InDel molecular marker related to maize rough dwarf disease resistance and application of InDel molecular marker

Abstract

The invention discloses an InDel molecular marker related to maize rough dwarf disease resistance and application of the InDel molecular marker, and belongs to the technical field of molecular genetics. The InDel molecular marker closely linked with the maize rough dwarf virus resistance gene is obtained by screening in 12, 857, 147-13, 124 and 718 bp regions of the maize chromosome 2, the resistance of maize to rough dwarf virus can be accurately identified in an early stage by utilizing the InDel molecular marker, and the InDel molecular marker has the advantages of simplicity, convenience, rapidness, high efficiency, accuracy, good repeatability, high specificity and the like; the method can be used for corn molecular marker-assisted breeding.

Description

Technical Field

[0001] This invention relates to the field of molecular genetics, specifically to an InDel molecular marker associated with maize resistance to maize rough dwarf disease and its application. Background Technology

[0002] corn( Zea mays Maize (L.) is a globally important food, feed, and industrial raw material crop, playing a significant role in ensuring national food security. Maize rough dwarf disease (MRDD) is a serious viral disease that severely damages maize production and is widespread globally. This disease is primarily caused by four viruses: Maize Rough Dwarf Virus (MRDV), Maldrio Quarto Virus (MRCV), Rice Black-Streaked Dwarf Virus (RBSDV), and Southern Rice Black-Streaked Dwarf Virus (SRBSDV), all belonging to the Reoviridae family (…). Reoviridae Fijivirus ( ) Fijivirus In my country, the main pathogens of maize rough dwarf disease are rice black-streaked dwarf virus (RBSDV) and southern rice black-streaked dwarf virus (SRBSDV), which are transmitted persistently by the rice planthopper. Viral infection can lead to shortened internodes, stunted growth, inability of tassels to release pollen normally, and malformed ear development, ultimately resulting in severe stunting of the plant (Fang et al., 2001; Yang et al., 2020). The occurrence of maize rough dwarf disease is influenced by various factors, including maize variety resistance, environmental conditions, the population size and migration dynamics of planthoppers, making its control challenging. Currently, production mainly employs a comprehensive strategy combining agricultural and chemical control, such as adjusting sowing dates and applying pesticides. However, this approach still faces limitations such as high economic costs, significant environmental pressure, and conflicts with sustainable agricultural principles. Therefore, breeding disease-resistant varieties, identifying disease-resistant genes, and creating disease-resistant germplasm resources are of great importance for controlling maize rough dwarf disease.

[0003] Molecular markers, due to their advantages of abundant quantity, simple and fast operation, and not affected by environmental conditions, can provide rich genetic information and are widely used in germplasm identification, quantitative trait locus (QTL) mapping, and molecular marker-assisted selection. Insertion-deletion (InDel) marker is a common molecular marker based on DNA sequence length polymorphism, which refers to the nucleotide insertion or deletion variation at a specific site in the genome of different individuals. By designing specific PCR primers for these variations, the target site can be quickly detected. By using InDel markers closely linked to target genes, linkage drag can be effectively reduced, and beneficial genes can be aggregated through assisted backcrossing, pedigree selection, or whole genome selection, thereby accelerating the breeding process and significantly improving the selection efficiency. However, there are still few reports on InDel markers significantly associated with resistance to maize rough dwarf disease. SUMMARY

[0004] In view of the above prior art, the purpose of the present application is to provide an InDel molecular marker associated with maize resistance to rough dwarf disease and its application. The InDel molecular marker of the present application can be used to detect the resistance of maize to rough dwarf disease, which can be used in breeding practice simply, quickly and with high throughput, thereby accelerating the breeding process of maize.

[0005] To achieve the above purpose, the technical scheme adopted by the present application is as follows: In a first aspect of the present application, an InDel molecular marker associated with maize resistance to rough dwarf disease is provided, which is named InDel-WL1. The nucleotide sequence of the InDel-WL1 is shown in SEQ ID NO. 1. The specific details are as follows: ACGATATCCTGTAGTTTGGATGTATTTTCTGTATGACTTAATTATTTTATTTCTACAGTTTGAAATGGACACGAGTTTACATTGCCAAATTATGATATTATCAATTCAGTAAAATTTATGTTGAATTTTGTATCATAAGTAATCTATATGGTACCTGAAACACCACTTTTTCTGTACACTAAATACAATGCCATGCAGCGTATTATTACAAACTTG. (SEQ ID NO. 1) The InDel molecular marker is located in the region of 12857147-13124718 bp of chromosome 2 of corn, and the physical position is referred to the B73 RefGen_v5 genome version.

[0006] The sequence of InDel-WL1 in the corn material susceptible to rough dwarf disease in the present application is shown as SEQ ID NO. 2, and is specifically as follows: ACGATATCCTGTAGTTTGGATGTATTTTCTGTATGACTTAATTATTTTATTTCTACAGTTTGAAATGGACACGAGTTTACATTGCCAAATTATGATATTATCAATTCAGTAAAATTTATGTTGAATTTTGTATCATAAGTAATCTATATGGTACCTGAAACACCACTTTTTCTGTACACTAAATACAATGCCATGCAGCGTATTATTACAAACTTG. (SEQ ID NO. 2) Compared with the sequence in the corn material susceptible to rough dwarf disease, the InDel-WL1 in the corn material resistant to rough dwarf disease has multiple insertion and / or deletion sites, resulting in a 182 bp difference in the length of two nucleotide fragments. Therefore, based on the difference in the length of the nucleotide fragments, the detection of the corn rough dwarf disease resistance can be realized.

[0007] In the second aspect of the present application, the above InDel-WL1 is applied in (1) or (2) as follows: (1) early screening or identifying the resistance of corn to rough dwarf disease; (2) corn molecular marker assisted breeding.

[0008] In the above applications, the corn molecular marker assisted breeding is the selection of corn inbred lines resistant to rough dwarf disease.

[0009] The present application researches and finds that InDel-WL1 is significantly associated with the resistance of corn to rough dwarf disease, and by detecting InDel-WL1 in the early growth of corn, corn germplasm resources resistant to rough dwarf disease can be selected, thereby accelerating the breeding process and improving the selection efficiency.

[0010] In a third aspect of the present application, a primer pair for amplifying the above-mentioned InDel-WL1 is provided, and the nucleotide sequences of the primer pair are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively; and the primer pair is specifically as follows: upstream primer: 5'-ACGATATCCTGTAGTTTGGATGT-3' (SEQ ID NO. 3) downstream primer: 5'-CAAGTTTGTAATAATACGCTGC-3' (SEQ ID NO. 4) In a fourth aspect of the present application, a kit containing the above-mentioned primer pair is provided.

[0011] Further, the kit further comprises a DNA template, Taq Master Mix and ddH2O.

[0012] In a fifth aspect of the present application, the above-mentioned primer pair or kit is applied in (1) or (2) as follows: (1) early screening or identifying the resistance of corn to rough dwarf disease; (2) corn molecular marker assisted breeding.

[0013] In the above applications, the corn molecular marker assisted breeding is the selection of corn inbred lines resistant to rough dwarf disease.

[0014] In a sixth aspect of the present application, a method for detecting the resistance of corn to rough dwarf disease is provided, comprising the following steps: Using the genomic DNA of the corn to be detected as a template, a primer pair shown in SEQ ID NO. 3 and SEQ ID NO. 4 is used for PCR amplification, and the rough dwarf disease of corn is identified according to the sequence of the amplification product or the fragment length of the amplification product.

[0015] Specifically: If the sequence of the amplification product is the corn material shown in SEQ ID NO. 1, the resistance to rough dwarf disease is higher than that of the corn material whose sequence of the amplification product is SEQ ID NO. 2. Alternatively, the corn material whose fragment length of the amplification product is 398 bp has higher resistance to rough dwarf disease than the corn material whose fragment length of the amplification product is 216 bp.

[0016] Preferably, the reaction system of PCR amplification is: 0.5 μL of the primer shown in SEQ ID NO. 3 with a concentration of 10 μM; 0.5 μL of the primer shown in SEQ ID NO. 4 with a concentration of 10 μM; 1 μL of genomic DNA with a concentration of 100 ng / μL; 5 μL of 2x Rapid Taq Master Mix; and 3 μL of ddH2O.

[0017] The reaction conditions of PCR amplification are: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s, annealing at 51℃ for 15 s, extension at 72℃ for 5 s, 35 cycles; final extension at 72℃ for 5 min; and preservation at 16℃.

[0018] Advantages of the present application: The InDel molecular marker obtained by screening in the region of 12857147-13124718 bp of chromosome 2 of corn in the present application is closely linked to the corn resistance gene to rough dwarf disease, and the InDel molecular marker of the present application can be used to accurately identify the resistance of corn to rough dwarf disease in early stage, has the advantages of being simple, fast, efficient, accurate, good repeatability and high specificity, and can be used for corn molecular marker assisted breeding. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 : Sequence alignment of corn inbred line CML199 (disease-resistant parent) and Zheng58 (disease-susceptible parent) at molecular marker InDel-WL1.

[0020] Figure 2 : Electrophoresis map of PCR amplification product of molecular marker InDel-WL1 in corn materials of Example 2. R: homozygous disease-resistant genotype (disease-resistant phenotype); S: homozygous disease-susceptible genotype (disease-susceptible phenotype); H: heterozygous genotype; M: DNA molecular weight marker (Marker).

[0021] Figure 3 : Disease index of improved inbred lines (Zheng58-R and Chang7-2-R) and receptor parents (Zheng58, Chang7-2). The data is represented by mean ± standard error. P <0.0001 (two-tailed t-test). DETAILED DESCRIPTION

[0022] It should be noted that the following detailed description is illustrative in nature and is intended to provide further description of the application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0023] In order for those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in conjunction with specific embodiments.

[0024] The test materials used in the embodiments of the present application are all conventional test materials in the art and can be purchased through commercial channels. The experimental methods not specified in detail are carried out according to the conventional test methods or according to the operation instructions recommended by the suppliers. Among them: the corn inbred line "CML199" is derived from the International Maize and Wheat Improvement Center (CIMMYT); the corn inbred lines "CML199" and "Zheng58" test materials are available to the public from the applicant for the purpose of repeating the present application.

[0025] Example 1: Obtaining of InDel molecular marker related to corn resistance to rough dwarf disease 1. Construction of a mapping and separation population: In this study, the corn inbred line "CML199" resistant to rough dwarf disease and the susceptible inbred line "Zheng58" were used as parents to construct a recombinant inbred line population containing 188 families. The population was obtained by single-seed transmission and continuous selfing. In 2018 and 2019, the parents and the recombinant inbred line population were phenotyped for corn rough dwarf disease resistance at the Taian Experimental Station of Shandong Agricultural University (36°11'N, 117°07'E). Field trials used a randomized incomplete block design, with resistant controls (CML199) and susceptible controls (Zheng58) in each block. Each recombinant inbred line was planted in a row, with a row length of 4.5 meters, a row spacing of 0.6 meters, and a plant spacing of 0.25 meters, with 18 plants per row.

[0026] 2. Positioning of the target QTL: To fine map the target QTL, 52 disease-resistant recombinant inbred lines with different chromosomal recombination events in the initial 8.37 Mb target interval were selected and backcrossed with the susceptible parent Zheng58 to construct an F1 population. Single plants with heterozygous target QTL sites were screened out using molecular marker assisted selection technology, and were continuously selfed to the F6 generation. In the F6 population, high-density molecular markers were used to identify recombinant single plants in the target interval, and F7 separation populations were obtained by selfing. From 2019 to 2021, through multiple rounds of recombinant single plant screening and phenotype verification, the breeding of the separation population was gradually promoted, involving 561 F7, 561 F8, 1,070 F9 and 1,016 F10 plants. 10Plant. Ultimately, the target QTL was located in the range of 12,857,147-13,124,718 bp of chromosome 2 of corn based on molecular marker 1 and molecular marker 2, and the physical interval was about 267.57 kb.

[0027] Molecular marker 1: Upstream primer A: AGGTGGAGCGCTAAGTATGC; Downstream primer B: TACGCTGTGGAGTACTGAC.

[0028] Molecular marker 2: Upstream primer C: TGGCTTATCGTCATTCAGCT; Downstream primer D: ACAAATCTAAACCCGCAGCA.

[0029] 3. Development of polymorphic markers: Based on the whole genome resequencing data of the disease-resistant parent CML199 and the disease-susceptible parent Zheng58 (sequencing completed by Novogene (Beijing)), the BWA-MEM software (v0.7.17) was used to align them to the corn B73 reference genome (version 5) with default parameters. Based on the initial positioning interval of 8.37 Mb, the InDel polymorphic sites were identified by the HaplotypeCaller module of GATK (v4.2.6.1), and variations with a length of ≥3 bp were focused on. Primer pairs were designed for the sequences on both sides of each InDel site (1 kb upstream and downstream) using Primer3 (v0.4.0) (Koressaar and Remm, 2007), with an amplification length of 100-500 bp and an annealing temperature of 50-58°C. The specificity of all primer sequences was verified by MaizeGDB (http: / / www.maizegdb.org / ) BLAST alignment. https: / / primer3.ut.ee / https: / / maizegdb.org /

[0030] Finally, a pair of InDel molecular markers tightly linked to the corn rough dwarf disease resistance gene was screened in the interval of 12,857,147-13,124,718 bp of chromosome 2 of corn, named InDel-WL1. The corresponding nucleotide sequence of InDel-WL1 in the disease-resistant parent CML199 is shown as SEQ ID NO. 1.

[0031] The sequence corresponding to InDel-WL1 in the disease-susceptible parent Zheng58 is shown as SEQ ID NO. 2.

[0032] The sequence alignment results of the molecular marker InDel-WL1 in the disease-resistant parent CML199 and the disease-susceptible parent Zheng58 are shown as SEQ ID NO. 3. The alignment results show that compared with the disease-resistant material, the disease-susceptible material has an insertion of 1 nucleotide and a deletion of 183 nucleotides at this site. Figure 1 ​​​

[0033] Example 2: Improvement of corn inbred lines by InDel-WL1 molecular marker assisted selection 1. Construction of molecular marker assisted selection population: The F9 plants with heterozygous target QTL sites were continuously self-crossed for two generations, and a pair of near-isogenic lines, NIL-R (carrying resistant alleles) and NIL-S (carrying susceptible alleles), were constructed. Taking NIL-R as the donor, the target QTL resistance fragment was introduced into Zheng 58 and Chang 7-2 through five rounds of backcrossing combined with molecular assisted selection based on InDel-WL1 marker, and finally the improved disease-resistant lines Zheng 58-R and Chang 7-2-R (BC5F2) were obtained. All materials were artificially inoculated and identified at Taian Experimental Station of Shandong Agricultural University (36°11′N, 117°07′E), and the field management followed the local standardized cultivation measures.

[0034] Based on the InDel-WL1 screened in Example 1, a primer pair for amplifying the molecular marker was designed, and the sequence of the designed primer pair is as follows: Upstream primer: 5'-ACGATATCCTGTAGTTTGGATGT-3'; (SEQ ID NO. 3) Downstream primer: 5'-CAAGTTTGTAATAATACGCTGC-3'. (SEQ ID NO. 4) The molecular marker InDel-WL1 and the designed primers were used to select the disease-resistant QTL sites in the improved population of corn materials, as follows: The genomic DNA of the corn to be tested was used as the template, and the primer pair represented by SEQ ID NO. 3 and SEQ ID NO. 4 was used for PCR amplification, and the size of the amplification product was used for judgment.

[0035] The reaction system of PCR amplification is as follows: (1) 0.5 μL of forward amplification primer represented by SEQ ID NO. 3 with a concentration of 10 μmo1 / L; (2) 0.5 μL of reverse amplification primer represented by SEQ ID NO. 4 with a concentration of 10 μmo1 / L; (3) 1 μL of DNA template with a concentration of 100 ng / μL; (4) 5 μL of 2x Rapid Taq Master Mix; (5) 3 μL of ddH2O.

[0036] The program of PCR amplification is as follows: (1) 95℃ pre-denaturation for 3 min; (2) 95℃ denaturation for 15 s, 51℃ annealing for 15 s, 72℃ extension for 5 s, 35 cycles; (3) 72℃ final extension for 5 min; (4) 16℃ storage.

[0037] The product obtained by the above-mentioned PCR amplification is subjected to 1% agarose gel electrophoresis, and the resistance genotype of the corn plant to the stunt disease can be judged according to the band size: if only a single band of 398 bp is present, the plant is a resistant homozygous genotype; if only a 216 bp band is detected, the plant is a susceptible homozygous genotype; if both 398 bp and 216 bp bands are present, the plant is determined to be a heterozygous genotype. Figure 2

[0038] 2. Disease resistance identification of plants In 2025, in Tai'an, at the V3 stage (three-leaf stage) of corn, the inbred lines (Zheng 58, Chang 7-2) identified as susceptible homozygous genotypes by the molecular marker InDel-WL1 and the improved lines (Zheng 58-R, Chang 7-2-R) identified as resistant homozygous genotypes by the molecular marker InDel-WL1 were artificially inoculated with rice black-streaked dwarf virus; and the group inoculated with non-toxic planthoppers was used as a control. After 72 hours of inoculation, all seedlings were transplanted to the field according to a completely randomized block design (Abendroth et al., 2011). After 60 days of inoculation, the incidence of stunt disease was evaluated using a five-grade scoring method, and the specific grading standards are as follows: 0 grade, no symptoms; 0.25 grade, slight internode shortening (plant height is 80% of the control); 0.50 grade, significant internode shortening (plant height is 50% of the control, normal seed setting); 0.75 grade, severe dwarfing (plant height is 30-40% of the control, male or fruiting panicle deformity with waxy protrusions); and 1 grade, extreme dwarfing (plant height is ≤30% of the control, no male flowering, whole plant showing symptoms or premature death). The disease severity index was calculated according to the formula: DSI (%) = ∑[(disease grade × number of plants at that grade)] / (1 × total number of plants) × 100.

[0039] The field inoculation results showed that the average disease index of inbred lines Zheng 58 and Chang 7-2 was 91.58% and 80.45%, respectively, while the average disease index of improved lines Zheng 58-R and Chang 7-2-R was 53.19% and 53.98%, respectively. Compared with the corresponding recipient inbred lines, the disease index of Zheng 58-R and Chang 7-2-R was reduced by 38.39% and 26.47%, respectively. Figure 3 The above results show that the corn stunt resistance identification results based on the molecular marker InDel-WL1 are consistent with the field phenotype identification results, indicating that the use of the molecular marker InDel-WL1 to detect the resistance and susceptibility traits of corn to stunt disease is accurate and reliable.

[0040] ​The above descriptions are only the preferred embodiments of the present application, and are not intended to limit the present application. The present application can have various modifications and changes for those skilled in the art. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. An InDel molecular marker associated with maize rough dwarf disease resistance, characterized in that, The InDel molecular marker is named InDel-WL1; the nucleotide sequence of InDel-WL1 is shown in SEQ ID NO.

1.

2. The use of the InDel molecular marker according to claim 1 in either (1) or (2): (1) Early screening or identification of maize resistance to maize rough dwarf disease; (2) Marker-assisted breeding of maize.

3. The application according to claim 2, characterized in that, The marker-assisted breeding of maize is for the selection and breeding of maize inbred lines resistant to maize rough dwarf disease.

4. A primer pair for amplifying the InDel molecular marker of claim 1, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

5. A kit containing the primer pair as described in claim 4.

6. The reagent kit according to claim 5, characterized in that, The kit also includes: DNA template, TaqMaster Mix and ddH2O.

7. The use of the primer pair of claim 4 or the kit of claim 5 in (1) or (2) below: (1) Early screening or identification of maize resistance to maize rough dwarf disease; (2) Marker-assisted breeding of maize.

8. The application according to claim 7, characterized in that, The marker-assisted breeding of maize is for the selection and breeding of maize inbred lines resistant to maize rough dwarf disease.

9. A method for detecting maize resistance to maize maize rough dwarf disease, characterized in that, Includes the following steps: Using the genomic DNA of the maize sample as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.3 and SEQ ID NO.

4. The maize rough dwarf disease was identified based on the sequence of the amplified product or the fragment length of the amplified product. If the sequence of the amplified product is the maize material shown in SEQ ID NO.1, its resistance to maize rough dwarf disease is higher than that of the maize material whose amplified product sequence is shown in SEQ ID NO.2; Alternatively, maize materials with an amplified product fragment length of 398 bp showed higher resistance to maize rough dwarf disease than maize materials with an amplified product fragment length of 216 bp.

Images