SgRNA pair for constructing low-fertility mouse model as well as construction method and application of sgRNA pair
By designing efficient and specific sgRNA pairs and using CRISPR/Cas9 technology, a 1700031M16Rik gene knockout mouse model was constructed. This solved the problem of the lack of specific targeting tools in existing technologies, realized an animal model that stably simulates the low fertility phenotype, and provided an experimental platform for in-depth exploration of reproductive health mechanisms.
Patent Information
- Application Number
- CN202511539953.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-27
- Publication Date
- 2026-02-27
AI Technical Summary
The lack of existing technologies for tools that can specifically and efficiently target the 1700031M16Rik gene makes it difficult to construct stable animal models that mimic low fertility phenotypes, hindering in-depth exploration of the gene's function and assessment of its potential value in reproductive health.
We designed highly efficient and specific sgRNA pairs and combined them with CRISPR/Cas9 technology to construct a 1700031M16Rik gene knockout mouse model. By introducing sgRNA and Cas9 nuclease into mouse fertilized eggs, we generated double-strand breaks and introduced frameshift mutations through non-homologous end joining repair, thus establishing a stable low-fertility mouse model.
A mouse model of significant and stable reproductive dysfunction phenotype associated with low fertility in humans was successfully constructed. This model achieved precise gene targeting, short construction cycle, and high efficiency, while reducing interference with other tissues. It can realistically simulate the pathophysiological state of low fertility in humans and provides an ideal research tool.
Smart Images

Figure CN121574982A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of animal model construction technology, specifically relating to an sgRNA pair for constructing a low-fertility mouse model, its construction method, and its application. Background Technology
[0002] Reproductive health is a core research focus in the biomedical field, with public health issues arising from low fertility and related diseases becoming increasingly prominent. With accelerated industrialization and changing lifestyles, the risk of low fertility continues to rise, making etiological research and the development of prevention and treatment methods in this area particularly urgent.
[0003] In the process of low fertility research, animal models are an indispensable tool for revealing disease mechanisms and verifying intervention strategies. At present, commonly used low fertility animal models mainly include the following categories: (1) Chemical drug induction model: For example, by injecting cytotoxic drugs such as busulfan, extensive damage to the reproductive system is caused. However, such models are prone to non-specific damage, and there are significant differences in phenotypes among individuals. It is difficult to accurately simulate low fertility caused by specific genetic or molecular etiologies, and the repeatability and reliability are insufficient. (2) Surgical intervention model: For example, a model of fertility dysfunction is constructed by vasectomy or tubal ligation. Although this method can quickly realize the infertility phenotype, it is a physical blockade and cannot reproduce the molecular and cellular pathological changes in the occurrence and development of low fertility. It has obvious limitations when applied to etiological research and drug target discovery. (3) Traditional gene modification model: For example, gene targeting technology using homologous recombination of embryonic stem cells. Although this technology can achieve targeted gene modification, it generally has problems such as long operation cycle, complex technical process, low targeting efficiency and high cost, which are difficult to meet the current needs of large-scale, high-throughput gene function research.
[0004] In recent years, CRISPR / Cas9 gene editing technology, with its advantages of strong targeting, ease of operation, and high editing efficiency, has provided a revolutionary tool for rapidly constructing gene-modified animal models and has been widely used for functional analysis of reproduction-related genes. However, the successful application of this technology highly depends on two key factors: first, the design of efficient and specific guide RNAs (gRNAs) targeting the gene; and second, the formulation of a reasonable model construction strategy based on the functional characteristics of the target gene. Currently, the specific biological function of the long non-coding RNA 1700031M16Rik, which is highly expressed in male reproductive tissues, remains unknown. At present, there is a lack of effective tools that can specifically target this gene, and no animal model has been found that reveals the causal relationship between this gene and the low fertility phenotype through its functional loss. The lack of suitable research tools severely hinders in-depth exploration of the gene's function and the assessment of its potential value in reproductive health.
[0005] Therefore, there is an urgent need in this field to develop a tool that can specifically and efficiently target the 1700031M16Rik gene, and based on this, to construct a novel animal model that can stably simulate the low fertility phenotype, in order to fill the gap in existing technologies and provide a new platform for the study of the mechanisms of low fertility and the development of treatments. Summary of the Invention
[0006] To address the shortcomings of existing technologies, this invention provides an sgRNA pair for constructing a low-fertility mouse model, its construction method, and its application. A highly efficient and specific gRNA was designed targeting the 1700031M16Rik gene, and a knockout mouse model was successfully constructed using CRISPR / Cas9 technology. This not only fills the functional gap of this gene in reproductive regulation and provides a novel, highly matched experimental tool for elucidating the deep molecular mechanisms of low fertility, but also lays a solid foundation for the screening of early diagnostic biomarkers and the development of innovative treatment strategies for low-fertility-related diseases. It has significant scientific value and broad prospects for clinical translation.
[0007] This invention is achieved through the following technical solution:
[0008] A pair of sgRNAs for constructing a mouse model of low fertility, the pair of sgRNAs consisting of sgRNA1 and sgRNA2, wherein the target sequence of sgRNA1 is shown in SEQ ID NO.1 and the target sequence of sgRNA2 is shown in SEQ ID NO.2.
[0009] A CRISPR-Cas9 gene editing system for constructing a mouse model of low fertility comprises the aforementioned sgRNA pair and a Cas9 nuclease or its encoding molecule.
[0010] A primer set for validating the 1700031M16Rik gene knockout mouse model constructed using the above-described sgRNA pairs comprises:
[0011] a) A pair of PCR amplification primers for genotype identification, the nucleotide sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4; and / or,
[0012] b) A pair of qPCR primers for mRNA level validation, the nucleotide sequences of which are shown in SEQ ID NO.6 and SEQ ID NO.7.
[0013] A kit for constructing and validating a mouse model of low fertility, comprising:
[0014] a) The above-mentioned sgRNA pairs, or the DNA molecules encoding the sgRNA pairs;
[0015] b) Cas9 nuclease, or mRNA or DNA molecules encoding Cas9 nuclease;
[0016] c) The primer set mentioned above.
[0017] A method for constructing an in vitro model of low fertility in mice for non-diagnostic or therapeutic purposes, comprising the following steps:
[0018] Step 1) The CRISPR-Cas9 gene editing system described above is introduced into mouse fertilized eggs or embryos, so that sgRNA1 and sgRNA2 guide the Cas9 nuclease to generate double-strand breaks in the target region of the mouse 1700031M16Rik gene, and generate frameshift mutations through endogenous cellular repair, thereby obtaining F0 generation mice with 1700031M16Rik gene knockout;
[0019] Step 2) Use the primer set described above to identify the genotype of the F0 generation mice or their offspring and / or verify the gene knockout efficiency, thereby screening for a stable genetic low-fertility mouse model.
[0020] Preferably, in step 1), sgRNA1 and sgRNA2 target the region from exon 1 to exon 11 of the 1700031M16Rik gene on mouse chromosome 15. After the double-strand break is repaired by non-homologous end joining, the gene is subjected to fragment deletion and / or base insertion / deletion, thereby introducing frameshift mutation.
[0021] A low-fertility mouse model, which is constructed by the method described above.
[0022] The application of the aforementioned low-fertility mouse model in screening or evaluating candidate drugs for improving fertility.
[0023] The application of the aforementioned low-fertility mouse model in studying the biological function of long non-coding RNA 1700031M16Rik or the mechanism of low-fertility-related diseases.
[0024] The beneficial effects of this invention are as follows:
[0025] (1) This invention successfully constructed a low-fertility mouse model with the 1700031M16Rik gene knockout for the first time. This model exhibits significant and stable reproductive dysfunction phenotypes that are highly correlated with the clinical characteristics of low fertility in humans, specifically including: significantly reduced pregnancy rate, reduced average litter size, decreased in vitro fertilization rate, and increased sperm abnormality rate. These quantitative phenotypic indicators clearly confirm the successful construction of the model and show good reproducibility in different generations of mice, providing a highly reliable experimental vector for research.
[0026] (2) This invention utilizes CRISPR / Cas9 gene editing technology to design specific sgRNAs for knockout of exons 1-11 of the 1700031M16Rik gene, achieving precise gene targeting, short construction cycle, and high efficiency. This method fundamentally overcomes the shortcomings of traditional chemical induction models, such as poor reproducibility and severe non-specific damage, and also avoids the problems of long cycle and low efficiency of traditional embryonic stem cell targeting techniques.
[0027] (3) The gene knockout model constructed in this invention has a low fertility phenotype directly caused by the loss of function of the 1700031M16Rik gene. Observation showed that, apart from causing the reproductive system phenotype, this gene knockout did not have any observable impact on the normal development of other tissues and organs in mice. This high tissue specificity minimizes the interference of complex systemic disease phenotypes on reproductive research, which is conducive to researchers focusing on exploring the molecular mechanisms related to reproduction.
[0028] (4) Since the 1700031M16Rik gene is evolutionarily conserved between humans and mice, the mouse model constructed based on the knockout of this gene in this invention can more realistically simulate the pathophysiological state of low fertility in humans. This greatly enhances the preclinical research value and translational potential of this model in revealing the molecular mechanisms of low fertility in humans, screening disease diagnostic biomarkers, and discovering and validating new drug therapeutic targets.
[0029] (5) The model provided by this invention offers researchers in the field of reproductive medicine an ideal and novel research tool. It can not only be used to explore the molecular mechanisms of the occurrence and development of low fertility, but also serve as an efficient in vivo platform for directly screening and evaluating candidate drugs and treatments that can improve or restore fertility, providing new ideas and experimental evidence for the development of clinical intervention strategies. Attached Figure Description
[0030] Figure 1 This is a schematic diagram of the gene knockout strategy and sgRNA sequence in Example 1;
[0031] Figure 2 The results of genotype PCR identification (A) and RT-qPCR experiment (B) of the model mice in Example 2 are shown.
[0032] Figure 3 The results show the statistical results of pregnancy rate (A), litter size (B), in vitro fertilization rate (C), and sperm abnormality rate (D) of the model mice in Example 3. Detailed Implementation
[0033] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.
[0034] Unless otherwise specified, the technical means used in the following embodiments are all conventional means well known to those skilled in the art, and the experimental methods without specific conditions are all conventional methods in the art.
[0035] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0036] All mice used in the following examples were bred in an SPF-grade barrier environment at the Animal Experiment Center of Nantong University. C57 / BL6 strain mice were used in the experiments, and their housing conditions were strictly controlled under 12-hour light-dark cycles and a constant temperature environment of 24-28°C, with standardized feed and drinking water provided. All experimental protocols of this invention have been reviewed and approved by the Animal Experiment Ethics Committee of Nantong University.
[0037] Example 1: Construction of the 1700031M16Rik gene knockout mouse model
[0038] 1. Gene knockout strategies and sgRNA pair design
[0039] This embodiment utilizes CRISPR / Cas9 technology to construct gene knockout mice, as detailed below:
[0040] First, the mouse 1700031M16Rik gene (GenBank accession number: NR_015496.1; Ensembl: ENSMUSG00000099353) is located on mouse chromosome 15 and has 11 exons.
[0041] Secondly, in this embodiment, exons 1 to 11 were selected as target sites. The target gene sequence was input using an online tool, and a pair of targeting sgRNA sequences (sgRNA1 and sgRNA2) were designed. The gene knockout strategy diagram is shown below. Figure 1 As shown.
[0042] sgRNA1 (SEQ ID NO.1): AATCTCCCCGCTATCACCCAGG;
[0043] sgRNA2 (SEQ ID NO. 2): GGCGTTTGTATATGCATATCAGG.
[0044] Finally, the Cas9 mRNA and sgRNA pairs (sgRNA1 and sgRNA2) generated by in vitro transcription were co-injected into fertilized eggs to produce knockout mice.
[0045] 2. Intrauterine Injection and Transfer of Fertilized Eggs
[0046] Six- to eight-week-old female mice were selected for superovulation induction. After mating with male mice, well-developed fertilized eggs were collected. A pair of sgRNAs (sgRNA1 and sgRNA2) targeting the mouse 1700031M16Rik gene, along with Cas9 mRNA, were injected into the fertilized mouse oocytes to initiate gene cleavage. The edited fertilized eggs were then introduced into pseudopregnant female mice for development, generating offspring with targeted knockout characteristics (F0 generation mice).
[0047] 3. Establishment of homozygous 1700031M16Rik gene knockout mice
[0048] F0 generation mice were crossed with wild-type mice to obtain heterozygous 1700031M16Rik gene knockout mice (F1 generation). Heterozygous F1 generation mice were intercrossed to obtain F2 generation mice. F2 generation mice of different sexes were intercrossed until homozygous 1700031M16Rik gene knockout mice were obtained.
[0049] Example 2: Validation of the 1700031M16Rik gene knockout mouse model
[0050] 1. Identification of mouse genotypes
[0051] (1) Experimental steps
[0052] Tissue excised from mouse tails was placed in 100 μL of 50 mM sodium hydroxide solution and heated at 95 °C for 60 min to dissolve and isolate mouse genomic DNA. The lysis buffer was then neutralized with 10 μL of Tris-HCl (pH=5.0). Primers were designed (Table 1) and DNA was amplified by PCR (reaction conditions shown in Table 2) to distinguish different genotypes from WT (wild type, 662 bp) to KO (homozygous, 800 bp).
[0053] Table 1 PCR primer sequences
[0054]
[0055] Table 2 PCR reaction conditions
[0056]
[0057] (2) Experimental results
[0058] like Figure 2 As shown in Figure A, the PCR results showed that the DNA band of the 1700031M16Rik gene knockout mouse was 800 bp, and the gene knockout mouse was successfully obtained.
[0059] 2. qPCR validation of the knockout of the 1700031M16Rik gene
[0060] (1) Experimental steps
[0061] Total RNA was extracted from the testes using Trizol reagent (Solarbio), and RNA concentration and quality were assessed by RNA electrophoresis. Reverse transcription of RNA was performed using the HiScript III RT SuperMix (+gDNA wipe) kit (Vazyme). qPCR primers were designed using Prime software (Table 3), and qPCR experiments were conducted on LightCycler96 using ChamQ Universal SYBR qPCR Master Mix (Vazyme). The raw data were normalized based on β-actin mRNA values.
[0062] Table 3 qPCR primer sequences
[0063]
[0064] (2) Experimental results
[0065] like Figure 2 As shown in Figure B, the qPCR results showed that the 1700031M16Rik gene transcript was missing in homozygous mice (KO group), and the gene knockout mouse was successfully constructed.
[0066] Example 3: Phenotypic evaluation of the 1700031M16Rik gene knockout low fertility model
[0067] 1. Fertility assessment
[0068] (1) Experimental steps
[0069] To study the fertility of male mice, the mice were divided into experimental and control groups. In the experimental group, one 2-month-old homozygous male mouse was mated with two 6-week-old wild-type female mice. Similarly, in the control group, one 2-month-old wild-type male mouse was mated with two 6-week-old wild-type female mice. The experimental group had at least five mated mice, while the control group maintained the same number. All mice were mated for four months. Pregnancy rates in the female mice and the number of pups per litter were recorded after mating.
[0070] (2) Experimental results
[0071] like Figure 3 As shown, the pregnancy rate of mice in the experimental group (KO) was significantly reduced. Figure 3 (A), and the litter size of the mice also decreased significantly ( Figure 3 (B)
[0072] 2. In vitro fertilization rate assessment
[0073] (1) Experimental steps
[0074] Five-week-old female wild-type mice were intraperitoneally injected with 10 IU of serum gonadotropin (CG), followed by a second injection of 10 IU of human chorionic gonadotropin (hCG) 48 h later. Sixteen h later, the mice were sacrificed by carbon dioxide asphyxiation to retrieve oocytes. The oocytes were evenly divided into two portions and placed in pre-equilibrated HTF droplets. Capacitated sperm from male mice in both the experimental and control groups were added around the oocytes to induce fertilization. Five h later, excess unfertilized sperm were removed, and the fertilized oocytes were transferred to KSOM culture droplets. The two-cell formation rate of the fertilized oocytes was assessed 24 h later.
[0075] (2) Experimental results
[0076] like Figure 3 As shown in Figure C, the two-cell formation rate and the number of in vitro fertilized eggs were reduced in the experimental group (KO) mice.
[0077] 3. Sperm morphology assessment
[0078] (1) Experimental steps
[0079] The epididymal tail of the mouse was isolated, and the sperm from the tail were released into preheated PBS solution at 37°C. The released sperm solution was then spread onto a glass slide at an appropriate concentration, and sperm morphology was observed using a Leica microscope. Characteristics of sperm malformation included small, numerous, or irregular sperm heads, or tail malformation characterized by a curled, bent, or broken tail. At least 200 sperm were counted from each mouse.
[0080] (2) Experimental results
[0081] like Figure 3 As shown in Figure D, the sperm abnormality rate of gene knockout mice (KO) was significantly higher than that of wild-type mice (WT).
[0082] The embodiments described above are only some, not all, of the embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments. The scope of protection of the present invention is determined by the scope claimed in the claims. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.
Claims
1. An sgRNA pair for constructing a mouse model of low fertility, characterized in that, The sgRNA pair consists of sgRNA1 and sgRNA2, the target sequence of sgRNA1 is shown in SEQ ID NO.1, and the target sequence of sgRNA2 is shown in SEQ ID NO.
2.
2. A CRISPR-Cas9 gene editing system for constructing a mouse model of low fertility, characterized in that, It comprises the sgRNA pair as described in claim 1, and the Cas9 nuclease or its encoding molecule.
3. A primer set for validating a 1700031M16Rik gene knockout mouse model constructed using the sgRNA pair as described in claim 1, characterized in that, Include: a) A pair of PCR amplification primers for genotype identification, the nucleotide sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4; and / or, b) A pair of qPCR primers for mRNA level validation, the nucleotide sequences of which are shown in SEQ ID NO.6 and SEQ ID NO.
7.
4. A kit for constructing and validating a mouse model of low fertility, characterized in that, Include: a) The sgRNA pair as described in claim 1, or the DNA molecule encoding the sgRNA pair; b) Cas9 nuclease, or mRNA or DNA molecules encoding Cas9 nuclease; c) The primer set as described in claim 3.
5. A method for constructing an in vitro model of low fertility in mice for non-diagnostic or therapeutic purposes, characterized in that, Includes the following steps: Step 1) The CRISPR-Cas9 gene editing system as described in claim 2 is introduced into mouse fertilized eggs or embryos, so that the sgRNA1 and sgRNA2 guide the Cas9 nuclease to generate double-strand breaks in the target region of the mouse 1700031M16Rik gene, and generate frameshift mutations through endogenous cellular repair, thereby obtaining F0 generation mice with 1700031M16Rik gene knockout; Step 2) Use the primer set as described in claim 3 to identify the genotype of the F0 generation mice or their offspring and / or verify the gene knockout efficiency, thereby screening for a stable genetic low-fertility mouse model.
6. The method for constructing an in vitro model of low fertility in mice for non-diagnostic or therapeutic purposes according to claim 5, characterized in that, In step 1), sgRNA1 and sgRNA2 target the region from exon 1 to exon 11 of the 1700031M16Rik gene on mouse chromosome 15. After the double-strand break is repaired by non-homologous end joining, the gene will undergo fragment deletion and / or base insertion / deletion, thereby introducing frameshift mutation.
7. A mouse model of low fertility, characterized in that, The mouse model is constructed by the method described in claim 5 or 6.
8. The use of the low fertility mouse model as described in claim 7 in screening or evaluating candidate drugs for improving fertility.
9. The application of the low-fertility mouse model as described in claim 7 in studying the biological function of long non-coding RNA 1700031M16Rik or the mechanism of low-fertility-related diseases.
Citation Information
Patent Citations
Improvement in lifting-jacks
US154961A