Hot spot self-assembly colorimetric-Raman sensing platform and escherichia coli detection method

Abstract

The invention discloses a hot spot self-assembly colorimetric-Raman sensing platform and an escherichia coli detection method, the hot spot self-assembly colorimetric-Raman sensing platform comprises an isothermal amplification system, a CRISPR-dCas9 system, GNPs-probe and SA-GNPs, a target bacterial gene is taken as a DNA template, RPA amplification is carried out through the isothermal amplification system, and a double-chain amplification product modified by terminal biotin is obtained; the CRISPR-dCas9 system is used for targeted recognition of a double-chain amplification product modified by terminal biotin to form a composite product; gNPs-probe is composed of gold nanoparticles, a Raman signal molecule and a DNA probe, and the GNPs-probe is combined with the stem-loop structure of the sgRNA of the composite product through the DNA probe; sA-GNPs is combined with the biotin of the composite product through streptavidin; gNPs-probe and SA-GNPs are assembled on the composite product, so that a colorimetric-Raman sensing platform for detecting target bacteria is formed. According to the present invention, the cross validation of the generated colorimetric, ultraviolet and Raman multi-mode signals is adopted to improve the result reliability, the isothermal amplification and the self-assembly hot spot are adopted to enhance the multiple sensibilization detection signal, and the specificity is enhanced based on the specific primer group and the CRISPR-dCas9 system mediated secondary recognition, such that the rapid and accurate detection of the bacteria in the actual sample is finally achieved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological detection, in particular to a hotspot self-assembly colorimetric-Raman sensing platform based on a CRISPR-dCas9 system and an Escherichia coli detection method. BACKGROUND

[0002] Pathogenic bacteria pollution is a widespread and costly public health problem. Pathogenic bacteria enter the human body through food, water, air and other media, causing diseases and posing a serious threat to human health. Foodborne diseases caused by foodborne pathogenic bacteria rank among the top of the total incidence rate of various diseases, seriously endangering food hygiene and safety. At present, traditional bacterial culture and colony counting are the standard methods for detecting pathogenic bacteria, but these methods are complex, time-consuming and labor-intensive, and the detection results are easily affected by the environment. Serological methods, such as enzyme-linked immunosorbent assay (ELISA), based on specific antigen-antibody interactions, can detect different types of bacteria, but the required reagents are usually expensive and the sensitivity is generally insufficient. Colorimetric methods can be directly observed with the naked eye, simplifying the process, but are often limited by low detection limits and relatively low detection sensitivity. Polymerase chain reaction (PCR) and real-time quantitative polymerase chain reaction (qPCR) have high specificity and sensitivity, but they rely on professional operators and require continuous power supply for thermal cycler instruments, which are not suitable for on-site detection. Isothermal amplification techniques such as recombinase polymerase amplification (RPA) have reduced the requirement for temperature during the amplification process due to their simplicity, efficiency and cost-effectiveness, making them a popular amplification method. However, RPA amplification is easily disturbed by primer dimerization and non-target amplification caused by exogenous genes, leading to false positives. How to avoid primer dimerization and non-target amplification interference has become a key problem that needs to be solved.

[0003] In addition, traditional detection methods often only output one signal, and due to environmental background light, detection system complexity and other factors, the accuracy and reliability of single signal mode face serious challenges. Therefore, constructing a multi-modal signal cooperative detection system will help break through the technical bottleneck of single signal mode of existing methods, improve sensitivity, accuracy and repeatability, and achieve accurate detection. SUMMARY

[0004] The present application relates to the technical field of biological detection, in particular to a hotspot self-assembly colorimetric-Raman sensing platform based on a CRISPR-dCas9 system and an Escherichia coli detection method.

[0005] To achieve the above-mentioned purpose, the present application provides the following technical solutions:

[0006] The hotspot self-assembly colorimetric-Raman sensing platform comprises an isothermal amplification system, a CRISPR-dCas9 system, GNPs-probe and SA-GNPs, the isothermal amplification system comprises a specific primer group with terminal biotin modification, and a target bacterial gene is taken as a DNA template; the RPA amplification is carried out through the isothermal amplification system, and a double-stranded amplification product with terminal biotin modification is obtained;

[0007] The CRISPR-dCas9 system comprises a dCas9 protein and sgRNA, and is used for targeted recognition of the double-stranded amplification product with terminal biotin modification, so as to form a complex product, wherein the sgRNA has a stem loop structure as a universal hybridization site;

[0008] The GNPs-probe is composed of gold nanoparticles, a Raman signal molecule and a DNA probe, and the GNPs-probe is combined with the stem loop structure of the sgRNA of the complex product through the DNA probe;

[0009] The SA-GNPs are composed of gold nanoparticles and streptavidin (SA), and the SA-GNPs are combined with the biotin of the complex product through the streptavidin;

[0010] The complex product is combined with the GNPs-probe and the SA-GNPs, so as to form a colorimetric-Raman sensing platform for detecting the target bacteria.

[0011] According to the present application, the complex product after the targeted recognition of the CRISPR-dCas9 system is taken as a template, the GNPs-probe and the SA-GNPs are combined, so that the GNPs-probe in a dispersed state is changed into a nuclear satellite assembly structure with the SA-GNPs as a core, a color signal is generated, and a large number of hot spots are formed, which can cause strong Raman signals.

[0012] According to a further scheme of the present application, the target bacteria are specifically Escherichia coli, and the specific primer group with terminal biotin modification comprises an upstream primer and a downstream primer, the sequence of the upstream primer is shown in SEQ ID NO. 1, and the sequence of the downstream primer is shown in SEQ ID NO. 2;

[0013] The sequence of the sgRNA is shown in SEQ ID NO. 3;

[0014] The sequence of the DNA probe is shown in SEQ ID NO. 4.

[0015] According to a further scheme of the present application, the target bacterial gene is obtained from a bacterial sample through a heating lysis method, the heating temperature of the heating lysis method is 80-100 DEG C, and the heating time is 3-6 min.

[0016] As a further scheme of the present application, the concentration of the upstream primer and the downstream primer is 100-1000 nmol / L, the reaction temperature of the isothermal amplification system is 30-40℃, and the reaction time is 20-30 min.

[0017] As a further scheme of the present application, the preparation method of the GNPs-probe comprises the following steps:

[0018] A1, mixing 2.5 μL of thiolated DNA probe with a concentration of 40 μM, 4 μL of TCEP solution with a concentration of 0.5 mM, and 5 μL of acetic acid buffer with a concentration of 100 mM (pH 5.2), and incubating in the dark for 0.5-1 h;

[0019] A2, adding the activated DNA probe to 100 μL of 10-fold concentrated gold nanoparticles, and mixing and incubating for 1 h to allow the two to fully bind;

[0020] A3, adding 1-10 μL of 5% BSA (bovine serum albumin) solution, and incubating at room temperature for 1 h to block the sites on the gold nanoparticles that are not coupled with the probe;

[0021] A4, centrifuging at 8000-10000 rpm for 10-20 min to remove excess reactants and impurity ions, and dispersing the obtained GNPs-probe precipitate with 50-100 μL of resuspension liquid, and repeating the centrifugation for 2 times.

[0022] As a further scheme of the present application, the preparation method of the SA-GNPs comprises the following steps:

[0023] B1, adding 10-20 μL of potassium carbonate with a concentration of 0.1 M, and 4-8 μL of SA solution with a concentration of 1 mg / mL to 1 mL of gold nanoparticle solution, and incubating at room temperature for 1 h;

[0024] B2, adding 50-150 μL of 10% BSA (bovine serum albumin) solution, and incubating at room temperature for 1 h;

[0025] B3, centrifuging at 8000-10000 rpm for 10-20 min to remove excess reactants and impurity ions, and resuspending the obtained SA-GNPs with 100 μL of resuspension liquid.

[0026] As a further scheme of the present application, the resuspension liquid comprises 1 mM Tris-HCl, 5% BSA, 0.25% Tween-20, and 10% sucrose, and the pH is 8.0.

[0027] As a further scheme of the present application, the concentration of dCas9 in the CRISPR-dCas9 system is 50-500 nmol / L, and the concentration of sgRNA is 40-400 nmol / L.

[0028] An E. coli detection method based on the hotspot self-assembly colorimetric-Raman sensing platform described above, comprising the following steps:

[0029] S1, preparing E. coli solutions of various standard concentrations;

[0030] S2, lysing and extracting E. coli genes;

[0031] S3, using E. coli genes as a DNA template, performing RPA amplification through an isothermal amplification system to obtain double-stranded amplification products modified with biotin at the ends;

[0032] S4, target recognition of the double-stranded amplification products modified with biotin at the ends through a CRISPR-dCas9 system to form a complex product;

[0033] S5, assembling GNPs-probe and SA-GNPs through the complex product to form a colorimetric-Raman sensing platform for detecting target bacteria, performing colorimetric, ultraviolet and Raman signal detection, and establishing a quantitative relationship between the three signals and the content of E. coli;

[0034] S6, extracting an unknown concentration of E. coli sample to be tested, and performing colorimetric, ultraviolet and Raman signal detection through the same processing method as steps S2-S5, and based on the quantitative relationship, the concentration of E. coli in the sample to be tested can be obtained.

[0035] Compared with the prior art, the present application has the following beneficial effects:

[0036] 1, based on the target recognition and binding function of the CRISPR-dCas9 system, the base complementary pairing principle and the high affinity of streptavidin-biotin, the present application constructs a self-assembly isothermal sensing detection platform of nucleic satellite structure, the colorimetric-Raman sensing platform assembled by the platform uses the cross verification of the colorimetric, ultraviolet and Raman multi-modal signals generated to improve the reliability of the results, enhances the multiple sensitive detection signals through isothermal amplification and self-assembly hotspots, enhances the specificity through specific primer groups and secondary recognition mediated by the CRISPR-dCas9 system, and finally realizes the rapid and accurate detection of bacteria in actual samples.

[0037] 2, the present application provides a universal binding site by designing an sgRNA expanded stem loop structure, realizes the hybridization of GNPs-probe with a specific sequence (DNA probe), reduces the repeatability and complexity of probe design, and improves the flexibility and universality of detection.

[0038] 3、The present application can perform rapid and sensitive analysis in a short time by using the precise recognition function of CRISPR / dCas9, the signal sensitization effect of ultraviolet and Raman technology, and the rapid amplification advantage of RPA, thereby greatly improving the timeliness of the method. BRIEF DESCRIPTION OF DRAWINGS

[0039] Figure 1 The principle diagram for detecting the present application is shown.

[0040] Figure 2 The feasibility analysis diagram of the target pathogenic bacteria E. coli for detecting the present application is shown, wherein A-C are colorimetric analysis diagram, ultraviolet absorption spectrum diagram and Raman spectrum diagram respectively, and D is the characteristic peak signal intensity diagram of Raman spectrum at 1079 cm -1 .

[0041] Figure 3 The sensitivity analysis diagram related to the detection of the present application is shown, wherein A is the colorimetric analysis diagram, B is the ultraviolet absorption spectrum diagram, C is the standard curve diagram of ultraviolet absorption value at 520 nm, D is the Raman spectrum diagram, E is the characteristic peak signal intensity diagram collected from 1079 cm -1 of diagram D, and F is the standard curve diagram of characteristic peak signal intensity at 1079 cm -1 .

[0042] Figure 4 The specificity analysis diagram related to the detection of the present application is shown, wherein A is the colorimetric analysis diagram; B is the ultraviolet absorption spectrum diagram; C is the Raman spectrum diagram; D is the characteristic peak signal intensity diagram collected from 1079 cm -1 of diagram C. DETAILED DESCRIPTION

[0043] The technical solutions in the embodiments of the present application will be described clearly and completely in combination with the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.

[0044] 1、Reagents and instruments

[0045] HAuCl4·4H2O was purchased from Aladdin Reagent Co., Ltd. (Shanghai, China). 10×PBS buffer (pH 7.4), Tris-HCl buffer (pH 8.0), Tween-20, sucrose, bovine serum albumin (BSA), polyethylene glycol 20000, DEPC-treated water, acetic acid, sodium hydroxide, TCEP, 4-ATP, sodium citrate (Na3Cit) and streptavidin (SA) were purchased from Shengong Biotech Co., Ltd. (Shanghai, China). All primers and probes were ordered from Shengong Biotech Co., Ltd. (Shanghai, China), and the specific sequence information is shown in Table 1.

[0046] Table 1 Gene sequence designed in the application

[0047] Serial number Sequence NO.1 Biotin-GCGTAGAGTGGGAACACGTC NO.2 AGTGCTGGCAGGACGGTGGA NO.3 CGACGUGUUCCCACUCUACGGUUUAAGAGCUAUGCUGGAAAAAAGAAAAAUGCAAGUGGAAUACCAAAAAGAAAAAAACAGCAUAGCAAGUUUAAAUAAGCUAGUCCGUUAUCAACUUGAAAAAGUCGGUGCUUUUUUUCUU NO.4 GGTATTCCACTTGCATTTTTTTTTTTTTTT-SH

[0048] The experimental equipment is shown in Table 2.

[0049] Table 2 Main experimental instruments

[0050] Instrument Model Manufacturer Ultraviolet spectrophotometer EPOCH 2 BioTek Instruments, Inc. Portable Raman spectrometer RMS1000 China Ruihai Optoelectronics PCR instrument Biometra Tone 96 Analytic Jena Centrifuge Allegra 64R Centrifuge Beckman Coulter Constant temperature metal bath MDB100C Qun'an Scientific Instruments (Zhejiang) Co., Ltd. Horizontal electrophoresis tank HE-120 Tanon Constant temperature incubator ZWY-240 Shanghai Zhicheng Analytical Instrument Manufacturing Co., Ltd. Water bath Stellar constant temperature water bath HH-6 Jietan City Jerry Electric Appliance Co., Ltd. Malvern laser particle size analyzer Nano-S90 Malvern Electrophoresis imager Gel Doc EZ Bio-Rad Laboratories Digital heating magnetic stirrer SH-3C Tianjin Test Instruments Co., Ltd. Electronic balance ME 104E Licheng Instruments Co., Ltd. Transmission electron microscope Talos L 120C G2 Thermo Fisher

[0051] 2. Preparation of GNPs-probe:

[0052] Mix 2.5 μL of thiolated DNA probe with a concentration of 40 μM, 4 μL of TCEP solution with a concentration of 0.5 mM and 5 μL of acetic acid buffer with a concentration of 100 mM (pH 5.2), and incubate in the dark for 0.5-1 h;

[0053] Add the activated nucleic acid probe to 100 μL of 10-fold concentrated gold nanoparticles, mix and incubate for 1 h to allow the two to fully bind;

[0054] Add 1-10 μL of 5% BSA (bovine serum albumin) solution, and incubate at room temperature for 1 h, which is to block the sites on the gold nanoparticles that are not coupled to the probe;

[0055] Centrifuge at 8000-10000 rpm for 10-20 min to remove excess reactants and impurity ions, and disperse the obtained GNPs-probe precipitate with 50-100 μL of resuspension, which includes 1 mM Tris-HCl, 5% BSA, 0.25% Tween-20, 10% sucrose, and has a pH of 8.0. Repeat centrifugation twice.

[0056] 3. Preparation of SA-GNPs:

[0057] Add 10-20 μL of 0.1M potassium carbonate solution and 4-8 μL of 1 mg / mL SA solution to 1 mL of gold nanoparticle solution, and incubate at room temperature for 1 h;

[0058] Add 50-150 μL of 10% BSA (bovine serum albumin) solution, and incubate at room temperature for 1 h;

[0059] Centrifuge at 8000-10000 rpm for 10-20 min to remove excess reactants and impurity ions, and resuspend the obtained SA-GNPs with 100 μL of resuspension solution.

[0060] 4. Extraction and RPA amplification of E. coli DNA in a biological sample to be tested:

[0061] Heat the sample containing E. coli at high temperature to lyse and obtain a solution containing the E. coli DNA to be tested as a DNA template, wherein the heating temperature of the heating lysis method is 80-100℃, and the heating time is 3-6 min;

[0062] The isothermal amplification system comprises 10 μL of a dissolving agent, 1 μL of an upstream primer FP, 1 μL of a downstream primer RP, 1 μL of a DNA template, and 1 μL of an activator, and the total system is supplemented with water to 25 μL, and is reacted at 30-40℃ for 20-30 min to obtain a double-stranded amplification product modified with biotin at the end, wherein the concentrations of the upstream primer and the downstream primer are both 100-1000 nmol / L.

[0063] 5. Assembly of a colorimetric-Raman sensing platform:

[0064] Mix the double-stranded amplification product modified with biotin at the end with a CRISPR-dCas9 system, GNPs-probe, SA-GNPs, and PEG buffer, and incubate for 5-10 min to obtain the colorimetric-Raman sensing platform, wherein the volume of GNPs-probe is 5-8 μL, the volume of the double-stranded product modified with biotin at the end is 2-10 μL, the concentration of dCas9 is 50-500 nmol / L, the concentration of sgRNA is 40-400 nmol / L, the volume of SA-GNPs is 4-8 μL, and the PEG buffer comprises polyethylene glycol 20000, and the volume is 2-4 μL.

[0065] 6. An E. coli detection method based on the hotspot self-assembly colorimetric-Raman sensing platform described above, comprising the following steps:

[0066] S1. Prepare various standard concentrations of E. coli solutions;

[0067] S2. Lyse and extract E. coli genes;

[0068] S3, using E. coli gene as a DNA template, performing RPA amplification through an isothermal amplification system to obtain a terminal biotin-modified double-stranded amplification product;

[0069] S4, performing targeted recognition on the terminal biotin-modified double-stranded amplification product through a CRISPR-dCas9 system to form a complex product;

[0070] S5, assembling GNPs-probe and SA-GNPs through the complex product to form a colorimetric-Raman sensing platform for detecting target bacteria, performing colorimetric, ultraviolet and Raman signal detection, and establishing a quantitative relationship between the three signals and the content of E. coli;

[0071] S6, extracting an unknown concentration of E. coli sample to be tested, performing colorimetric, ultraviolet and Raman signal detection according to the same processing method of steps S2-S5, and based on the quantitative relationship, the concentration of E. coli in the sample to be tested can be obtained.

[0072] The main process of the detection method is as follows:

[0073] Extracting sample nucleic acids and performing RPA amplification; mixing various reaction components to realize nano-assembly; and performing colorimetric, ultraviolet and Raman quantitative analysis.

[0074] The present application uses a primer set specific to E. coli DNA, obtains a biotin end-labeled double-stranded amplification product through RPA technology, specifically recognizes and unwinds the RPA double-stranded amplification product through a CRISPR-dCas9 system, triggers the combination of GNPs-probe and double-stranded amplification product, and based on the combination ability of SA and gold nanoparticles, modifies SA on the surface of gold nanoparticles, based on the affinity of SA and biotin, combines multiple double-stranded amplification products with biotin molecules with one SA-GNPs molecule to form SA-terminal biotinylated double-stranded amplification product, and the gap between adjacent GNPs-probe can form a large number of hot spots to produce amplified Raman signals.

[0075] According to the different content of E. coli DNA in the sample to be tested, the ultraviolet and Raman signals produced are different, thereby establishing a relationship between the ultraviolet-Raman signal intensity and the content of E. coli DNA, and further realizing the purpose of sensitive detection of E. coli in actual samples.

[0076] In addition, by using different primer pairs, sgRNA sequences and single-stranded DNA probe sequences, the colorimetric-Raman sensing platform of the present application can also be used for rapid and sensitive detection of any pathogenic bacteria.

[0077] 7. Quantitative analysis:

[0078] The final colorimetric-Raman sensing platform carries out quantitative analysis by using the ultraviolet absorption spectrometer and the portable Raman spectrometer to determine the ultraviolet and Raman spectra, specifically, the ultraviolet absorption peak value intensity of the solution at 520 nm is determined by the ultraviolet absorption spectrometer, and the 1078 cm -1 absorption peak value intensity is determined by the portable Raman spectrometer.

[0079] In the specific experiment of the feasibility verification, please refer to Figure 2 , wherein 1-7 are GNPs-probe, GNPs-probe+dsDNA amplicon, GNPs-probe+dCas9 / sgRNA, GNPs-probe+dCas9 / sgRNA+dsDNA amplicon, GNPs-probe+dCas9 / sgRNA+SA-GNPs, GNPs-probe+dCas9 / sgRNA+SA-GNPs+dsDNA amplicon, GNPs-probe+dCas9 / sgRNA+SA-GNPs+non-target amplicon, and a blank control group is set up, the target of the blank control group does not contain E. coli, and the target bacteria is E. coli, after being treated by the method of the application, the blank control group has no corresponding Raman signal characteristic peak, and the solution color is red, which is negative; and the target bacteria shows the corresponding Raman characteristic peak, and the solution color is deepened, and the total number of E. coli colonies contained in the sample can be calculated according to the height of the corresponding Raman characteristic peak and the ultraviolet absorption peak.

[0080] In the specific experiment of the sensitivity analysis, please refer to Figure 3 , the concentration of E. coli is diluted into different gradients (from 10 7 CFU / mL to 10 0 CFU / mL), and a blank control group is set up, and different concentrations of bacteria treated by the method of the application can show corresponding Raman characteristic peaks and ultraviolet absorption peaks according to the height of the bacteria concentration, the method can detect to 10 1 CFU / mL, and has good linear relationship, and can realize accurate quantification of E. coli.

[0081] In the specific experiment of the specificity verification, please refer to Figure 4 , the E. coli group and the other non-target bacteria group are treated by the method of the application, and the Raman and ultraviolet signals are determined, it can be seen that only the target bacteria shows the corresponding change of Raman characteristic peak and ultraviolet absorption peak, and thus it is concluded that the method has excellent specificity and can obviously distinguish the target bacteria and the non-target bacteria.

[0082] In summary, according to the technical scheme, the corresponding end biotin modified double-stranded amplification product is obtained by RPA amplification when the E. coli DNA exists, the dCas9 system is used to recognize and unwind the end biotin modified double-stranded amplification product, then combined with GNPs-probe and SA-GNPs to obtain a colorimetric-Raman sensing platform, and through assembly, colorimetric, ultraviolet absorption signals and hotspot enhanced Raman signals are formed, according to the content change of the E. coli, the assembly changes accordingly, thereby causing different degrees of colorimetric, ultraviolet and Raman signals, and a quantitative relationship between the three signals and the content of the E. coli is established.

[0083] The method has the advantages of good specificity, high sensitivity, simple operation, strong adaptability and high accuracy, does not need bulky large instruments, only needs an ordinary ultraviolet absorption spectrometer and a portable Raman spectrometer, and can realize rapid and high-sensitivity detection of the E. coli, of course, a mobile phone can also be used to take pictures of the solution, and a related software can be used to identify the colorimetric image, so that the detection can also be performed, thereby meeting the requirements of modern rapid detection.

[0084] It is apparent to those skilled in the art that the present application is not limited to the details of the foregoing exemplary embodiments, but can be implemented in other concrete forms without departing from the spirit or essential characteristics of the present application. Therefore, the embodiments should be considered in all aspects as illustrative and not restrictive, and the scope of the present application is defined by the appended claims rather than the foregoing description, and it is intended to encompass all changes falling within the meaning and scope of the equivalent elements of the claims. Any reference signs in the claims should not be considered as limiting the claims involved.

Claims

1. A hot spot self-assembly colorimetric-Raman sensing platform, characterized in that, The isothermal amplification system, the CRISPR-dCas9 system, the GNPs-probe and the SA-GNPs, the isothermal amplification system comprising a specific primer set with terminal biotin modification, and a target bacterial gene as a DNA template, the RPA amplification is carried out through the isothermal amplification system, and a double-stranded amplification product with terminal biotin modification is obtained; The CRISPR-dCas9 system comprises a dCas9 protein and an sgRNA, and is used for targeted recognition of the double-stranded amplification product with terminal biotin modification, to form a complex product, wherein the sgRNA has a stem-loop structure as a universal hybridization site; The GNPs-probe is composed of a gold nanoparticle, a Raman signal molecule and a DNA probe, and the GNPs-probe is combined with the stem-loop structure of the sgRNA of the complex product through the DNA probe; The SA-GNPs are composed of a gold nanoparticle and streptavidin, and the SA-GNPs are combined with the biotin of the complex product through the streptavidin; The complex product is assembled with the GNPs-probe and the SA-GNPs to form a colorimetric-Raman sensing platform for detecting the target bacteria. 2.The hotspot self-assembly colorimetric-Raman sensing platform according to claim 1, wherein, The target bacteria are specifically Escherichia coli, and the specific primer set with terminal biotin modification comprises an upstream primer and a downstream primer, the sequence of the upstream primer is shown as SEQ ID NO. 1, and the sequence of the downstream primer is shown as SEQ ID NO. 2; The sequence of the sgRNA is shown as SEQ ID NO. 3; The sequence of the DNA probe is shown as SEQ ID NO.

4. 3.The hotspot self-assembly colorimetric-Raman sensing platform according to claim 2, characterized in that, The target bacterial gene is obtained from a bacterial sample by a heating lysis method, the heating temperature of the heating lysis method is 80-100 DEG C, and the heating time is 3-6 min. 4.The hotspot self-assembly colorimetric-Raman sensing platform according to claim 2, wherein, The concentration of the upstream primer and the downstream primer is 100-1000 nmol / L, the reaction temperature of the isothermal amplification system is 30-40 DEG C, and the reaction time is 20-30 min.

5. The hotspot self-assembled colorimetric-Raman sensing platform according to claim 1, wherein, The preparation method of the GNPs-probe comprises the following steps: A1, 2.5 μL of a thiolated DNA probe with a concentration of 40 μM, 4 μL of a TCEP solution with a concentration of 0.5 mM and 5 μL of an acetic acid buffer with a concentration of 100 mM are mixed, and incubated in a dark environment for 0.5-1 h; A2, the activated DNA probe is added to 100 μL of 10-fold concentrated gold nanoparticles, and mixed and incubated for 1 h to allow the two to fully combine; A3, 1-10 μL of a 5% BSA solution is added, and incubated at room temperature for 1 h to block the sites on the gold nanoparticles that are not coupled with the probe; A4, centrifugation is performed at 8000-10000 rpm for 10-20 min to remove excess reactants and impurity ions, and the obtained GNPs-probe precipitate is dispersed with 50-100 μL of a resuspension solution, and centrifugation is repeated twice. 6.The hotspot self-assembly colorimetric-Raman sensing platform according to claim 5, wherein, The preparation method of the SA-GNPs comprises the following steps: B1, 10-20 μL of a 0.1M potassium carbonate solution, 4-8 μL of a 1 mg / mL SA solution are added to 1 mL of a gold nanoparticle solution, and incubated at room temperature for 1 h; B2, add 50-150 μL of 10% BSA solution, incubate at room temperature for 1 h; B3, centrifuge at 8000-10000 rpm for 10-20 min to remove excess reactants and impurity ions, and resuspend the obtained SA-GNPs with 100 μL of resuspension solution.

7. The hotspot self-assembled colorimetric-Raman sensing platform according to claim 6, wherein, The resuspension solution comprises 1 mM Tris-HCl, 5% BSA, 0.25% Tween-20 and 10% sucrose. 8.The hotspot self-assembled colorimetric-Raman sensing platform according to claim 1, wherein, The concentration of dCas9 in the CRISPR-dCas9 system is 50-500 nmol / L, and the sgRNA concentration is 40-400 nmol / L.

9. A method for detecting Escherichia coli, characterized by, The hotspot self-assembly colorimetric-Raman sensing platform according to any one of claims 1-8 comprises the following steps: S1, prepare E. coli solutions with various standard concentrations; S2, lyse and extract E. coli genes; S3, use E. coli genes as DNA templates to perform RPA amplification through an isothermal amplification system to obtain double-stranded amplification products with terminal biotin modification; S4, target and recognize the double-stranded amplification products with terminal biotin modification through a CRISPR-dCas9 system to form a complex product; S5, assemble GNPs-probe and SA-GNPs through the complex product to form a colorimetric-Raman sensing platform for detecting target bacteria, perform colorimetric, ultraviolet and Raman signal detection, and establish a quantitative relationship between the three signals and the content of E. coli; S6, extract an unknown concentration of E. coli sample to be tested, and perform colorimetric, ultraviolet and Raman signal detection according to the same processing method of steps S2-S5, and based on the quantitative relationship, the concentration of E. coli in the sample to be tested can be obtained.

Images