197I; F183D / P219W; F183D / A226G; F183D / N232D; F183D / V197I / P219W; F183D / A226G / N232D; F183D / V197I / P219W / A226G; F183D / P219W / A226G / N232D; F183D / V197I / P219W / A226G / N232D; V197I; V197I / P219W; V197I / A226G; V197I / N232D; V197I / P219W / A226G; V197I / P219W / N232D; V197I / A226G / N232D; V197I / P219W / A226G / N232D; P219W; P219W / A226G; P219W / N232D; P219W / A226G / N232D; A226G; N232D; A226G / N232D T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D.
[0011] The present invention also relates to the encoding gene of the above-mentioned alkaline protease mutant.
[0012] The present invention also relates to recombinant expression vectors containing the above-mentioned mutant coding genes.
[0013] In some embodiments of the present invention, a host cell is also involved, which is Bacillus subtilis (B. subtilis). Bacillus subtilis ), which includes the aforementioned recombinant expression vectors.
[0014] Based on the wild-type alkaline protease AprE derived from Bacillus clausti, this invention provides single-point mutants containing mutation sites T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G, and N232D. After storage in liquid detergent at 37°C and 45°C for 4 weeks, the enzyme activity residual rates reached 73.1%-85.8% and 16.2%-35.4%, respectively, which are 37.4%-61.3% and 138.2%-420.6% higher than those of the wild type. This invention also provides mutants containing two or more combined mutation sites, which, after being stored in liquid detergents at 37°C and 45°C for 4 weeks, exhibit enzyme activity residual rates that are 14.6%-25.3% and 31.5%-42.3% higher than the corresponding single-site mutants, respectively. The mutation sites provided by this invention can significantly enhance the resistance of alkaline proteases to commonly used surfactants, effectively improving their storage stability in liquid detergents and promoting their widespread application in the detergent industry. Detailed Implementation
[0015] The method of the present invention will be further illustrated below with reference to examples. Experimental methods not specified in the examples can be performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual* by J. Sambrook et al., or according to the manufacturer's recommendations. Those skilled in the art can better understand and master the present invention with the help of these examples. However, the methods for implementing the present invention should not be limited to the specific method steps described in the embodiments of the present invention.
[0016] In this invention, the nomenclature used to define the amino acid positions is based on the amino acid sequence WP_094423791.1 of the Bacillus alkaline protease deposited in GenBank, which is given in the sequence listing as SEQ ID NO:1 (amino acids 1-269 of SEQ ID NO:1). Therefore, in this context, the basis for position numbering, SEQ ID NO:1, begins at A1 (Ala1) and ends at R269 (Arg269). SEQ ID NO:1 serves as the standard for position numbering and thus as the basis for nomenclature.
[0017] Labeling of alkaline protease mutants: The mutated amino acid in the alkaline protease mutant is indicated by "the amino acid that was replaced at the original amino acid position". For example, V30I indicates that the amino acid at position 30 is replaced by Ile(I) in the original alkaline protease. The position number corresponds to the number in SEQ ID NO:1 of the appendix sequence listing.
[0018] The culture medium formulation involved in the embodiments of the present invention is as follows: LB liquid medium: 1% tryptone, 0.5% yeast extract, 0.5% NaCl; LB agar: 1% tryptone, 0.5% yeast extract, 0.5% NaCl, 2% agar; Skim milk agar plates: 1% tryptone, 0.5% yeast extract, 0.5% NaCl, 1% skim milk, 1.5% agar; The preparation method for GM I is as follows: 95.6 ml of 1* minimum salt solution, 2.5 ml of 20% glucose, 0.4 ml of 5% hydrolyzed casein, and 1 ml of 10% yeast extract; wherein the preparation method for the 1* minimum salt solution is as follows: 14 g / L K2HPO4, 6 g / L KH2PO4, 2 g / L (NH4)2SO4, 1 g / L trisodium citrate, and 0.2 g / L MgSO4•7H2O are dissolved in distilled water in sequence; The preparation method for GM II is as follows: 96.98 ml of 1* minimum salt solution, 2.5 ml of 20% glucose, 0.08 ml of 5% hydrolyzed casein, 0.04 ml of 10% yeast extract, 0.25 ml of 1 M MgCl2, and 0.05 ml of 1 M CaCl2. Seed culture medium: yeast extract 0.5%, tryptone 0.5%, NaCl 0.5%; Fermentation medium: 1% glucose, 0.2% disodium hydrogen phosphate, 1% peptone, 1% sodium chloride, and 0.5% yeast extract.
[0019] The method for determining the enzyme activity and protein content of alkaline protease in this invention is as follows: (a) Enzyme activity assay method: 1. Principle Under specific temperature and pH conditions, proteases hydrolyze casein substrates to produce amino acids containing phenolic groups (such as tyrosine and tryptophan). Under alkaline conditions, Folin reagent is reduced to produce molybdenum blue and tungsten blue. The absorbance of the solution is measured at a wavelength of 680 nm using a spectrophotometer. Enzyme activity is directly proportional to absorbance, thus allowing the calculation of the product's enzyme activity.
[0020] 2. Definition of enzyme activity The definition of protease activity, expressed in units, is as follows: 1 g of solid enzyme powder (or 1 ml of liquid enzyme) hydrolyzes casein to produce 1 μg of tyrosine in 1 minute under certain temperature and pH conditions, which is 1 unit of enzyme activity, expressed as u / g (u / ml).
[0021] 3. Reagents and solutions (1) Folin reagent (Folin:water = 1:2); (2) 42.4 g / L sodium carbonate solution; (3) 0.5 mol / L sodium hydroxide solution; (4) borate buffer (pH 10.5); (5) 10.0 g / L casein solution; (6) 100 g / mL and 1 mg / mL L-tyrosine standard solutions; (7) 6.54% trichloroacetic acid.
[0022] 4. Measurement Method (1) Preparation of standard curve: Prepare L-tyrosine standard solutions with concentrations of 0 g / mL, 10 g / mL, 20 g / mL, 30 g / mL, 40 g / mL and 50 g / mL. Take 1.00 mL of each standard solution, add 5.00 mL of 0.4 mol / L sodium carbonate solution and 1.00 mL of Folin reagent working solution, shake well, and place in a 40℃ water bath for color development for 20 min. Remove and use a spectrophotometer at a wavelength of 680 nm with a 10 mm cuvette, using a tyrosine-free tube (C) as a blank, to measure the absorbance of each. Plot the standard curve with absorbance A as the ordinate and the concentration of tyrosine C as the abscissa (this line should pass through the zero point).
[0023] (2) Enzyme activity assay Take a pre-diluted amount of enzyme solution, then add an equal volume of 10% casein preheated at 40℃, and react at 40℃ for 10 min. Then add an equal volume of trichloroacetic acid (6.54% concentration) to the reaction system, mix well, and let stand at room temperature for 10 min to terminate the reaction. Take 1 ml of the terminated reaction solution, then add 5 ml of 42.4 g / L sodium carbonate solution, followed by 1 ml of Folin reagent, and perform a colorimetric reaction at 40℃ for 20 min. Finally, measure the OD608 value.
[0024] (3) Calculation Read the enzyme activity of the final diluted sample from the standard curve, in units of u / mL. The enzyme activity of the sample is calculated using the following formula: X=A×K×4 / 10×n=2 / 5×A×K×n.
[0025] Where: X — enzyme activity of the sample (u / g or u / ml); A—The average absorbance of the sample in parallel tests; K—absorption constant; 4—Total volume of reaction reagents (ml); 10 — Reaction time 10 min, calculated as 1 min; n – dilution factor.
[0026] The present invention will now be described in detail with reference to specific embodiments.
[0027] Example 1 Construction of alkaline protease mutant Bacillus claurinus ( Bacillus clausii alkaline protease gene aprE The lead peptide and mature peptide were optimized based on Bacillus codon preferences, and the optimized nucleotide sequence was synthesized by Beijing Liuhe BGI Genomics Co., Ltd. The protease gene was named... aprEIts amino acid sequence is SEQ ID NO:1, and its encoding nucleotide sequence is SEQ ID NO:2.
[0028] by aprE Using gene (SEQ ID NO:2) as a template, PCR amplification was performed using the above primers and the GeneMorph II random mutagenesis PCR kit. The PCR primers and reaction conditions are as follows: aprE-F: gcactgctggcaggaggcgcaactcaagcttttgccgctgaagaagcaaaagaaaaata; aprE-Rv: ggaaacagctatgaccatgattacgccaagctttagcgtgttgccgcttctgcattg.
[0029] PCR conditions were: 98℃ for 2 min; 98℃ for 10 s; 58℃ for 20 s, 72℃ for 45 s, 30 cycles; 72℃ for 5 min. PCR amplification products were recovered using a gel extraction kit, digested with HindIII, and ligated into the HindIII-treated vector pX131. The enzyme digestion conditions for the pX131 expression vector were as follows: pX131 20uL 10*Buffer 5ul HindIII 2.5uL <![CDATA[ddH2O]]> 22.5ul Total volume 50ul Enzyme digestion was performed in a 37℃ water bath for 2 hours. After electrophoresis, the target fragments were recovered and dissolved in 20 μL ddH2O.
[0030] Using the NEB Gbison assembly kit, in a 20 μL reaction system, genes aprE The molar ratio of fragment to carrier pX131 was 1:3, and the reaction was carried out at 50℃ for 60 min.
[0031] Example 2: Screening of alkaline protease mutants with improved storage stability The above 20 μL assembly reaction solution was transformed into Bacillus subtilis 1A751 host cells using the competent cell method. The specific transformation process is as follows: Freshly activated Bacillus subtilis 1A751 was inoculated into 5 ml GMI solution on an LB plate and cultured overnight at 30°C and 125 rpm with shaking. The next day, 1 ml of the culture solution was transferred to 9 ml of GMI and cultured at 37°C and 220 rpm for 3.5 h. Then, 1 ml of the culture solution from the previous step was transferred to 9 ml of GMII solution and cultured at 37°C and 125 rpm for 90 min. The cells were then collected by centrifugation at 5000 g for 10 min. The cells were gently resuspended in 1 ml of GMII solution. The resuspended cells are the competent cells. Then, 0.2 ml of competent cells were taken and 20 μL of assembly reaction solution was added. The cells were cultured at 37°C and 200 rpm for 60 min with shaking. The mixture was then plated on skim milk containing 30 μg / mL kanamycin and incubated overnight at 37°C. The transformants and corresponding clear zones were examined the next day to determine the wild-type gene sequence. aprE For comparison.
[0032] Transformants with clear zones were picked from mutant transformation plates and purified by streaking on skim milk plates containing 30 μg / mL kanamycin to obtain single colonies with clear zones. These colonies were then individually inoculated into 96-well plates using toothpicks, with 200 μL of LB solution added to each well. The plates were incubated at 37°C and 500 rpm for approximately 48 hours with shaking. The alkaline protease activity of the fermentation supernatant in each well was measured using a high-throughput assay kit. Ultimately, the applicant screened over 2000 transformants with clear zones who exhibited alkaline protease activity no less than that of the wild type.
[0033] Furthermore, sodium fatty alcohol polyoxyethylene ether sulfate (AES) solution was added to the fermentation broth of the more than 2,000 transformants selected above to a final concentration of 4% (v / v). After standing for 72 hours, the alkaline protease activity of the fermentation supernatant in each well plate was measured. The enzyme activity residual rate was calculated as 100% of the initial enzyme activity. Different mutants showed different storage stability in the surfactant solution. Finally, the applicant screened out mutation sites that significantly improved the stability of alkaline protease: T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G, and N232D.
[0034] Based on wild-type alkaline protease aprE, this invention provides single-point mutants containing any one of the mutation sites T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G, and N232D.
[0035] The present invention also provides mutants comprising at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 mutation sites selected from T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G, and N232D. For example: T22S / S99A, T22S / G172A, S99A / F183D, S101G / P219W, P127Q / A226G, G172A / N232D, P219W / A226G two-point mutants; T22S / P127Q / G172A, S99A / N138Q / F183D, S101G / V197I / P219W, P127Q / N138Q / G172A, N138Q / A226 G / N232D, F183D / V197I / P219W, V197I / A226G / N232D three-point mutants; T22S / S99A / S101G / P127Q, S99A / N138Q / G172A / F183D, S101G / V197I / P219W, P127Q / N138Q / G172A / F183D, N138Q / G172A / F183D / V197I, N138Q / V1 Four-point mutants: 97I / P219W / A226G, G172A / F183D / V197I / P219W, F183D / V197I / P219W / A226G, V197I / P219W / A226G / N232D; T22S / S101G / / N138Q / F183D / V197I, S99A / F183D / V197I / A226G / N232D, S101G / P127Q / N138 Five-point mutants: Q / G172A / F183D, S101G / G172A / V197I / P219W / A226G, P127Q / F183D / V197I / A226G / N232D, N138Q / G172A / V197I / P219W / A226G, G172A / V197I / P219W / A226G / N232D, F183D / V197I / P219W / A226G / N232D;T22S / S99A / N138Q / F183D / V197I / A226G, T22S / S101G / G172A / F183D / P219W / N232D, S99A / S101G / N138Q / G172A / V19 7I / P219W, S101G / P127Q / N138Q / G172A / F183D / V197I, P127Q / F183D / V197I / P219W / A226G / N232D, G172A / F183D / V19 7I / P219W / A226G / N232D six-point mutant; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D, S99A / S101G / N138Q / G172A / F183D / P219W / A226G, S101G / G172A / F183D / V197I / P219W / A226G / N232D, P127Q / N138Q / G172A / F183D / V197I / P219W / A226G N138Q / G172A / F183D / V197I / P219W / A226G / N232D seven-point mutant; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I, T22S / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, T22S / N138Q / G172A / F183D / V197I / P219W / A226G / N232D, S99A Eight-point mutants: / S101G / N138Q / G172A / F183D / V197I / P219W / A226G, S99A / P127Q / G172A / F183D / V197I / P219W / A226G / N232D, S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D;T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W, T22S / S101G / P1 27Q / N138Q / G172A / F183D / V197I / P219W / A226G, S99A / S101G / P127Q / N138Q / G1 72A / F183D / V197I / P219W / A226G, S99A / P127Q / N138Q / G172A / F183D / V197I / P2 19W / A226G / N232D, S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N 232D nine-point mutant; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, T22S / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D, S99 A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D ten-point mutant; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D eleven-point mutant.
[0036] Example 3: Storage stability analysis of alkaline protease mutants in surfactants The recombinant Bacillus subtilis strain expressing wild-type alkaline protease AprE or its mutant obtained in Example 2 was inoculated into 50 mL of fermentation medium (0.5% yeast extract, 0.5% tryptone, 1% glucose, 1.8% K2HPO4) and fermented in shake flasks for 48 h. After centrifugation at 5000 rpm for 10 min, the supernatant was collected, and the alkaline protease activity in the supernatant was measured.
[0037] A solution of sodium fatty alcohol polyoxyethylene ether sulfate (AES) was added to the fermentation supernatant to a final concentration of 4% (v / v). After standing for 72 hours, the alkaline protease activity of the fermentation supernatant was measured. The residual enzyme activity was calculated as 100% of the initial enzyme activity. The specific results are shown in Table 1.
[0038] Table 1 Storage stability of alkaline protease single-point mutants in surfactant solution. alkaline protease mutant enzyme activity residual rate Wild-type AprE 83.6% T22S 99.0% S99A 94.6% S101G 100.7% P127Q 97.4% N138Q 98.9% G172A 95.2% F183D 96.9% V197I 93.6% P219W 96.7% A226G 97.0% N232D 106.3% As can be seen from the data in Table 1, compared with wild-type alkaline protease AprE, the alkaline protease mutants provided by this invention, which contain single mutation sites T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G, and N232D respectively, showed a 12.0%-27.2% increase in enzyme activity residual rate and a significant improvement in stability after being stored in a 4% sodium fatty alcohol polyoxyethylene ether sulfate (AES) solution for 72 hours.
[0039] Furthermore, this invention provides two-point mutants: T22S / S99A, T22S / G172A, S99A / F183D, S101G / P219W, P127Q / A226G, G172A / N232D, and P219W / A226G; three-point mutants: T22S / P127Q / G172A, S99A / N138Q / F183D, S101G / V197I / P219W, P127Q / N138Q / G172A, N138Q / A226G / N232D, and F183D / V197I / P219W, V197I / A226G / N232D; T The four-point mutants are 22S / S99A / S101G / P127Q, S99A / N138Q / G172A / F183D, S101G / V197I / P219W, P127Q / N138Q / G172A / F183D, N138Q / G172A / F183D / V197I, N138Q / V197I / P219W / A226G, G172A / F183D / V197I / P219W, F183D / V197I / P219W / A226G, and V197I / P219W / A226G / N232D; T22S / S101G / / N 138Q / F183D / V197I, S99A / F183D / V197I / A226G / N232D, S101G / P127Q / N138Q / G172A / F183D, S101G / G172A / V197I / P219W / A226G, P127Q / F183D / V197I / A226G / N232D, N138Q / G172A / V197I / P219W / A226G, G172A / V197I / P219W / A226G / N232D, F183D / V197I / P219W / A226G / N232 D five-point mutant; T22S / S99A / N138Q / F183D / V197I / A226G, T22S / S101G / G172A / F183D / P219W / N232D, S99A / S101G / N138Q / G172A / V197I / P219W, S101G / P127Q / N138Q / G172A / F183D / V197I, P127Q / F183D / V197I / P219W / A226G / N232D, G172A / F183D / V197I / P219W / A226G / N232D six-point mutant;T22S / S99A / S101G / P127Q / N138Q / G172A / F183D, S99A / S101G / N138Q / G172A / F183D / P219W / A226G、S101G / G172A / F183D / V197I / P219W / A226G / N232D、P 127Q / N138Q / G172A / F183D / V197I / P219W / A226G, N138Q / G172A / F183D / V197I / P219W / A226G / N232D seven-point mutant; T22S / S99A / S101G / P127Q / N138Q / G172A / F18 3D / V197I, T22S / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, T22S / N 138Q / G172A / F183D / V197I / P219W / A226G / N232D, S99A / S101G / N138Q / G172A / F183D / V197I / P219W / A226G、S99A / P127Q / G172A / F183D / V197I / P219W / A2 26G / N232D, S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D eight-point mutant; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W, T22S / S101G / P127Q / N138Q / G 172A / F183D / V197I / P219W / A226G, S99A / S101G / P127Q / N138Q / G172A / F183 D / V197I / P219W / A226G, S99A / P127Q / N138Q / G172A / F183D / V197I / P219W / A2 26G / N232D, S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D nine-point mutant; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226 G, T22S / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D, S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D ten-point mutants;The eleven-point mutant T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D, after being stored in a 4% sodium fatty alcohol polyoxyethylene ether sulfate (AES) solution for 72 hours, showed an unexpectedly high enzyme activity residual rate, generally 9.7%-19.2% higher than the corresponding single-point mutants.
[0040] Example 4: Storage stability analysis of alkaline protease mutant in liquid detergent This invention selects a liquid detergent with a composite formulation of the most commonly used anionic component sodium fatty alcohol polyoxyethylene ether sulfate (AES) and the nonionic component fatty alcohol polyoxyethylene ether (AEO9) (formulation shown in Table 2) to evaluate the storage stability of alkaline protease mutants.
[0041] The fermentation supernatant of the Bacillus subtilis engineered bacteria expressing the recombinant wild-type alkaline protease AprE or its mutant described in Example 3 was diluted with 0.15M, pH 10.5 borate buffer to a protease activity of 10,000 U / mL. This diluted supernatant was added to the above-mentioned compound liquid detergent at a volume ratio of 0.2% and stirred thoroughly. The detergent was stored at 37℃ and 45℃ for 1, 2, and 4 weeks, respectively. The alkaline protease activity in the detergent was then measured, and the residual enzyme activity was calculated with the initial enzyme activity as 100%. Specific results are shown in Tables 3 and 4.
[0042] Enzyme activity residual rate (%) = enzyme activity after storage / initial enzyme activity × 100%.
[0043] Table 2 Liquid Detergent Formulation Formula ingredients content(%) Sodium fatty alcohol polyoxyethylene ether sulfate (AES) 80 mL / L <![CDATA[Polyoxyethylene (9) lauryl ether]]> 80 mL / L Calcium salts 0.24 g / L phosphate 5 g / L preservative 0.2 g / L Antistatic agent 0.1 g / L Table 3. Storage stability of alkaline protease single-point mutants in liquid detergents at 37℃
[0044] Table 4. Storage stability of alkaline protease single-point mutants in liquid detergents at 45℃
[0045] As shown in Table 3, after being placed at 37°C for 4 weeks, the residual enzyme activity of wild-type alkaline protease in liquid detergent decreased to 53.2%, while the residual enzyme activity of the 11 single-point mutants provided by this invention reached 73.1%-85.8%, which is 37.4%-61.3% higher than that of wild-type.
[0046] As shown in Table 4, after being placed at 45°C for 4 weeks, the residual enzyme activity of wild-type alkaline protease in liquid detergent was only 6.8%, while the residual enzyme activity of the 11 single-point mutants provided by this invention reached 16.2%-35.4%, which is 138.2%-420.6% higher than that of wild-type.
[0047] Furthermore, this invention provides two-point mutants: T22S / S99A, T22S / G172A, S99A / F183D, S101G / P219W, P127Q / A226G, G172A / N232D, and P219W / A226G; three-point mutants: T22S / P127Q / G172A, S99A / N138Q / F183D, S101G / V197I / P219W, P127Q / N138Q / G172A, N138Q / A226G / N232D, and F183D / V197I / P219W, V197I / A226G / N232D; T The four-point mutants are 22S / S99A / S101G / P127Q, S99A / N138Q / G172A / F183D, S101G / V197I / P219W, P127Q / N138Q / G172A / F183D, N138Q / G172A / F183D / V197I, N138Q / V197I / P219W / A226G, G172A / F183D / V197I / P219W, F183D / V197I / P219W / A226G, and V197I / P219W / A226G / N232D; T22S / S101G / / N 138Q / F183D / V197I, S99A / F183D / V197I / A226G / N232D, S101G / P127Q / N138Q / G172A / F183D, S101G / G172A / V197I / P219W / A226G, P127Q / F183D / V197I / A226G / N232D, N138Q / G172A / V197I / P219W / A226G, G172A / V197I / P219W / A226G / N232D, F183D / V197I / P219W / A226G / N232 D five-point mutant; T22S / S99A / N138Q / F183D / V197I / A226G, T22S / S101G / G172A / F183D / P219W / N232D, S99A / S101G / N138Q / G172A / V197I / P219W, S101G / P127Q / N138Q / G172A / F183D / V197I, P127Q / F183D / V197I / P219W / A226G / N232D, G172A / F183D / V197I / P219W / A226G / N232D six-point mutant;T22S / S99A / S101G / P127Q / N138Q / G172A / F183D, S99A / S101G / N138Q / G172A / F183D / P219W / A226G、S101G / G172A / F183D / V197I / P219W / A226G / N232D、P 127Q / N138Q / G172A / F183D / V197I / P219W / A226G, N138Q / G172A / F183D / V197I / P219W / A226G / N232D seven-point mutant; T22S / S99A / S101G / P127Q / N138Q / G172A / F18 3D / V197I, T22S / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, T22S / N 138Q / G172A / F183D / V197I / P219W / A226G / N232D, S99A / S101G / N138Q / G172A / F183D / V197I / P219W / A226G、S99A / P127Q / G172A / F183D / V197I / P219W / A2 26G / N232D, S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D eight-point mutant; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W, T22S / S101G / P127Q / N138Q / G 172A / F183D / V197I / P219W / A226G, S99A / S101G / P127Q / N138Q / G172A / F183 D / V197I / P219W / A226G, S99A / P127Q / N138Q / G172A / F183D / V197I / P219W / A2 26G / N232D, S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D nine-point mutant; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226 G, T22S / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D, S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D ten-point mutants;The eleven-point mutant T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D showed further improved stability in detergents. After 4 weeks of storage at 37°C, its enzyme activity residual rate was generally 14.6%-25.3% higher than that of the corresponding single-point mutants; after 4 weeks of storage at 45°C, its enzyme activity residual rate was generally 31.5%-42.3% higher than that of the corresponding single-point mutants.
[0048] In summary, the T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G, and N232D mutation sites provided by this invention can significantly enhance the resistance of alkaline proteases to commonly used surfactants in detergents, effectively improve their storage stability in liquid detergents, and achieve unexpected technical effects.
[0049] The alkaline protease mutant provided by this invention can be widely used in the detergent production field.
Claims
1. An alkaline protease mutant, characterized in that, The mutant is an alkaline protease with the amino acid sequence SEQ ID NO:1 containing substitutions or combinations of substitutions for at least one amino acid from the group consisting of: P127Q; T22S / P127Q; T22S / P127Q / G172A; T22S / P127Q / N138Q / G172A; T22S / P127Q / G172A / V197I / P219W; T22S / S101G / P127Q / G172A / A226G / N232D; T22S / S99A / P127Q / N138Q / F183D / A226G / ; T22S / P127Q / F183D / V197I / P219W / A226G; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D; T22S / P127Q / F183D / V197I / P219W / A226G / N232D; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I; T22S / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G; T22S / P127Q / N138Q / G172A / F183D / V197I / P219W / N232D; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W; T22S / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G; T22S / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G; T22S / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D; S99A / P127Q; S99A / S101G / P127Q; S99A / S101G / P127Q / N138Q; S99A / S101G / P127Q / N138Q / G172A; S99A / P127Q / F183D / V197I / P219W / N232D; S99A / P127Q / G172A / F183D / V197I / P219W / A226G / N232D; S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G; S99A / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D; S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D S101G / P127Q; S101G / P127Q / N138Q; S101G / P127Q / N138Q / G172A; S101G / P127Q / N138Q / G172A / F183D; S101G / P127Q / N138Q / G172A / F183D; S101G / P127Q / N138Q / G172A / F183D / V197I; S101G / P127Q / F183D / V197I / P219W / A226G / N232D; S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G; S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D; P127Q / N138Q; P127Q / G172A; P127Q / F183D; P127Q / V197I; P127Q / P219W; P127Q / A226G; P127Q / N232D; P127Q / N138Q / G172A; P127Q / F183D / V197I; P127Q / P219W / A226G; P127Q / N138Q / G172A / F183D; P127Q / F183D / V197I / P219W; P127Q / P219W / A226G / N232D; P127Q / N138Q / G172A / F183D / V197I; P127Q / F183D / V197I / A226G / N232D; P127Q / N138Q / G172A / F183D / V197I / P219W; P127Q / F183D / V197I / P219W / A226G / N232D; P127Q / N138Q / G172A / F183D / V197I / P219W / A226G; P127Q / G172A / F183D / V197I / P219W / A226G / N232D; P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D.
2. A DNA molecule encoding the alkaline protease mutant of claim 1.
3. A recombinant expression plasmid comprising the DNA molecule of claim 2.
4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid as described in claim 3; the host cell is a non-animal or non-plant variety.
5. The host cell as described in claim 4, characterized in that, The host cell is Pichia pastoris (Pichia pastoris). Pichia pastoris ) or Trichoderma reesei ( Trichoderma reesei ).
6. The application of the alkaline protease mutant of claim 1 in detergent production.