SiRNA (small interfering ribonucleic acid) for interfering codling moth CmHsp20-12 gene as well as synthesis method and application of siRNA
By synthesizing siRNA that interferes with the CmHsp20-12 gene of the codling moth, and using RNA interference technology to reduce its expression, the problem of tolerance to high temperature stress was solved, and effective control of the codling moth was achieved, providing a new molecular target and technical approach.
Patent Information
- Application Number
- CN202511804493.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-03
- Publication Date
- 2026-02-27
AI Technical Summary
In the existing technology, the molecular response mechanism of codling moth to environmental stresses such as high temperature is relatively limited, especially the functional research on members of the low molecular weight HSP20 family, which affects the screening and utilization of target genes in molecular control strategies such as RNAi, and limits the understanding of the temperature tolerance mechanism of codling moth.
We designed and synthesized siRNAs that interfere with the CmHsp20-12 gene of the codling moth. By using RNA interference technology to reduce the mRNA expression level of the CmHsp20-12 gene, and by delivering the siRNAs into the larvae of the codling moth, we significantly reduced their tolerance to high temperature stress.
Significantly reducing the expression of the CmHsp20-12 gene leads to a decrease in the tolerance of codling moth larvae to high-temperature stress and an increase in mortality, providing a new molecular target and technical approach, and offering a new method for the green control of codling moth.
Smart Images

Figure CN121574989A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, specifically to interfering with the heat shock proteins of the codling moth. CmHsp20-12 siRNA of genes, its synthesis methods and applications. Background Technology
[0002] Apple codling moth ( Cydia pomonella The codling moth (Gnaphalium affineum) is a globally widespread fruit tree pest, primarily damaging apple, pear, peach, plum, and other kernel and stone fruit trees. The larval stage is the main damaging stage; the larvae bore into the fruit to feed on the pulp, causing abnormal fruit development, rotting, or premature drop. They can also move between different fruits to feed, severely impacting fruit marketability and tree yield. Due to its concealed feeding habits, multiple generations, and long damage cycle, field control is quite difficult. The codling moth poses a serious threat to fruit tree production and is listed as one of my country's quarantine pests.
[0003] With the increasing frequency of global agricultural trade and the diversification of logistics and transportation methods, the codling moth has spread to more than 70 countries worldwide, covering almost all major apple and pear producing regions. Studies have shown that temperature is one of the important environmental factors affecting the distribution and spread of the codling moth, contributing up to 66.6%. The codling moth has strong temperature tolerance and can adapt to a wide temperature range, which provides conditions for its survival and spread in different ecological environments.
[0004] For a long time, due to the widespread use of chemical pesticides and biological control agents, the codling moth population has developed significant tolerance to various conventional control measures. RNA interference (RNAi) technology, as an emerging molecular biological control strategy, has advantages such as high target specificity, low risk of pesticide resistance, and environmental friendliness, and has broad application prospects in green pest control compared to traditional chemical pesticides and specific biological agents. However, to achieve efficient application of RNAi technology in the control of the codling moth, the key lies in screening and validating target genes closely related to its development and environmental adaptability.
[0005] Heat shock proteins (HSPs) are a class of highly conserved molecular chaperone proteins widely found in plants, animals, and microorganisms. They play a crucial role in organisms' response to environmental stress, especially under adverse conditions such as high temperatures. Members of the HSP20 family have molecular masses of approximately 15–42 kDa and exhibit high sequence diversity within the family. However, their C-terminus contains a relatively conserved α-crystallin domain of about 80–100 amino acids, making them typical ATP-dependent molecular chaperones. These proteins typically bind to other proteins under adverse conditions, inhibiting their denaturation or aggregation, maintaining protein structural stability and biological function, and are of great significance for insect survival and adaptation.
[0006] Currently, research on the molecular response mechanisms of the codling moth to environmental stresses such as high temperatures is relatively limited. Existing studies have shown that heat shock proteins play a central role in insect stress responses, but most research focuses on high molecular weight families such as HSP70 and HSP90, with limited research on the functions of low molecular weight HSPs (i.e., the HSP20 family). Particularly in the codling moth, the number, expression characteristics, and specific roles of HSP20 family members in high-temperature stress adaptation remain unclear. Furthermore, different HSP members exhibit significant differences in tissue-specific expression and heat response patterns, and their potential functions have not yet been systematically elucidated. The lack of in-depth research on key HSP20 genes limits our understanding of the temperature tolerance mechanisms of the codling moth and also affects the screening and utilization of target genes in molecular control strategies such as RNAi (RNA interference). Summary of the Invention
[0007] In view of this, the object of the present invention is to provide a method to interfere with the codling moth. CmHsp20-12 Gene siRNA, its synthesis method and application: By delivering siRNA into the larvae of the codling moth, it can significantly reduce... CmHsp20-12 The mRNA expression level of the gene was monitored to achieve effective silencing. After gene silencing, the tolerance of codling moth larvae to high temperature stress decreased significantly, and the mortality rate increased significantly, indicating that... CmHsp20-12 Genes play a key role in the regulation of heat stress response and tolerance, providing new molecular targets and technical approaches for the green control of codling moth.
[0008] In a first aspect, the present invention provides a method for interfering with the codling moth. CmHsp20-12 The siRNA of the gene, the nucleotide sequence of which is shown in SEQ ID No. 1-2.
[0009] As mentioned above, the codling moth that interferes with apple production CmHsp20-12 The siRNA of the gene, CmHsp20-12The nucleotide sequence of the gene is shown in SEQ ID No. 3.
[0010] Secondly, the present invention provides a method to interfere with the codling moth. CmHsp20-12 The method for synthesizing gene siRNA includes the following steps: S1. Two pairs of complementary single-stranded oligonucleotides are annealed to form two pairs of double-stranded templates; S2. Transcribe the two pairs of double-stranded templates to obtain sense RNA and antisense RNA, respectively; S3. The sense RNA and the antisense RNA are subjected to annealing hybridization and enzyme digestion to obtain siRNA.
[0011] As described above, the two pairs of complementary single-stranded oligonucleotides include Oligonucleotides A1, Oligonucleotides A2, Oligonucleotides B1, and Oligonucleotides B2. The nucleotide sequence of Oligonucleotides A1 is shown in SEQ ID No. 4; the nucleotide sequence of Oligonucleotides A2 is shown in SEQ ID No. 5; the nucleotide sequence of Oligonucleotides B1 is shown in SEQ ID No. 6; and the nucleotide sequence of Oligonucleotides B2 is shown in SEQ ID No. 7.
[0012] Thirdly, the present invention provides the application of siRNA as described above or siRNA synthesized by the synthesis method described above in the control of codling moth.
[0013] Fourthly, the present invention provides a formulation for controlling codling moths of the apple tree, wherein the active ingredient of the formulation includes siRNA as described above or siRNA obtained by the synthesis method described above.
[0014] The preparations described above are used in a manner including at least one of injection, feeding, soaking, and spraying.
[0015] Fifthly, the present invention provides an apple codling moth. CmHsp20-12 Gene screening methods include the following steps: Based on the reference genome of the codling moth, the HSP20 gene family of the codling moth was identified. Larvae containing the HSP20 gene family were subjected to high-temperature stress treatment, and RNA was extracted for transcriptome sequencing to obtain the expression profile of the HSP20 family genes under high-temperature stress. By analyzing the expression profile data, genes were screened...CmHsp20-12 Gene.
[0016] As mentioned above, the codling moth CmHsp20-12 The gene screening method involves a high-temperature stress treatment at a temperature of 35-38°C.
[0017] Sixthly, the present invention provides a method to interfere with the codling moth. CmHsp20-12 Methods for analyzing gene expression include the following steps: Total RNA was extracted from the codling moth with the introduced siRNA gene, and cDNA was synthesized by reverse transcription. Using the cDNA as a template, amplification was performed in the same RT-PCR system. CmHsp20-12 Simultaneous amplification of primer pairs obtained from gene design and primer sets of internal reference genes CmHsp20-12 The gene and the internal reference gene are used to obtain the... CmHsp20-12 The Ct value of the gene and the Ct value of the internal reference gene; According to the above CmHsp20-12 Analysis of Ct values of genes and Ct values of the internal reference gene. CmHsp20-12 Gene expression levels.
[0018] The present invention, employing the above-described solution, has at least the following beneficial effects: 1. This invention is based on the codling moth of the apple tree. CmHsp20-12 The nucleotide sequence of the gene was designed and siRNA was synthesized. The siRNA was then delivered into the larvae of the codling moth, which significantly reduced... CmHsp20-12 The mRNA expression level of a gene is monitored to achieve effective silencing of that gene. CmHsp20-12 Gene silencing significantly reduced the tolerance of codling moth larvae to high-temperature stress and increased mortality, indicating that... CmHsp20-12 Genes play a crucial role in the regulation of heat stress response and tolerance.
[0019] 2. This invention discloses for the first time CmHsp20-12 Investigating the physiological function of genes in the thermal adaptation of the codling moth provides a method for regulating the heat sensitivity of pests based on RNA interference technology, offering new molecular targets and technical approaches for the green control of the codling moth. Attached Figure Description
[0020] This application can be further illustrated by the non-limiting embodiments given in the accompanying drawings; Figure 1 In Embodiment 1 of this application CmHsp20-12 Gene expression profiles for screening; Figure 2 In Embodiment 1 of this application CmHsp20-12 Figure showing gene expression after induction at 36℃ for 1 hour; Figure 3In embodiment 2 of this application, si CmHsp20-12 Electrophoresis results image; Figure 4 In this embodiment 3, si CmHsp20-12 Silence efficiency test results graph; Figure 5 In this embodiment 3 CmHsp20-12 Comparison of mortality rates of codling moth larvae after gene silencing under 43℃ and 4h treatment conditions. Detailed Implementation
[0021] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. In current research, the molecular response mechanisms of the codling moth to high-temperature stress are relatively limited. Existing studies have shown that heat shock proteins play a central role in insect stress responses, but most research focuses on high molecular weight families such as HSP70 and HSP90, with limited research on the functions of low molecular weight HSPs (i.e., the HSP20 family). Particularly in the codling moth, the number, expression characteristics, and specific roles of HSP20 family members in high-temperature stress adaptation remain unclear. Furthermore, different HSP members exhibit significant differences in tissue-specific expression and heat response patterns, and their potential functions have not been systematically elucidated. The lack of in-depth research on key HSP20 genes limits our understanding of the temperature tolerance mechanisms of the codling moth and also affects the screening and utilization of target genes in molecular control strategies such as RNAi.
[0022] In view of this, the inventors, through systematic identification, sequence alignment, and expression characteristic analysis of the HSP20 family genes of the codling moth, discovered... CmHsp20-12 The gene was significantly induced to express under high-temperature stress, suggesting its potential involvement in the temperature response and heat tolerance regulation process of the codling moth. Further functional verification of the gene using RNA interference (RNAi) technology showed that… CmHsp20-12 It has the function of promoting heat resistance in the larvae of the codling moth, thus providing a new technical basis and application approach for the molecular control of the codling moth and the research on the regulation of the heat adaptation of pests.
[0023] Firstly, this application provides a method to interfere with the codling moth. CmHsp20-12The gene contains a double-stranded siRNA. The double-stranded siRNA consists of a sense strand and an antisense strand. The nucleotide sequence of the sense strand is shown below: 5′-GCAUGGGAUCGAGGGAGUAUA-3′ (SEQ ID No. 1); the nucleotide sequence of the antisense strand is shown below: 5′-UAUACUCCCUCGAUCCCAUGC-3′ (SEQ ID No. 2). By introducing the double-stranded siRNA into the larvae of the codling moth (A. coleoptile), the exogenous or endogenous double-stranded siRNA is recognized and unwound by the RISC complex. The retained lead strand pairs with its perfectly complementary target mRNA, allowing core components such as AGO2 to cleave the mRNA at the pairing region. The cleaved mRNA is then rapidly degraded by the cell, blocking protein translation and thus significantly reducing [the risk of protein loss / damage]. CmHsp20-12 The mRNA expression level of genes can be used to achieve control over the expression of genes. CmHsp20- 12 Effective gene silencing. After gene silencing, the tolerance of codling moth larvae to high-temperature stress decreased significantly, and the mortality rate increased markedly. This indicates... CmHsp20-12 Genes play a key role in the regulation of heat stress response and tolerance, providing new molecular targets and technical approaches for the green control of codling moth.
[0024] In one embodiment of the present invention, CmHsp20-12 The nucleotide sequence of the gene is shown below: ATGTCACTTATGCCGTATTGGGCGCGTCATTTAAGGAATCTGGCCCTTCGGTGATCCTATCGCAAGGGCATTTGAGGATCCTTTCGCTGTCTTCGCTCGCGATCCGTTCTTCCGCGACCCGATAAAGT TCATCAAGGAAGCAACAGCGCCCCTTCAGCATGGGATCGAGGGAGTATACTCCGACGCAGAAGTTAAAGTCGACGGGAAGAAAGTTGAAGTGCATTTAGACGTGCAGAATTTCACTCCAGATCAGAT CCAGGTGAAGACAGTCGGGAACGAAATCATGGTTGAAGGAAAAAAGGAGGTGAAACGCGAGGATGGTTGGACCAGGAGCCATTTTGAGAGGAGATTCCTGCTTCCTGAAGGTTTTCCTCCGGAAAGAGTTGAGTGCCATCTGGATAAGGGGAAGCTGCTGCTAGTCGCCTTCAGATCTGAGCCTCTAGAAGAGAGGACCATCAAGATCAACACCAAGGAACAGAAGGAGCCGGAGAAGATTGAGAAGTAG (SEQ ID No. 3). By screening out the main expressed genes of the codling moth's tolerance to high temperatures, it is beneficial to subsequently target and interfere with the expression of these genes, thereby achieving green control of the codling moth.
[0025] Secondly, the present invention provides a method to interfere with the codling moth. CmHsp20-12 The method for synthesizing gene siRNA includes the following steps: S1. Two pairs of complementary single-stranded oligonucleotides are annealed to form two pairs of double-stranded templates; S2. Transcribe the two pairs of double-stranded templates to obtain sense RNA and antisense RNA, respectively; S3. The sense and antisense RNAs were annealed and hybridized, and then digested with enzymes to obtain siRNA.
[0026] In the process of synthesizing siRNA, two pairs of complementary single-stranded oligonucleotides are used as the starting point to synthesize two pairs of double-stranded templates first, which can reduce the risk of degradation and ensure transcription efficiency. Then, in vitro transcription is performed, which can precisely control the synthesis of the sense and antisense strands and ensure sequence accuracy. Finally, annealing hybridization can ensure that the sense and antisense strands are correctly paired to form an interfering dsRNA intermediate. Enzymatic digestion generates siRNA of the length required by the RNAi mechanism, thus ensuring its function.
[0027] In one embodiment of the invention, the two pairs of complementary single-stranded oligonucleotides include Oligonucleotides A1, Oligonucleotides A2, Oligonucleotides B1, and Oligonucleotides B2.
[0028] Specifically, Oligonucleotides A1 and Oligonucleotides A2 are used as a pair of complementary single-stranded oligonucleotides; Oligonucleotides B1 and Oligonucleotides B2 are used as another pair of complementary single-stranded oligonucleotides.
[0029] Specifically, the nucleotide sequence of Oligonucleotides A1 is shown in SEQ ID No. 4: GATCACTAATACGACTCACTATAGGGCATGGGATCGAGGGAGTATATT (SEQ ID No. 4).
[0030] Specifically, the nucleotide sequence of Oligonucleotides A2 is shown in SEQ ID No. 5: AATATACTCCCTCGATCCCATGCCCTATAGTGAGTCGTATTA GTGATC (SEQ ID No. 5) Specifically, the nucleotide sequence of Oligonucleotides B1 is shown in SEQ ID No. 6: AAGCATGGGATCGAGGGAGTATAACCTATAGTGAGTCGTATTAGTGATC (SEQ ID No. 6).
[0031] Specifically, the nucleotide sequence of Oligonucleotides B2 is shown in SEQ ID No. 7: GATCACTAATACGACTCACTATAGGTATACTCCCTCGATCCCATGCTT (SEQ ID No. 7).
[0032] In one embodiment of the present invention, in step S1, the reaction system for annealing includes: RNase-free H2O, Oligonucleotides A1, Oligonucleotides A2, Oligonucleotides B1, Oligonucleotides B2 and Annealing Buffer.
[0033] In the above technical solution, when synthesizing one pair of double-stranded templates, the annealing reaction system consists of RNase-free H2O, Oligonucleotides A1, Oligonucleotides A2, and Annealing Buffer. When synthesizing the other pair of double-stranded templates, the annealing reaction system consists of RNase-free H2O, Oligonucleotides B1, Oligonucleotides B2, and Annealing Buffer. By annealing the two pairs of complementary single-stranded oligonucleotides separately, the precise pairing of the two double-stranded templates can be guaranteed.
[0034] Furthermore, the Annealing Buffer uses a 10x concentrated Annealing Buffer.
[0035] The annealing procedure for synthesizing double-stranded templates included: denaturation at 95°C for 2 min, annealing at 65.8°C for 658 s, and final extension at 22°C for 10 min. Annealing yielded two 10 μM DNA templates, i.e., two pairs of double-stranded templates. These two pairs of double-stranded templates are designated DNA template 1 and DNA template 2. DNA template 1 was obtained from the components listed in Table 1 through annealing. DNA template 2 was obtained from the components listed in Table 2 through annealing.
[0036] In one embodiment of the invention, in vitro transcription is performed during the transcription of two pairs of double-stranded templates. The in vitro transcription process is carried out overnight at 37°C in a PCR instrument.
[0037] Specifically, during in vitro transcription, the transcription system includes NTP Mix, Transcription Buffer, T7Enzyme Mix, DNA Template 1, DNA Template 2, and RNase-free H2O. By selecting specific promoters, the synthesis of the sense and antisense strands can be precisely controlled, ensuring sequence accuracy, and large-scale amplification can be achieved through overnight reaction at 37°C in a PCR instrument.
[0038] Furthermore, the Transcription Buffer uses a 10x concentrated Transcription Buffer.
[0039] Furthermore, during the overnight reaction in the PCR instrument at 37°C, the reaction program was as follows: 37°C for 720 min for one cycle, followed by holding at 4°C.
[0040] In one embodiment of the present invention, the product after enzymatic digestion is further purified to obtain siRNA.
[0041] Specifically, two enzymes are used for enzymatic digestion: DNase I and RNase T1.
[0042] Specifically, ammonium acetate is used for purification during the purification process.
[0043] In one embodiment of the present invention, the annealing hybridization procedure includes: denaturation at 95°C for 2 min, annealing at 65.8°C for 658 s, and final extension at 22°C for 10 min.
[0044] Thirdly, the present invention provides the application of siRNA as described above or siRNA synthesized by the above synthesis method in the control of codling moth.
[0045] In one embodiment of the present invention, during the control of the codling moth, the aforementioned siRNA is introduced into the codling moth to silence its activity. CmHsp20-12 Genes. For example, the introduction method could be by injecting double-stranded siRNA into the abdomen of a codling moth larva.
[0046] Fourthly, the present invention provides a formulation for controlling codling moths of the apple tree, wherein the active ingredient of the formulation includes siRNA as described above or siRNA obtained by the synthesis method described above.
[0047] In one embodiment of the present invention, the method of using the formulation includes at least one of injection, feeding, soaking, and spraying. No specific limitations are imposed in this embodiment.
[0048] Fifthly, the present invention provides an apple codling moth. CmHsp20-12 Gene screening methods include the following steps: Based on the reference genome of the codling moth, the HSP20 gene family of the codling moth was analyzed and identified. Larvae containing the HSP20 gene family were subjected to high-temperature stress treatment, and RNA was extracted for transcriptome sequencing to obtain the expression profile of the HSP20 family genes under high-temperature stress. By analyzing the expression profile data, genes were screened... CmHsp20-12 Gene.
[0049] Specifically, the codling moth CmHsp20-12 The gene screening method can be as follows: Based on a high-quality chromosome-level reference genome of the codling moth, all members of the HSP20 gene family of the codling moth were analyzed and identified. By subjecting the first day of fifth-instar larvae to 1 hour of high-temperature stress, RNA was extracted and transcriptome sequencing was performed to obtain the expression profile of the HSP20 family genes under high-temperature stress. By analyzing this expression profile data, genes with significant changes in expression levels under high-temperature stress were screened, thus obtaining... CmHsp20-12Genes. The screening method of this invention is scientific and reasonable, simple to operate, and accurate in providing results. It can screen out codling moths that are most significantly affected by temperature. CmHsp20-12 Gene.
[0050] In this invention, a high-quality chromosome-level reference genome of the codling moth can be downloaded from the following website: http: / / v2.insect-genome.com / Organism / 224. Alternatively, refer to: Wan F, Yin C, Tang R, et al. A chromosome-level genome assembly of Cydia pomonella This provides insights into chemical ecology and insecticide resistance. Nature Communications. 2019;10(1):4237. A high-quality chromosome-level reference genome of the codling moth was obtained.
[0051] In one embodiment of the present invention, the temperature during the high-temperature stress treatment is 35-38°C. For example, the temperature can be 35°C, 36°C, 37°C, 38°C, or any range between the above.
[0052] In this embodiment, the temperature during the high-temperature stress treatment was 36°C, while the control temperature, 26°C, was the optimal temperature for the growth of codling moth larvae. Through high-temperature stress treatment, genes expressing responses to high-temperature stress in the larvae may participate in temperature tolerance stress, thereby allowing for the screening of genes with high-temperature tolerance.
[0053] Sixthly, the present invention provides a method to interfere with the codling moth. CmHsp20-12 Methods for analyzing gene expression include the following steps: Total RNA was extracted from the codling moth with the introduced siRNA gene, and cDNA was synthesized by reverse transcription. Using the cDNA as a template, amplification was performed in the same RT-PCR system. CmHsp20-12 Simultaneous amplification of primer pairs obtained from gene design and primer sets of internal reference genes CmHsp20-12 Genes and internal reference genes were obtained. CmHsp20-12 Ct values of the gene and the internal reference gene; according to CmHsp20-12 Ct value analysis of genes and Ct value analysis of internal reference genes CmHsp20-12 Gene expression levels.
[0054] The present invention provides interference with codling moths. CmHsp20-12 Gene expression analysis methods can overcome potential experimental differences during sample preparation and detection, providing a basis for the analysis of gene expression in the codling moth.CmHsp20-12 This invention provides practical assistance for the accurate identification of gene expression levels. Furthermore, the method offered by this invention is simple to operate, yields accurate results, and is suitable for large-scale operations.
[0055] The methods for preparing codling moth material with siRNA gene introduced, extracting RNA from the material, and reverse transcribing RNA to obtain cDNA samples are conventional techniques in the field, and this invention does not impose any limitations on them.
[0056] In one embodiment of the present invention, the method for preparing codling moth material infused with siRNA gene is as follows: Fifth instar larvae of uniform size on day 1 are selected as experimental subjects. The siRNA gene is injected into the abdomen of the larvae using a microinjection system. Samples of the treated codling moth larvae are collected at different time points, namely 12h, 24h, 36h, and 48h, after injection of the interfering siRNA gene. All samples are immediately flash-frozen in liquid nitrogen after collection and stored at -80℃.
[0057] In one embodiment of the present invention, the method for extracting RNA from the material is as follows: Take 50-100 mg of codling moth larvae sample, grind them thoroughly in a mortar containing liquid nitrogen until the codling moth larvae sample is in powder form, and then use the Fast Pure Universal Plant Total RNA Isolation Kit produced by Novizan to extract total RNA from the codling moth larvae sample.
[0058] In one embodiment of the present invention, the method for obtaining cDNA samples by reverse transcription of RNA is as follows: the extracted total RNA is reverse transcribed to obtain cDNA products using the HiScript IV RT SuperMix for qPCR (+gDNA wiper) kit manufactured by Novizan.
[0059] Furthermore, to better facilitate subsequent RT-qPCR, the concentration of the cDNA product can be detected and controlled to generate a cDNA template more suitable for RT-qPCR. For example, in one embodiment of the present invention, the OD260 / 280 value of the cDNA product can be measured using a ThermoNanoDrop 2000c, and the cDNA product can be diluted 10-fold to obtain a cDNA template for subsequent real-time quantitative PCR.
[0060] Next, regarding CmHsp20-12 Genes need to be based on CmHsp20-12 Designing primer pairs based on gene sequences. The methods for designing primer pairs are conventional techniques in the field, and those skilled in the art can design them as needed; this invention does not limit such designs.
[0061] Subsequently, using the aforementioned cDNA sample as a template, in the same RT-qPCR amplification system... CmHsp20-12 Simultaneous amplification of primer pairs obtained from gene design and primer sets of internal reference genes CmHsp20-12 Genes and internal reference genes can be obtained CmHsp20-12 Amplification curves of the gene and internal reference gene were obtained, and then... CmHsp20-12 The Ct value of the gene and the Ct value of the internal reference gene. It is understandable that this is achieved by utilizing... CmHsp20-12 The primer set obtained by gene design will amplify CmHsp20-12 Gene sequence: The sequence of the internal reference gene can be obtained by amplifying it using primers for the internal reference gene.
[0062] The Ct value (cycle threshold) is the number of amplification cycles at which the fluorescence signal of the amplified product reaches a set fluorescence threshold during RT-qPCR amplification. It is a relative measurement of gene expression abundance in the RT-qPCR reaction. However, besides gene expression abundance, some experimental factors may also affect the Ct value, thus influencing the experimenter's understanding of its potential impact. CmHsp20-12 The gene expression abundance of a gene can lead to incorrect judgments.
[0063] Therefore, this invention introduces an internal reference gene that can still be stably expressed at high temperatures, namely... EF-1α and RPL12 Genes, and analyze them using the Ct value of the gene. CmHsp20-12 Gene expression levels.
[0064] in, EF-1α (elongation factor-1alpha) The nucleotide sequence is shown below: ATGGGCAAGGAAAAGATTCACATTAACATCGTCGTGATCGGACACGTCGACTCCGGCAAGTCCACCAC CACCGGCCACTTGATTTACAAATGCGGTGGTATCGACAAACGTACCATCGAGAAGTTCGAGAAGGAGGCCCAGGAG ATGGGTAAGGGCTCCTTCAAGTACGCGTGGGTGTTGGACAAGCTTAAGGCTGAGCGTGAGCGTGGTATCACCATCG ATATCGCCCTGTGGAAGTTCGAGACCGCAAAGTACTACGTGACCATCATCGATGCTCCTGGACACAGGGATTTCAT CAAAAACATGATCACTGGTACCTCACAGGCTGATTGCGCCGTGCTCATCGTTGCCGCCGGTACTGGTGAGTTCGAG GCCGGTATCTCCAAGAACGGCCAGACCCGCGAGCACGCCCTGCTCGCCTTCACCCTTGGTGTGAAGCAGCTGATCG TGGGCGTCAACAAGATGGACTCCACTGAGCCCCCATACAGTGAGTCCCGTTTCGAGGAAATCAAGAAGGAAGTCTC CTCGTACATCAAGAAGATTGGTTACAACCCAGCTGCCGTCGCTTTCGTACCCATTTCTGGCTGGCACGGAGACAAC ATGCTGGAGGCGTCCACTAAGATGCCCTGGTTCAAGGGATGGCAGATTGAGCGCAAGGAAGGCAAGGCTGAAGGCA AGTGCCTCATCGAGGCTCTTGACGCCATCCTGCCCCCTGCCCGCCCCACAGACAAGGCCCTGCGTCTGCCCCTGCA GGACGTGTACAAAATCGGCGGTATTGGTACGGTGCCCGTAGGCCGTGTCGAGACTGGTATTCTCAAGCCTGGCACC ATCGTCGTGTTCGCGCCCGCCAACATCACCACTGAAGTAAAGTCCGTGGAGATGCACCACGAGGCCCTCCAGGAGG CCGTGCCCGGCGACAACGTCGGTTTCAACGTCAAGAACGTGTCCGTTAAGGAGCTGCGTCGTGGCTACGTCGCTGG CGACTCCAAGAACAACCCCCCTAAGGGTGCCGCAGACTTCACCGCACAGGTCATCGTGCTCAACCACCCCGGACAG ATTTCAAACGGCTACACGCCTGTGCTCGATTGCCACACAGCCCACATTGCCTGCAAATTCGCAGAAATCAAAGAGA AGGTTGACCGTCGTACCGGCAAATCCACTGAAGATAACCCCAAATCCATCAAATCGGGAGATGCTGCCATCGTCAA CCTGGTCCCCTCCAAGCCTCTGTGCGTGGAGTCCTTCCAGGAGTTCCCTCCTCTCGGTCGTTTCGCCGTGCGTGAC ATGAGGCAGACGGTCGCTGTAGGTGTCATCAAGGCTGTCAACTTCAAGGAGGCTGGTGGTGGCAAGGTCACCAAAG CTGCCGAGAAGGCCACCAAGGGCAAGAAGTAG( SEQ ID No. 14 )。
[0065] The nucleotide sequence of RPL12 (ribosomal protein L12) is shown below: (SEQ ID No.15). Example 1
[0066] Identification of the Hsp20 gene family sequence of the codling moth Based on the genome sequence of the codling moth, the Hidden Markov Model (HMM) file of the conserved domain (α-crystal protein domain, Pfam number PF00011) of the HSP20 family was obtained from the Pfam database. The HMMER software was used to perform alignment screening with an E-value ≤ 1e-5 as the threshold. Subsequently, the integrity of the conserved domains in the candidate sequences was verified by alignment with the Conserved Domain Database. Sequences with missing or truncated domains were removed, and the HSP20 family genes of the codling moth were integrated to obtain the genome.
[0067] The heat-resistant gene of the codling moth CmHsp20-12 Gene screening Fifth instar larvae of the codling moth (Caryota macrantha) were subjected to a 1-hour high-temperature stress treatment at 36 °C. Following this treatment, RNA-Seq sequencing was performed on the larvae. Larvae treated at 26 °C for 1 hour served as a control group. The obtained transcriptome data were analyzed for differential expression using bioinformatics methods. Specifically, the raw transcriptome data underwent quality control using FastQC software, low-quality reads were filtered using Trimmomatic software, and clean reads were aligned to the Codling Moth reference genome using HISAT2. The read count matrix for each gene was then calculated using StringTie software. This matrix was then used as input data for differential expression analysis using DESeq2 software. The screening threshold for gene expression differences was set at padj < 0.05 and |log2FC| ≥ 1. Differentially expressed Hsp20 genes were selected. CmHsp20-12 Genes. For example... Figure 1 As shown, from Figure 1 From this, we can know that: CmHsp20-12 The genes showed a high degree of significance compared to the control group. P The value is less than 1.39 × 10 -59 The upregulation was 15.34-fold, showing highly significant upregulation, suggesting that this gene has a heat-resistant response in the codling moth and may have a potential function of high-temperature resistance.
[0068] in, CmHsp20-12 The nucleotide sequence of the gene is shown below: ATGTCACTTATGCCGTATTGGGCGCGTCATTTAAGGAATCTGGCCCTTCGGTGATCCTATCGCAAGGGCATTTGAGGATCCTTTCGCTGTCTTCGCTCGCGATCCGTTCTTCCGCGACCCGATAAAGT TCATCAAGGAAGCAACAGCGCCCCTTCAGCATGGGATCGAGGGAGTATACTCCGACGCAGAAGTTAAAGTCGACGGGAAGAAAGTTGAAGTGCATTTAGACGTGCAGAATTTCACTCCAGATCAGAT CCAGGTGAAGACAGTCGGGAACGAAATCATGGTTGAAGGAAAAAAGGAGGTGAAACGCGAGGATGGTTGGACCAGGAGCCATTTTGAGAGGAGATTCCTGCTTCCTGAAGGTTTTCCTCCGGAAAGA GTTGAGTGCCATCTGGATAAGGGGAAGCTGCTGCTAGTCGCCTTCAGATCTGAGCCTCTAGAAGAGAGGACCATCAAGATCAACACCAAGGAACAGAAGGAGCCGGAGAAGATTGAGAAGTAG (SEQ ID No. 3).
[0069] Real-time quantitative PCR (qPCR) was used to... CmHsp20-12 The expression level was detected under high temperature stress of 36℃. CmHsp20-12 The expression level of the control group treated at 26℃ served as a control. The qPCR reactions were performed using the Vazyme SYBR Green system. Each 20 μL reaction volume consisted of: 10 μL 2× qPCR Master Mix, 0.4 μL upstream primer (10 µM), 0.4 μL downstream primer (10 µM), 1 μL cDNA, and 8.2 μL ddH2O. The qPCR program was: 95℃ pre-denaturation for 30–60 s; followed by 40 cycles, including 95℃ for 10–15 s and 60℃ for 30 s.
[0070] In qPCR, select EF-1α and RPL12 As an internal reference gene, it is used for the target detection gene. CmHsp20-12 The Ct value is normalized. EF-1α and RPL12Its expression is relatively stable across different treatment groups and time points, therefore it can be used as an internal control gene to correct for technical differences in RNA initiation amount, reverse transcription efficiency, and sample loading error between samples. Through... EF-1α and RPL12 Standardizing the internal control improves the accuracy and comparability of gene expression quantification results, thereby ensuring the reliability of subsequent biological conclusions. After amplification, melting curve analysis was performed (65–95 ℃, with gradual temperature increases and fluorescence acquisition). The upstream and downstream primers used in real-time quantitative PCR are shown in Table 1, and the detection results are as follows: Figure 2 As shown.
[0071] The results showed that after high-temperature stress of 36 ℃, CmHsp20-12 The transcriptional level of the gene was significantly upregulated, with the highest level observed 1 hour after treatment. CmHsp20-12 The gene expression level increased by approximately 22.66 times compared to the control, indicating... CmHsp20-12 Genes play an important role in the high-temperature tolerance of the codling moth.
[0072] Table 1 Primer name Primer sequence 5′→3′ Serial Number GGTCCCCTCCAAGCCTCTGT SEQ ID No. 8 CTCGGCAGCTTTGGTGACCT SEQ ID No. 9 CGACTGGAAGGGCCTCAAGA SEQ ID No. 10 TTGCCGCTGTGCTTGATGTT SEQ ID No. 11 -F GAGTTGAGTGCCATCTGGATAAGG SEQ ID No. 12 -R GCTCCTTCTGTTCCTTGGTGTTG SEQ ID No. 13 Example 2
[0073] Apple codling moth CmHsp20-12 Synthesis of gene siRNA Based on the selected CmHsp20-12 The gene was commissioned to Shanghai Sangon Biotech to design and synthesize four single-stranded oligonucleotides: Oligonucleotides A1, Oligonucleotides A2, Oligonucleotides B1, and Oligonucleotides B2. The sequences of the four single-stranded oligonucleotides are shown in Table 2.
[0074] Table 2 The four synthesized single-stranded oligonucleotides were annealed to form two pairs of double-stranded templates. Annealing system 1 consisted of: 14 μL RNase-free H₂O, 2 μL 100 μM Oligonucleotides A1, 2 μL 100 μM Oligonucleotides A2, and 2 μL 10 × Annealing Buffer. After centrifugation and remixing, the mixture was annealed on a PCR instrument at 95°C for 2 min, followed by denaturation at 65.8°C for 658 s, and a final extension at 22°C for 10 min. This yielded 10 μM DNA template 1.
[0075] Annealing system 2 consisted of: 14 μL RNase-free H2O, 2 μL 100 μM Oligonucleotides B1, 2 μL 100 μM Oligonucleotides B2, and 2 μL 10 × Annealing Buffer. After centrifugation and remixing, annealing was performed on a PCR instrument: denaturation at 95°C for 2 min, annealing at 65.8°C for 658 s, and final extension at 22°C for 10 min. This yielded 10 μM DNA template 2.
[0076] DNA template 1 and DNA template 2 were transcribed in vitro using the Novizan T7 RNAi Transcription Kit TR102, and then reacted overnight at 37°C in a PCR instrument to obtain sense and antisense RNA. The transcription system consisted of: 8 μL NTP Mix, 2 μL 10 × Transcription Buffer, 2 μL T7 Enzyme Mix, 2.5 μL DNA template 1, 2.5 μL DNA template 2, and 3 μL RNase-free H2O.
[0077] After transcription, annealing hybridization and enzymatic digestion were performed, and the transcripts were incubated at 37°C for 30 min. The digested transcripts were then subjected to electrophoresis and purification to obtain double-stranded siRNA.
[0078] The enzymatic digestion system includes: 20 μL of Transcription Product, 17 μL of RNase-free H2O, 1 μL of DNase I, and 2 μL of RNase T1 (10 U / μL).
[0079] During the electrophoresis detection of transcription products, DNA fragments were separated using 4% agarose gel electrophoresis, and an M5HiClear 20 bp DNA ladder was used as the molecular weight standard. The electrophoresis results are as follows: Figure 3 As shown. From Figure 3 As can be seen from the data, there are 6 clear bands in the 20bp range, which indicates that the required siRNA has been successfully synthesized. Subsequently, we purified the PCR product to obtain pure siRNA.
[0080] During the purification process of the transcription products, the ammonium acetate purification method was used, as detailed below: (1) If the electrophoresis shows that the bands are correct and single (i.e., all 6 bands are the same siRNA), then transfer the incubated system to a 1.5 mL RNase-free centrifuge tube and add 60 μL Nuclease-free Water to make the total system volume 100 μL; (2) Add 10 μL of 5M Ammonium Acetate to the system and vortex mix it. (3) Add 3 times the volume (330 μL) of 100% anhydrous ethanol to the centrifuge tube and vortex to mix. (4) Place the mixture in a -20 ℃ refrigerator for 30 min; (5) Centrifuge at 12,000 rpm for 15 min in a 4 ℃ low-temperature high-speed centrifuge to precipitate the siRNA; (6) Discard the supernatant, add 1 mL of 75% ethanol solution, and repeat step (5); (7) Discard the supernatant, and after the ethanol has evaporated, add 20 μL of DEPC water to dissolve the precipitate; (8) Take 1 μL of the siRNA solution after vortexing and add 9 μL of DEPC water to dilute it 10 times. Use a Nanophotometer P330 to detect its concentration. The concentration should be above 5000 µg / mL. Example 3
[0081] Apple codling moth CmHsp20-12 RNAi experiments with isogens (1) CmHsp20-12 Gene microinjection The codling moth population used in this embodiment was collected from Jiuquan City, Gansu Province, China. The obtained codling moth larvae were reared on artificially prepared feed, while the adults were placed in oviposition boxes lined with gauze, and were provided with fresh water regularly for feeding. Laboratory rearing conditions were controlled as follows: temperature 26±1℃, relative humidity (RH) 75±5%, and a photoperiod of 16 hours light: 8 hours darkness.
[0082] Fifth instar larvae of uniform size, on day 1, were selected as experimental subjects. 3 mg was injected into the abdomen of the larvae using a microinjection system. siCmHsp20-12 (siRNA) was used for gene interference experiments, with siNC (purchased from Genewiz, its nucleotide sequence is: UUCUCCGAACGUGUCACGU SEQ ID No. 16) injected as a negative control. Each experiment was performed in triplicate, with 2 larvae used in each replicate.
[0083] (2) CmHsp20-12 Detection of gene silencing efficiency Based on the above method, the interfering fragment si was injected. CmHsp20-12Samples of treated codling moth larvae were collected at different time points (12h, 24h, 36h, and 48h). All samples were immediately flash-frozen in liquid nitrogen and stored at -80℃. Total RNA was extracted from the codling moth larvae samples using the Fast Pure Universal Plant Total RNA Isolation Kit (Novozymes), and the extracted total RNA was reverse transcribed into cDNA products using the HiScript IV RTSuperMix for qPCR (+gDNA wiper) kit (Novozymes). EF-1α and RPL12 Genes as internal references, designed EF-1α and RPL12 The primer set of the gene, and then based on CmHsp20-12 Gene-designed primer pairs were used for detection via real-time quantitative PCR (RT-qPCR). CmHsp20-12 The gene expression levels, including the internal reference gene and the primers used for RT-qPCR, are shown in Table 1.
[0084] Each experiment was conducted in triplicate, with each replicate containing two larvae. The test results are as follows: Figure 4 As shown, at each time point CmHsp20-12 Gene expression levels all showed a decreasing trend, with the largest decrease occurring at 12 h of treatment, where gene expression levels decreased by 57.10%. P <0.001).
[0085] (3) High-temperature treatment after RNAi increased the mortality rate of codling moths. Based on the aforementioned experiments, the test results showed that 12 hours after siRNA treatment... CmHsp20-12 Gene silencing is most effective. Therefore, high-temperature lethal treatment was performed 12 hours after siRNA injection. The specific method was as follows: Apple codling moths treated with siRNA for 12 hours (…) Cydia pomonella The larvae were treated at 43°C for 4 hours. Following the same procedure, siNC injection was used as a negative control group. The results were as follows: Figure 5 As shown.
[0086] The results showed that, CmHsp20-12 When gene expression was silenced, the mortality rate of larvae significantly increased after treatment at 43℃, reaching 58.33%, which was significantly higher than the mortality rate of 8.33% in the negative control group (siNC group). P <0.001). This result indicates CmHsp20-12 Genes involved in the tolerance of codling moth larvae to high temperature stress are key factors in regulating the heat tolerance of codling moths and are also potential targets for high temperature control.
[0087] In conclusion, based on the codling moth... CmHsp20-12 The nucleotide sequence of the gene was designed and siRNA was synthesized. Injecting the siRNA into the larvae of the codling moth significantly reduced... CmHsp20-12 The mRNA expression level of a gene is monitored to achieve effective silencing of that gene. CmHsp20-12 Gene silencing significantly reduced the tolerance of codling moth larvae to high-temperature stress and increased mortality, indicating that... CmHsp20-12 Genes play a crucial role in the regulation of heat stress response and tolerance. And revealed... CmHsp20-12 The physiological function of genes in the thermal adaptation of the codling moth provides new molecular targets and technical approaches for the green control of the codling moth.
[0088] It should be noted that: for experimental steps or conditions not specified in the examples, the procedures and conditions described in conventional experimental procedures in the literature of this art can be followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional reagent products.
[0089] The above examples are provided to better understand the present invention and are not limited to the preferred embodiments described. They do not constitute a limitation on the content and scope of protection of the present invention. Any product that is the same as or similar to the present invention, derived by anyone under the guidance of the present invention or by combining the features of the present invention with other prior art, falls within the scope of protection of the present invention.
Claims
1. A type of pest that interferes with the codling moth CmHsp20-12 The siRNA of a gene is characterized by, The nucleotide sequence of the siRNA is shown in SEQ ID No. 1-2.
2. The interference with codling moths according to claim 1 CmHsp20-12 The siRNA of a gene is characterized by, The CmHsp20-12 The nucleotide sequence of the gene is shown in SEQ ID No.
3.
3. A method for interfering with the codling moth as described in any one of claims 1-2 CmHsp20-12 A method for synthesizing siRNA of a gene, characterized in that, Includes the following steps: S1. Two pairs of complementary single-stranded oligonucleotides are annealed to form two pairs of double-stranded templates; S2. Transcribe the two pairs of double-stranded templates to obtain sense RNA and antisense RNA, respectively; S3. The sense RNA and the antisense RNA are subjected to annealing hybridization and enzyme digestion to obtain siRNA.
4. The interference moth according to claim 3 CmHsp20-12 A method for synthesizing siRNA of a gene, characterized in that, The two pairs of complementary single-stranded oligonucleotides include Oligonucleotides A1, Oligonucleotides A2, Oligonucleotides B1, and Oligonucleotides B2; The nucleotide sequence of Oligonucleotides A1 is shown in SEQ ID No. 4; the nucleotide sequence of Oligonucleotides A2 is shown in SEQ ID No. 5; the nucleotide sequence of Oligonucleotides B1 is shown in SEQ ID No. 6; and the nucleotide sequence of Oligonucleotides B2 is shown in SEQ ID No.
7.
5. The application of siRNA as described in any one of claims 1-2 or siRNA synthesized by the synthetic method described in any one of claims 3-4 in the control of codling moth.
6. A formulation for controlling the codling moth of the apple tree, characterized in that, The active ingredient of the formulation includes siRNA as described in any one of claims 1-2 or siRNA obtained by the synthetic method as described in any one of claims 3-4.
7. The formulation according to claim 6, characterized in that, The method of application of the preparation includes at least one of injection, feeding, soaking, and spraying.
8. A type of codling moth CmHsp20-12 The gene screening method is characterized by, Includes the following steps: Based on the reference genome of the codling moth, the HSP20 gene family of the codling moth was identified. Larvae containing the HSP20 gene family were subjected to high-temperature stress treatment, and RNA was extracted for transcriptome sequencing to obtain the expression profile of the HSP20 family genes under high-temperature stress. By analyzing the expression profile data, genes were screened... CmHsp20-12 Gene.
9. The interference moth according to claim 8 CmHsp20-12 The gene screening method is characterized by, During the high-temperature stress treatment, the temperature is 35-38℃.
10. A type of codling moth that interferes with apple growth. CmHsp20-12 A method for analyzing gene expression, characterized in that, Includes the following steps: Total RNA was extracted from the codling moth with the introduced siRNA gene, and cDNA was synthesized by reverse transcription. Using the cDNA as a template, amplification was performed in the same RT-PCR system. CmHsp20-12 Simultaneous amplification of primer pairs obtained from gene design and primer sets of internal reference genes CmHsp20-12 The gene and the internal reference gene are used to obtain the... CmHsp20-12 The Ct value of the gene and the Ct value of the internal reference gene; According to the above CmHsp20-12 Analysis of Ct values of genes and Ct values of the internal reference gene. CmHsp20-12 Gene expression levels.