High-strength promoter, schizochytrium limacinum engineering bacteria based on promoter and application of schizochytrium limacinum engineering bacteria

Abstract

The invention relates to the technical field of gene engineering, and discloses a high-strength promoter, a schizochytrium limacinum engineering bacterium based on the promoter and application of the schizochytrium limacinum engineering bacterium. Phosphoric acid pantetheinyl transferase (PPTase) is a key rate-limiting enzyme for biosynthesis of docosahexaenoic acid. Four high-strength promoters which can be strongly expressed in a schizochytrium limacinum chassis are obtained through screening and comprise a P3431 promoter, a P5659 promoter, a P6631 promoter and a P4862 promoter, and the nucleotide sequences of the promoter are shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 respectively; furthermore, the high-strength promoter is connected with PPTase and is integrated into a schizochytrium limacinum genome, so that the yield of the docosahexaenoic acid is remarkably increased. After a P3431 promoter, a P5659 promoter, a P6631 promoter and a P4862 promoter are respectively connected with PPTase and are transferred into schizochytrium limacinum for expression, the docosahexaenoic acid yield is respectively increased by 25%, 37.5%, 43% and 36.5% compared with that of a wild type.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a high-strength promoter, an engineered strain of Schizochytrium based on the promoter driving the expression of phosphopanthenyl thioglycolate transferase, and its applications. Background Technology

[0002] Docosahexaenoic acid (DHA) is an omega-3 long-chain polyunsaturated fatty acid essential for human health. It plays an irreplaceable physiological role in infant brain and retinal development, adult cardiovascular health, and anti-inflammation. With increasing health awareness, the global DHA market demand continues to grow rapidly, with an estimated annual growth rate of approximately 16%. However, the current average dietary DHA intake is far below the recommended level, creating a significant supply-demand gap that urgently needs to be filled.

[0003] Traditionally, marine fish oil has been the primary commercial source of DHA. However, this production method faces numerous insurmountable problems. The main issues are as follows: First, sustainability is a concern, as overfishing has depleted marine fishery resources and threatened the marine ecological balance. Second, quality and stability are issues, as the content and composition of DHA in fish oil are significantly affected by factors such as fish species, season, and geographical environment, leading to inconsistent final product quality. Third, the extraction process is complex, requiring intricate extraction, refining, and deodorization processes from fish to high-purity DHA oil, resulting in high production costs.

[0004] Schizochytrium is a single-celled heterotrophic marine eukaryote and an ideal producer of DHA. It exhibits rapid growth and ease of cultivation, making it the optimal strain for DHA fermentation research. Currently, Schizochytrium is certified by the US FAD as one of the commercial strains for DHA production. However, the current DHA yield of Schizochytrium still falls short of the cost-effectiveness requirements for industrial production. Modifying Schizochytrium through metabolic engineering to increase its DHA production remains a key research focus. The core of metabolic engineering in Schizochytrium lies in achieving precise regulation of the expression intensity of specific genes. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a high-strength promoter, an engineered strain of Schizochytrium based on the promoter, and its applications.

[0006] The specific technical solution of this invention is as follows:

[0007] As a first aspect of the present invention, the present invention provides a high-strength promoter. The nucleotide sequence of the high-strength promoter is selected from the nucleotide sequences shown in SEQ ID NO.1 (P3431 promoter), SEQ ID NO.2 (P5659 promoter), SEQ ID NO.3 (P6631 promoter) or SEQ ID NO.4 (P4862 promoter).

[0008] As a second aspect of the present invention, the present invention provides a schizochytrium engineered strain that produces docosahexaenoic acid, wherein the genome of the engineered strain integrates an exogenous expression cassette, the exogenous expression cassette comprising a high-strength promoter and a phosphate pantothenic acid thioethylamine transferase (PPTase) encoding gene driven by the high-strength promoter.

[0009] The nucleotide sequence of the high-strength promoter is selected from one of the nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4.

[0010] Phosphopantothioethylamine transferase (PPTase) is a key rate-limiting enzyme in the biosynthesis of docosahexaenoic acid (DHA). This invention screened four high-strength promoters that were strongly expressed in the Schizochytrium chassis, including the P3431, P5659, P6631, and P4862 promoters, with nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively. Furthermore, this invention significantly increased DHA production by linking these high-strength promoters to PPTase and integrating them into the Schizochytrium genome. After linking the P3431, P5659, P6631, and P4862 promoters to PPTase and expressing them in Schizochytrium, DHA production increased by 25%, 37.5%, 43%, and 36.5%, respectively, compared to the wild type.

[0011] As a third aspect of the present invention, the present invention provides a method for constructing a Schizochytrium engineered strain that produces high levels of docosahexaenoic acid, comprising the following steps:

[0012] Step S1: Connect any one of the promoters shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 to the gene encoding phosphopantoylthioethylamine transferase, and then connect it to the expression vector to construct a recombinant expression vector;

[0013] Step S2: The recombinant expression vector is introduced into Schizochytrium to obtain engineered bacteria overexpressing PPTase.

[0014] As a preferred embodiment of the above method, the nucleotide sequence of the gene encoding the phosphopantoylthioethylamine transferase is shown in SEQ ID NO.5.

[0015] As a preferred embodiment of the above method, the recombinant expression vector is introduced into Schizochytrium via electroporation.

[0016] As a preferred embodiment of the above method, the expression vector is the pEX18GM plasmid.

[0017] Based on the above, as a fourth aspect of the present invention, the present invention provides an application of engineered Schizochytrium strains in the production of docosahexaenoic acid.

[0018] Based on the above, as a fifth aspect of the present invention, the present invention provides a method for producing docosahexaenoic acid, which includes the following steps: fermenting and culturing the above-mentioned Schizochytrium engineered strain, and then extracting DHA from the fermented cells.

[0019] Preferably, the fermentation medium contains: 40-80 g / L glucose, 5-15 g / L yeast powder, and 10-30 g / L sea salt.

[0020] Compared with the prior art, the present invention has the following technical effects:

[0021] Phosphopantothioethylamine transferase (PPTase) is a key rate-limiting enzyme in the biosynthesis of docosahexaenoic acid (DHA). This invention screened four high-strength promoters that were strongly expressed in the Schizochytrium chassis, including the P3431, P5659, P6631, and P4862 promoters, with nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively. Furthermore, this invention significantly increased DHA production by linking these high-strength promoters to PPTase and integrating them into the Schizochytrium genome. After linking the P3431, P5659, P6631, and P4862 promoters to PPTase and expressing them in Schizochytrium, DHA production increased by 25%, 37.5%, 43%, and 36.5%, respectively, compared to the wild type. Attached Figure Description

[0022] Figure 1 This is a comparison of the fluorescence intensity of 29 different promoters obtained in the initial promoter screening.

[0023] Figure 2This is a schematic diagram of the plasmid construction of the recombinant plasmid pEX18GM-Q(1-29).

[0024] Figure 3 This is a comparison chart of lipid content and DHA production between four engineered bacteria and wild-type Schizochytrium.

[0025] Figure 4 The gel image is used to verify plasmid transformation. Detailed Implementation

[0026] To address the problem of low docosahexaenoic acid (DHA) production in existing Schizochytrium fungi, this invention is provided.

[0027] The present invention will be further described below with reference to embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0028] First, in one embodiment, a high-strength promoter is provided. The nucleotide sequence of the high-strength promoter is selected from the nucleotide sequences shown in SEQ ID NO.1 (P3431 promoter), SEQ ID NO.2 (P5659 promoter), SEQ ID NO.3 (P6631 promoter) or SEQ ID NO.4 (P4862 promoter).

[0029] In another embodiment, a method for constructing a Schizochytrium engineered strain that produces high levels of docosahexaenoic acid is provided, comprising the following steps:

[0030] Step S1: Connect any one of the promoters shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 to the gene encoding phosphopantoylthioethylamine transferase, and then connect it to the expression vector to construct a recombinant expression vector;

[0031] Step S2: The recombinant expression vector is introduced into Schizochytrium to obtain engineered bacteria overexpressing PPTase.

[0032] Phosphopantothioethylamine transferase (PPTase) is a key rate-limiting enzyme in the biosynthesis of docosahexaenoic acid (DHA). In this embodiment, four high-strength promoters that are strongly expressed in the Schizochytrium chassis were screened, including the P3431, P5659, P6631, and P4862 promoters, with nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively. Furthermore, this embodiment achieved a significant increase in DHA production by linking these high-strength promoters with PPTase and integrating them into the Schizochytrium genome.

[0033] As a preferred embodiment of the above method, the nucleotide sequence of the gene encoding the phosphopantoylthioethylamine transferase is shown in SEQ ID NO.5.

[0034] Optionally, the recombinant expression vector is introduced into Schizochytrium via electroporation.

[0035] Optionally, the expression vector is the pEX18GM plasmid, but not limited to it. This embodiment uses the pEX18GM plasmid as an example to construct a recombinant expression vector for the gene combination linked to the aforementioned high-strength promoter and PPTase.

[0036] In another embodiment, the engineered Schizochytrium strain was fermented and cultured, and then DHA was extracted from the fermented cells. Experimental results showed that after the P3431, P5659, P6631, and P4862 promoters were linked to PPTase and expressed in Schizochytrium, the yield of docosahexaenoic acid (DHA) increased by 25%, 37.5%, 43%, and 36.5%, respectively, compared to the wild type.

[0037] Experimental verification shows that, optionally, the fermentation medium contains: 40-80 g / L glucose, 5-15 g / L yeast powder, and 10-30 g / L sea salt.

[0038] To make the present invention clearer and easier to understand, the following embodiments are provided. The embodiments of the present invention described below are generally only some embodiments of the present invention, and not all embodiments.

[0039] In the following examples, the culture media used consisted of the following compositions: GYP medium: 8 g / L yeast extract, 4 g / L glucose, 2 g / L peptone, 8 g / L sea salt crystals (solid medium containing 2% agar). Seed culture medium: 10 g / L yeast extract, 20 g / L glucose, 5 g / L peptone, 20 g / L sea salt crystals. Fermentation medium: 60 g / L glucose, 10 g / L yeast extract, 20 g / L sea salt crystals. LB medium: 10 g / L yeast extract, 20 g / L protein, 20 g / L sodium chloride. All the above culture media were autoclaved at 115 °C for 30 minutes.

[0040] In the following examples, the plasmid vector backbone pEX18GM used was a conventional plasmid, purchased commercially from Newp Biotechnology, product model v006439. The conventional plasmid pEX18GM carries the suicide marker gene SacB.

[0041] In the following examples, the competent cells were prepared as follows: the bacterial strain was streaked onto GYP solid medium and cultured at 27°C and 220 rpm for 48 h. Then, a single colony was picked and cultured in GYP liquid medium at 25°C and 220 rpm for 17 h. 100 μL of this liquid culture was then inoculated into seed culture medium and cultured at 27°C and 220 rpm for 17 h until the logarithmic growth phase (OD50) was reached. 600 (1.5~1.7). Collect the bacterial culture from the shake flasks, centrifuge at 4000 rpm for 10 min at 4°C to harvest cells in the logarithmic growth phase. Resuspend the cells in sterile water, centrifuge at 4000 rpm for 10 min at 4°C, wash once, and collect the bacterial cells. Resuspend the cells in 1M sterile pre-chilled sorbitol solution, centrifuge at 4000 rpm for 10 min at 4°C, and repeat the centrifugation and washing twice. Resuspend the bacterial cells in 1 mL of 1M sterile pre-chilled sorbitol solution, aliquot 100 μL into each tube to obtain competent cells, and store on ice for later use.

[0042] The primers and their sequences used in the following examples are shown in Table 1.

[0043] Table 1 ZT-R ATGGGTTAAAAAGGATCGATCCT ZT-F ATGTCCAAGGGTGAAGAGCTCTT PK-R AAATCACGGGCGTCGTGG PK-F TGACGTCACCATCGAGCTCG P-F ATGGCGGCCTTCGAAGGT P-R TTAGCAGCTAGATGCCTCTTCACTCT P3-R GCAACTCTTACGATGCAAGCG P3-F GATCTCTGTTTATTCTTTTCTCTACTGTCCTCTG P5-R, TCGCCGATCATTGCTCCTAA P5-F TCGTGCGATGTTTTTCATATCAGG P6-R GCCTTCCTTCCTCTCTCGCTTCAGCGCC P6-F TGTCGTAGTGTCTGCAATGAAATCTT P4-R GACCTGAAGATGCATGGACCTG P4-F CTTGCTGCTTTGGATTTATTCAC ZP-R GTAGAATTCCCTAGGGCGGC ZP-F-3 GGACAGTAGAGAAAAGAATAAACAGAGATC ZP-F-5 TGATATGAAAAACATCGCACG ZP-F-6 CGGAAGATTTCATTGCAGACACTACGAC ZP-F-4 ATCGATCCTTTTTAACCCATGACCTGAAGATGCATGGACCTG Y-F AGATGAGGGCAAGCGGATGG Y-R GCACTGGTCAACTTGGCCATAG FT-R CGGCATTTTCTTTTGCGTTTTTA ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ .

[0044] The PCR reaction system in the following examples is shown in Table 2.

[0045] Table 2 ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ <![CDATA[dd H2O]]> ​ .

[0046] Example 1: Initial screening of promoters

[0047] This embodiment is used for preliminary screening of strong promoters that can be expressed at high intensity in the Schizochytrium chassis. It includes the following steps:

[0048] Aurantiochytrium sp. YLH70 (a publicly available strain, purchased, accession number CCTCCNO: M2014215, deposited at the China Center for Type Culture Collection) was removed from a -80℃ ultra-low temperature freezer. 200 μL of this strain was inoculated into a 250 mL Erlenmeyer flask containing 50 mL of seed culture medium. The flask was placed in a constant temperature shaker at 27℃ and a rotation speed of 220 rpm for 120 hours. Bacterial cultures were collected at 48, 96, and 120 hours and then freeze-dried. Transcriptome analysis was performed on the cells at these three time points. Based on the transcriptome data, 29 gene groups with high expression at all three time points were screened. Sequencing revealed that the first 1500 bp of the amino acid sequence of these 29 genes were used as promoter sequences, suggesting the presence of strong promoters, resulting in 29 potential promoters.

[0049] Using plasmid pEX18GM as a template, reverse PCR was performed using primers FT-R and FT-F to amplify the fragment from which the SacB gene and its promoter were removed. The fragment was then recovered from the gel and preserved as a backbone. Using NCBI annotation, the whole genome was synthesized to obtain the bleomycin nucleotide sequence (BLE, accession number AFV14773.1), the green fluorescent protein sequence (GFP, accession number MW194930.1), and the CYC1 terminator sequence (nucleotide sequence shown in SEQ ID NO. 6). Primers BF, BR, GF, GR, CF, and CR were designed, and the three genes were ligated together using a one-step cloning method to obtain the ligation fragment GFP-BLE-CYC1. The original SacB marker sequence of pEX18GM was then replaced with the GFP-BLE-CYC1 sequence to obtain the pEX18GM-GBC plasmid.

[0050] Next, a fluorescent selection expression cassette was constructed. Specifically, 29 promoter sequences to be selected were cloned into the pEX18GM-GBC plasmid backbone using a one-step cloning method, resulting in 29 recombinant plasmids pEX18GM-Q(1-29), namely pEX18GM-Q1, pEX18GM-Q2, ..., pEX18GM-Q29. A schematic diagram of the plasmid construction of recombinant plasmid pEX18GM-Q(1-29) is shown below. ​ As shown, the 29 recombinant plasmids differ only in the promoter portion before GFP.

[0051] Next, pEX18GM-Q(1-29) was electroporated into Schizochytrium YLH70. In the Schizochytrium system, the intensity of green fluorescent protein expression—that is, the fluorescence intensity of each Schizochytrium carrying the exogenous plasmid—was analyzed to screen for high-intensity promoters and verify their strength. Specifically:

[0052] Primers XF and XR were designed to linearize the recombinant plasmid pEX18GM-Q(1-29) constructed in the above steps using reverse PCR. Schizochytrium competent cells were thawed on ice. 10 μL of the linearized recombinant plasmid pEX18GM-Q(1-29) was added to 100 μL of Schizochytrium competent cells and incubated on ice for 10 minutes. The electroporation cuvette was pre-chilled in a refrigerator. The competent cells, after being incubated on ice, were placed in the cuvette and incubated on ice for 10 minutes. The electroporation parameters were set to 2.0 kV, 500 Ω, 50 μF, and a duration of 6–8 ms. After electroporation, 1 mL of seed culture medium was added. After recovery at 28°C and 220 rpm for 3 hours, the transformed bacterial culture was cultured at 27°C for 48 hours on a GYP solid resistance selection plate containing 200 μg / L bleomycin.

[0053] PCR verification was performed using validation primers PK-R and PK-F to confirm successful plasmid transformation. The best-growing transformants were then selected and cultured in shake flasks at 220 rpm and 28°C for 48 h. The fermentation broth was collected, centrifuged at 8000 rpm for 5 minutes, the supernatant was discarded, and the broth was washed three times with sterile water. 50 mL of sterile water was added to resuspend the washed bacterial cells, and each group was diluted to the same OD value. 600 The value was (0.5~0.6). Fluorescence was detected using flow cytometry to confirm that the promoter enabled the fluorescent protein to function properly.

[0054] The fluorescence intensity of the diluted bacterial culture was measured using an ELISA reader, with the fluorescence intensity of the wild-type strain considered as 1. Finally, the fluorescence intensity was analyzed to determine the final result. ​ As shown, promoters with different efficiencies were obtained, and a promoter library belonging to Schizochytrium was constructed. Among them, promoters P3431, P5659, P6631, and P4862 showed the best performance. Their amplification primers were P3-R, P3-F, P5-R, P5-F, P6-R, P6-F, and P4-R, P4-F, and the fluorescence intensities were 2.45 times, 2.33 times, 2.14 times, and 2.09 times that of the wild type, respectively. This indicates that promoters P3431, P5659, P6631, and P4862 can significantly enhance the expression intensity of the fluorescent protein GFP.

[0055] The promoters P3431, P5659, P6631, and P4862 have nucleotide sequences as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively, and are carried by plasmids pEX18GM-Q3, pEX18GM-Q11, pEX18GM-Q16, and pEX18GM-Q9.

[0056] Example 2: Construction of engineered Schizochytrium strains

[0057] This embodiment uses the four high-strength promoters screened in Example 1 to drive the expression of the target gene PPTase, constructing four engineered strains of Schizochytrium. The steps are as follows:

[0058] The phosphate pantothenic acid thioglycolate (PPTase) gene was amplified from Schizochytrium YLH70 by PCR using primers PF and PR. After gel recovery, the amplified protein was stored at -20°C. The nucleotide sequence of the phosphate pantothenic acid thioglycolate gene is shown in SEQ ID NO. 5.

[0059] Using plasmid pEX18GM-Q3 obtained in Example 1 as a template and primers ZP-F-3 / ZP-R, pEX18GM-Q11 as a template and primers ZP-F-5 / ZP-R, pEX18GM-Q16 as a template and primers ZP-F-6 / ZP-R, and pEX18GM-Q9 as a template and primers ZP-F-4 / ZP-R, four vector fragments without green fluorescent protein sequences were obtained by reverse PCR. Subsequently, the vector fragments obtained above were ligated with the PPTase gene fragment using a one-step cloning method, replacing the fluorescent protein gene in the pEX18GM-Q plasmid with the PPTase gene, to construct recombinant plasmids pEX18GM-PPT-3, pEX18GM-PPT-5, pEX18GM-PPT-6, and pEX18GM-PPT-4. The recombinant plasmids pEX18GM-PPT-3, pEX18GM-PPT-5, pEX18GM-PPT-6, and pEX18GM-PPT-4 drive PPTase gene expression via promoters P3431, P5659, P6631, and P4862, respectively.

[0060] The four overexpression recombinant plasmids were transformed into Schizochytrium YLH70 using electroporation, the method being the same as in Example 1. The cells were incubated at 27°C for 48 h on GYP solid antibiotic selection plates containing 200 μg / L bleomycin. The resulting Schizochytrium engineered strains were labeled L-1, L-2, L-3, and L-4, respectively. Transformants were picked, validated using primers YR and YF, and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing to ensure successful transformation into Schizochytrium and correct ligation of all fragments. The validation gel image is shown below. Figure 4 As shown, the actual band size meets the theoretical band size requirement (2645 bp). Subsequent passages were performed for three generations to obtain stably inherited transformants.

[0061] Example 3 Fermentation Culture

[0062] In this embodiment, four engineered Schizochytrium strains constructed in Example 2 were fermented to obtain the target product, docosahexaenoic acid (DHA). The steps are as follows:

[0063] (1) Fermentation broth acquisition: The engineered bacteria L-1, L-2, L-3, and L-4 obtained in Example 2, as well as the wild-type Schizochytrium, were inoculated into 50 mL of seed culture medium and cultured at 27°C and 220 r / min for 17 h to obtain seed broth. Subsequently, the seed broth was inoculated into the fermentation medium at an inoculation rate of 1% and cultured at 27°C and 220 r / min for 120 h. The fermentation broth obtained after culture was collected, washed and resuspended with sterile water, freeze-dried, and stored at -20°C.

[0064] (2) Lipid extraction: Take 0.2 g of lyophilized bacterial powder, add 1.2 mL of 4M hydrochloric acid, vortex, react at room temperature for 60 minutes, then boil in a water bath for 30 minutes, and immediately freeze at -80℃. Add 2 mL of chloroform-methanol solution 1:1 (v:v), shake vigorously, and centrifuge at 3000 rpm for 15 min. Take the lower chloroform layer, add an equal volume of 0.1% sodium chloride solution, mix well, and centrifuge at 3000 rpm for 15 min. Collect the chloroform layer, centrifuge at 55℃ to concentrate until the mass no longer changes. Measure the weight of the lipids obtained at this time.

[0065] (3) DHA extraction and determination: 10 mg of lyophilized bacterial powder was ground, and 500 μL of KOH-methanol solution was added for saponification at 60℃ for 1 h. Then, 500 μL of 14% BF was added for methyl esterification for 1 h. Finally, 500 μL of n-hexane and saturated saline solution were added for extraction for 30 min. The extracted fatty acid methyl esters were analyzed by gas chromatography. The gas chromatography conditions were: HP-INNOWAX column (30 m × 0.25 mm × 0.25 μL, Agilent Technologies), with nitrogen as the carrier gas, and analyzed by Shimadzu GC-2014. The relative content of DHA was calculated by the peak area normalization method. A standard curve of the relationship between DHA concentration and peak area was prepared using the standard DHA methyl ester sample as a control. The DHA yield of wild-type Schizochytrium and L-1, L-2, L-3, and L-4 was calculated accordingly.

[0066] (4) Results of DHA and lipid production are as follows Figure 4 As shown, the total lipid content of wild-type Schizochytrium accounted for 46.3% of the total biomass, while the lipid content of L-1, L-2, L-3, and L-4 accounted for 54.7%, 49.1%, 58.4%, and 51.2% of the total biomass, respectively. All four engineered strains increased the total lipid content of Schizochytrium. Meanwhile, the DHA production of wild-type Schizochytrium was 3.14 g / L, while the DHA production of L-1, L-2, L-3, and L-4 was 3.94 g / L, 4.32 g / L, 4.49 g / L, and 4.28 g / L, respectively, representing increases of 25%, 37.5%, 43%, and 36.5% compared to the wild-type.

[0067] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0068] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A high-strength promoter, characterized in that: The nucleotide sequence of the high-strength promoter is selected from one of the nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.

4.

2. A Schizochytrium engineered strain that produces high levels of docosahexaenoic acid, characterized by: The genome of the engineered bacteria integrates an exogenous expression cassette, which contains a high-strength promoter and a phosphate pantothenic acid thioethylamine transferase encoding gene driven by the high-strength promoter. The nucleotide sequence of the high-strength promoter is selected from the nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.

4.

3. A method for constructing a Schizochytrium engineered strain that produces high levels of docosahexaenoic acid, characterized in that: Step S1: Connect any one of the promoters shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 to the gene encoding phosphopantoylthioethylamine transferase, and then connect it to the expression vector to construct a recombinant expression vector; Step S2: The recombinant expression vector is introduced into Schizochytrium to obtain engineered bacteria overexpressing PPTase.

4. The method as described in claim 3, characterized in that: The nucleotide sequence of the gene encoding the phosphate pantothenic acid thioethylamine transferase is shown in SEQ ID NO.

5.

5. The method as described in claim 3, characterized in that: The recombinant expression vector was introduced into Schizochytrium via electroporation.

6. The method as described in claim 3, characterized in that: The expression vector is the pEX18GM plasmid.

7. The application of the engineered Schizochytrium strain as described in claim 2 or the engineered Schizochytrium strain constructed by the method described in any one of claims 3 to 6 in the production of docosahexaenoic acid.

8. A method for producing docosahexaenoic acid, characterized in that: Includes the following steps: The Schizochytrium engineered strain as described in claim 2 or the Schizochytrium engineered strain constructed by the method described in any one of claims 3 to 6 is fermented and cultured, and then DHA is extracted from the fermented cells.

9. The method as described in claim 8, characterized in that: The fermentation medium contains: 40-80 g / L glucose, 5-15 g / L yeast powder, and 10-30 g / L sea salt.

Images