KASP molecular marker linked with stripe rust resistance site YrYZW-6A of wheat-agropyron cristatum distant filial generation and application of KASP molecular marker

By developing a KASP molecular marker for the stripe rust resistance locus YrYZW-6A in wheat-wheat-wheat grass distant hybrid progeny and using KASP technology for genotyping, the accuracy problem of stripe rust resistance screening in wheat-wheat grass distant hybrid progeny was solved, enabling early and precise breeding screening and improving breeding efficiency and accuracy.

CN121575152AActive Publication Date: 2026-02-27HAINAN UNIVERSITY SANYA NANFAN RESEARCH INSTITUTE +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202610113548.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-28
Publication Date
2026-02-27
Estimated Expiration
2046-01-28

AI Technical Summary

Technical Problem

Existing technologies cannot accurately screen stripe rust resistance in wheat-ice grass distant hybrids, resulting in long breeding cycles, heavy workloads, and susceptibility to environmental influences, making it impossible to accurately screen disease-resistant materials in the early stages.

Method used

We developed a KASP molecular marker linked to the stripe rust resistance locus YrYZW-6A in wheat-ice grass distant hybrids, used competitive allele-specific PCR (KASP) technology for genotyping, identified the genotype of the target SNP locus by fluorescence signal, and designed specific primers for PCR amplification and fluorescence detection.

Benefits of technology

This technology enables early and precise screening of stripe rust resistance in wheat materials, significantly reducing the errors and time costs of traditional phenotypic identification, broadening the sources of disease-resistant genes, and improving breeding efficiency and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121575152A_ABST
    Figure CN121575152A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular biology and genetic breeding, and provides a KASP molecular marker linked with a stripe rust resistance site YrYZW-6A of a wheat-agropyron cristatum distant filial generation and application of the KASP molecular marker, the nucleotide sequence of the KASP molecular marker linked with the stripe rust resistance site YrYZW-6A of the wheat-agropyron cristatum distant filial generation is shown as SEQ ID NO: 4, and M in the nucleotide sequence is C or T; and the resistance site YrYZW-6A is located at the 440 bp position, the 339 bp position and the 352bp position of the TraesPB6A chromosome in the wheat reference genome Purice 3504. According to the technical scheme, the problem that the stripe rust resistance of the wheat-wheatgrass distant filial generation cannot be accurately screened in the related technology is solved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and genetic breeding technology, specifically to stripe rust resistance loci in distant hybrids of wheat and wheatgrass. YrYZW-6A Linked KASP molecular markers and their applications. Background Technology

[0002] wheat( Triticum aestivum *L.* is a monocotyledonous herbaceous plant belonging to the Poaceae family and is one of the most important food crops. Wheat stripe rust is caused by *Striga styracifolium*, a wheat-specific strain. Puccinia striiformis f. sp . tritici, Pst Wheat stripe rust is a common fungal disease caused by a strictly virulent fungus. Currently, the most widely adopted measure for controlling wheat stripe rust in my country is to cultivate disease-resistant varieties.

[0003] *Corydalis* is an important wild relative of wheat, belonging to the *Corydalis* complex, which consists of a single *P* genome. The *Corydalis* *P* genome contains a large number of genes highly beneficial for wheat genetic improvement. In terms of disease resistance, it exhibits resistance to many common wheat diseases, such as stripe rust, leaf rust, and powdery mildew. These superior characteristics undoubtedly make *Corydalis* a high-quality exogenous gene donor for wheat improvement. However, in distant hybrids, the identification of target traits usually relies on field inoculation or natural disease phenotypic identification. This method is greatly affected by environmental conditions, is time-consuming, labor-intensive, and cannot accurately screen in early generations.

[0004] Currently, using molecular marker-assisted selection (MMR) to aggregate superior disease-resistant genes is an effective strategy for breeding durable disease-resistant varieties. Compared with traditional phenotypic screening methods, molecular markers have the following significant advantages: they are numerous, widely distributed, and unaffected by environment and developmental stage; most markers are co-dominant, accurately distinguishing between heterozygous and homozygous genotypes; they exhibit high polymorphism and abundant allelic variations; and the detection process is rapid, simple, and accurate. However, current technologies have not yet developed or further explored molecular markers for stripe rust in wheat-ice grass distant hybrids.

[0005] Therefore, developing molecular markers for detecting stripe rust resistance in wheat-ice grass distant hybrids can provide an efficient and reliable identification tool for disease-resistant breeding, enabling early and precise screening of disease-resistant materials, thereby accelerating the utilization of disease-resistant genes and the process of new variety breeding, which is of great practical significance for improving the level of wheat stripe rust resistance breeding. Summary of the Invention

[0006] This invention proposes stripe rust resistance loci in the offspring of distant hybrids of wheat and wheatgrass. YrYZW-6A Linked KASP molecular markers and their applications have solved the problem of inaccurate screening for stripe rust resistance in wheat-ice grass distant hybrids in related technologies.

[0007] The technical scheme of the present application is as follows: The present application proposes a stripe rust resistance site of a wheat- Agropyron mongolicum distant hybrid offspring YrYZW-6A The KASP molecular marker is shown in the nucleotide sequence of SEQ ID NO: 4, and M in the nucleotide sequence is C or T.

[0008] As a further technical scheme, the resistance site YrYZW-6A Located at 440,339,352 bp of TraesPB6A chromosome in wheat reference genome Puchun 3504.

[0009] As a further technical scheme, the genotyping of the KASP molecular marker in the wheat genome to be tested is detected, and the wheat with TT homozygous type has stripe rust resistance.

[0010] In the present application, when the genotype of the plant variety is TT homozygous type, it indicates that the wheat plant has resistance to stripe rust, the marker is highly linked to the target resistance site, can accurately track the disease resistance gene, significantly reduces the error and time cost of traditional phenotype identification, and at the same time, the wheat distant germplasm Agropyron mongolicum widens the source of disease resistance genes, which has important value for breeding against stripe rust.

[0011] As a further technical scheme, the KASP molecular marker is determined by target interval sequencing and differential frequency screening on the disease-resistant DNA pool and the disease-susceptible DNA pool of the wheat-Agropyron mongolicum distant hybrid offspring population, and genetic linkage and phenotype verification.

[0012] The present application also proposes a primer set for amplifying the KASP molecular marker, which comprises a forward specific primer F1, a forward specific primer F2 and a reverse universal primer; The sequence of the forward specific primer F1 is shown in SEQ ID NO: 1; The sequence of the forward specific primer F2 is shown in SEQ ID NO: 2; The sequence of the reverse universal primer is shown in SEQ ID NO: 3.

[0013] As a further technical scheme, the 5' end of the forward specific primer F1 and the forward specific primer F2 is independently connected with different fluorescent reporter groups, respectively; The sequence of the fluorescent reporter group connected to the 5' end of the forward specific primer F1 is shown in SEQ ID NO: 5: GAAGGTGACCAAGTTCATGCT; The sequence of the fluorescent reporter group connected to the 5' end of the forward specific primer F2 is shown as SEQ ID NO: 6: GAAGGTCGGAGTCAACGGATT.

[0014] The application further provides a kit containing the primer set.

[0015] The application further provides the primer set or the kit for use in any one of the following A-C: A. identifying or assisting in identifying the resistance of wheat to stripe rust; B. identifying or assisting in identifying wheat as resistant wheat or susceptible wheat to stripe rust; C. breeding a wheat variety resistant to stripe rust.

[0016] The application further provides a method for identifying the resistance of a wheat- Agropyron cryeslance distant hybrid offspring to stripe rust, comprising the following steps: S1. extracting genomic DNA of the wheat- Agropyron cryeslance distant hybrid offspring to be tested; S2. performing PCR amplification using the primer set, and determining the genotype by fluorescence detection after amplification to determine whether it has resistance to stripe rust.

[0017] In the application, single nucleotide polymorphism (SNP) markers have become an important basis for molecular marker-assisted selection (MAS) due to their dense distribution in the genome and strong stability. Kompetitive Allele-Specific PCR (KASP) is a SNP typing technology based on fluorescence signal. This technology connects different fluorescent groups to the end of specific primers, and uses PCR end fluorescence signal to identify the genotype of the target SNP site. Therefore, KASP technology has the advantages of high efficiency, low cost, simple operation, high throughput, etc., can realize rapid and accurate typing of specific SNPs in a large number of samples, and significantly improve the efficiency of molecular marker-assisted breeding, and has a wide application prospect in crop genetic improvement.

[0018] As a further technical solution, the determination is based on the genotyping result to determine the resistance of the wheat- Agropyron cryeslance distant hybrid offspring to be tested to stripe rust: if the genotype is TT homozygous, the wheat- Agropyron cryeslance distant hybrid offspring to be tested has resistance to stripe rust; if the genotype is CC homozygous, the wheat- Agropyron cryeslance distant hybrid offspring to be tested has susceptibility to stripe rust.

[0019] The application further provides a method for breeding wheat resistant to stripe rust, comprising the following steps: extracting genomic DNA of a wheat sample to be tested, performing PCR amplification using the primer set, and determining the genotype by fluorescence detection after amplification, if the determined genotype is TT type, the wheat sample to be tested is retained for breeding.

[0020] The working principle and beneficial effects of the present application are: In the present application, the developed molecular marker is highly linked to the stripe rust resistance site YrYZW-6A , which can reliably predict the resistance level of wheat materials to stripe rust, has the characteristics of high stability, easy automation detection, and suitability for high-throughput screening, is convenient for breeding platform application, and meets the accuracy and stability requirements of molecular marker-assisted selection breeding. Based on the clear genomic location (TraesPB6A:440,339,352bp) and stable allele-genotype correspondence rule, the marker can realize reliable and early prediction of the resistance level of wheat germplasm resources and breeding offspring materials to stripe rust. Through large-scale recombinant inbred line population (F11, 1220 single plants) verification, the marker shows extremely significant phenotypic differentiation ability among different genotypes, fully meets the core requirements of marker accuracy, stability and practicability of molecular marker-assisted selection breeding, is suitable for high-throughput and automated screening, and can significantly improve the efficiency of disease-resistant breeding.

[0021] Using the molecular marker of the present application, resistant single plants can be screened at the seedling stage, greatly shortening the breeding cycle, and converting the traditional process of multiple generations of field inoculation identification into leaf DNA detection, greatly saving time, manpower and land resources.

[0022] In addition, the molecular marker method of the present application not only reduces the dependence on chemical pesticides, but also meets the trend of green agriculture; and can reduce the risk of field disease outbreak through precision breeding and protect food security. BRIEF DESCRIPTION OF DRAWINGS

[0023] The present application will be further described in detail below in combination with the drawings and specific embodiments.

[0024] Figure 1 is the reaction type of the wheat stripe rust fungus on the wheat seedling of the present application.

[0025] Figure 2 is the TraesPB6A chromosome SNP-Indel result map of the present application based on exon pool sequencing.

[0026] Figure 3 is the KASP genotyping result map of the SNP molecular marker on the offspring single plant of the present application.

[0027] Figure 4 is the correlation analysis map of the genotype of the SNP molecular marker and the stripe rust resistance phenotype of the present application.

[0028] Figure 5 is the KASP genotyping result map of the SNP molecular marker in other wheat materials of the present application. DETAILED DESCRIPTION

[0029] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0030] Example 1 1. Resistance loci to wheat stripe rust YrYZW-6A Obtaining linked KASP molecular markers 1.1 Construction of F11 generation recombinant inbred line population Using PB3504 as the male parent and Yecora Rojo as the female parent, a cross was conducted. Starting from the F2 generation, the single-seed passage method (SSD) was used for 11 consecutive generations of self-pollination to construct a population of 1220 genetically stable F11 recombinant inbred lines.

[0031] 1.2 Identification of disease resistance phenotype In a greenhouse, stripe rust resistance was assessed in 1220 F11 generation recombinant inbred lines. Wheat seeds were sown in 7cm square pots filled with nutrient substrate and cultured under the following conditions: 16h light, 8h dark, and 17℃. When the wheat reached the one-heart-one-leaf stage, it was inoculated with the stripe rust physiological race CYR34. For inoculation, a 4mg / mL suspension of CYR34 stripe rust spores was prepared using electronic fluoride solution. After mixing by inverting the pot, 5μL was evenly applied to the upper surface of the wheat leaves from top to bottom. After inoculation, the leaves were sprayed with water and placed in a 10℃ dark humidified room for 24h (100% humidity). After humidification, the plants were cultured at 15℃ under the following conditions: 16h light, 8h dark. The first phenotypic assessment was conducted on day 15 after inoculation, and the second phenotypic assessment was conducted on day 18 after inoculation. The result with the most severe disease development was taken as the final phenotype.

[0032] Table 1 shows the reactivity and symptomatic characteristics of wheat stripe rust on wheat, and the reactivity of wheat stripe rust on wheat seedlings is shown in Table 2. Figure 1 As shown, the stripe rust resistance phenotype was identified by recording the leaf reaction patterns according to the 0-9 grade standard, where 0-6 grades indicate resistance and 7-9 grades indicate susceptibility.

[0033] Table 1. Reactivity patterns and symptomatic characteristics of wheat stripe rust on wheat.

[0034] The identification results are: under the infection condition of stripe rust physiological race CYR34, among the 1220 materials, 594 materials (accounting for 48.69%) show resistance to disease; 626 materials (accounting for 51.31%) show susceptibility to disease.

[0035] 1.3 Extraction of DNA A recombinant inbred line population (F11 generation, a total of 1220 families) derived from a distant hybridization between wheat and Agropyron cristatum and its parents were used as materials. Fresh leaf tissue was collected, and total genomic DNA was extracted using a modified CTAB method: 0.5 g of fresh leaf tissue was quickly frozen in liquid nitrogen and ground thoroughly. The ground powder was transferred to a centrifuge tube containing preheated CTAB buffer, extracted with chloroform, precipitated with isopropanol, washed with ethanol, and dried in a ventilated environment. The sample was then dissolved in 100 μL of ddH2O as a stock solution. The CTAB buffer contained 20 g / L CTAB, 81.90 g / L NaCl, 7.46 g / L EDTA, 12.14 g / L Tris-HCl, and 2 g / L PVP, and the pH was adjusted to 8.0. The concentration and purity of the genomic DNA in the stock solution were quantitatively analyzed using a microspectrophotometer. When A260 / A280 was greater than 1.8 and A260 / A230 was greater than 1.8, the purity of the extracted DNA met the standard. The DNA was then diluted to a working concentration of 100 ng / μL to ensure that it met the quality requirements for subsequent high-throughput genotyping.

[0036] 1.4 Construction of extreme pools According to the identification results of the disease resistance phenotype, 38 extreme disease-resistant single plants and 47 extreme disease-susceptible single plants were selected, and equal amounts of genomic DNA were mixed to construct disease-resistant DNA pools (R-pool) and disease-susceptible DNA pools (S-pool).

[0037] 1.5 Screening of key SNPs Target interval sequencing: The qualified DNA samples of the two pools were subjected to exon pool sequencing with a sequencing depth of 30x. Association interval positioning: Based on the principle of cluster separation analysis, the allele frequency difference value (ΔSNP-index) of the resistant and susceptible pools at each SNP site in the genome was calculated, and a significance threshold of p<0.05 was used for screening. The results are shown in Table 1. Figure 2 Figure 2 ​Display: The genetic locus related to stripe rust resistance is located on chromosome 6A, and a continuous and significant peak signal is detected on chromosome 6A, covering a physical interval of 300-500 Mb, indicating that there is a major resistance locus to stripe rust in the association interval, the effect is strong, and it is an ideal target area for developing closely linked molecular markers; except for chromosome 6A, the ΔSNP-index values on the rest of the chromosomes are randomly distributed around zero, indicating that these genomic regions have no significant association with stripe rust resistance; In the above association interval, further screening of SNP sites with extremely significant differences in allele frequency (ΔSNP-index>0.8) and polymorphism in resistant DNA pool, susceptible DNA pool, etc.; ultimately a key SNP site highly co-segregated with the resistance phenotype is identified, which is located at the 440,339,352 base site of TraesPB6A chromosome in the wheat reference genome Pubing3504. In this site, the resistant DNA pool and the resistant parent are fixed as "T" base, while the susceptible DNA pool and the susceptible parent are fixed as "C" base. The major resistance gene to stripe rust linked to the SNP marker is named YrYZW-6A .

[0038] 1.6 Development of KASP molecular markers Based on the principle of competitive allele-specific PCR (KASP), KASP primers are designed for the flanking sequences of the above SNP site to ensure the specificity and efficiency of typing. Among them, the sequence of allele 1-forward specific primer (F1) is: 5'-GAAGGTGACCAAGTTCATGCTgcgacggacttggcacgacggcggc-3' (the lowercase part is SEQ ID NO: 1; the uppercase part is a specific fluorescent tag sequence FAM, as shown in SEQ ID NO: 5); The sequence of allele 2-forward specific primer (F2) is: 5'-GAAGGTCGGAGTCAACGGATTgcgacggacttggcacgacggcggt-3' (the lowercase part is SEQ ID NO: 2; the uppercase part is a specific fluorescent tag sequence VIC, as shown in SEQ ID NO: 6); The sequence of reverse universal primer (R) is: 5'-ctccaccacatcacccctgcctcgttctg-3' (SEQ ID NO: 3).

[0039] The nucleotide sequence of the synthesized KASP molecular marker is as follows: 5'-GCGACGGACTTGGCACGACGGCGGM GATCCGATCGGGTCAGAACGAGGCAGGGGTGATGTGGTGGAG-3' (SEQ ID NO: 4, M is C or T).

[0040] 1.7 KASP genotyping experiment The KASP molecular marker was used for fluorescent quantitative PCR genotyping of genomic DNA: PCR reaction system: 10 μL total reaction system, 30 ng template DNA, the remaining volume was supplemented with ddH2O; Among them, the total reaction system contains: 5 μL 2xKASP Master Mix, 0.75 μL KASP primer mixture with a concentration of 10 μM (KASP primer mixture includes specific primer F1, specific primer F2 and universal primer R with a volume ratio of 1:1:3); PCR reaction program: 94°C hot start for 15 min, 94°C denaturation for 20 s, annealing / extension temperature from 61°C, 10 cycles, each cycle decreasing 0.6°C to 55°C, lasting 60 s, 94°C denaturation for 20 s, 55°C annealing / extension for 60 s, 38 cycles, 16°C incubation; Fluorescence signal detection and genotyping: After the above PCR reaction, the instrument automatically collects FAM and VIC fluorescence signals. Through the matching analysis software, automatic genotyping is carried out according to the cluster distribution of fluorescence signals in the two-dimensional scatter plot, and part of the sample genotyping results are shown in Figure 3 ; As shown in Figure 3 , it can be seen that the samples to be detected are clearly divided into three completely separated clusters: disease-resistant pool (T / T homozygous genotype), disease-susceptible pool (C / C homozygous genotype) and disease-resistant and susceptible mixed pool (C / T heterozygous genotype); among them, the disease-resistant genotype (left cluster), the heterozygous genotype (middle cluster) and the disease-susceptible genotype (right cluster) correspond to the intensity difference of X axis (FAM fluorescence signal) and Y axis (VIC fluorescence signal). After detecting 1220 strains of materials, it was found that 251 strains were C / C homozygous genotype, 851 strains were T / T homozygous genotype, 22 strains were C / T heterozygous genotype, and 96 strains were unknown genotype.

[0041] 2. KASP molecular marker and phenotype correlation verification The genotyping results of the KASP marker are associated with the stripe rust resistance phenotype (disease index). First, the disease index of each material is arranged into a structured data table with the corresponding KASP marker genotype (TT, CC, CT), and unknown types are not verified for association. For the continuous phenotype data of the disease index, t-test is used to compare the phenotype mean difference between different genotype groups, and the statistical significance (P value) is calculated. Finally, the phenotype distribution of different genotype groups is visualized by box plot, which intuitively presents the association strength of the marker and the disease resistance; the disease index distribution results corresponding to different genotypes are as shown in Figure 4 . .

[0042] As shown in Figure 4 , 463 of the 851 T / T homozygous single plants are highly resistant or immune, 177 of the 251 C / C homozygous single plants are highly susceptible, and the 22 C / T heterozygous single plants are phenotypically separated and distributed in the range of medium resistance to medium susceptibility. Statistical analysis further confirms that the genotyping results of the SNP molecular marker are significantly correlated with the stripe rust resistance P = 2.78E-15, indicating that it can be used for efficient and accurate wheat stripe rust breeding screening. .

[0043] 3. Genotyping of other wheat materials using the SNP molecular marker The KASP genotype analysis of the wheat-ice grass introgression line materials (PB2022-1, PB03, PB06, PB4201, PB09, PB3504, PB298, PB300), ice grass Z559 and common wheat (Zhoumai 18, Fukoho, Zhoumai 36, Jagger, 924144-2, Yekora, FC Dahuai, Zhi 7730, CMH83605) is performed using the molecular marker of the application, and the experimental steps are the same as steps 1.6-1.7 above. The analysis results are as shown in Figure 5 . .

[0044] As shown in Figure 5 , in addition to the ddH2O, resistant pool and susceptible pool controls, the 10 T / T homozygous single plants are PB2022-1, PB03, PB06, Zhoumai 18, Fukoho, PB4201, Zhoumai 36, Jagger, 924144-2 and Z559, respectively; the 8 C / C homozygous single plants are Yekora, FC Dahuai, PB09, PB3504, PB298, PB300, Zhi 7730 and CMH83605, respectively. .

[0045] The above is only a preferred embodiment of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. Stripe rust resistance loci in distant hybrids of wheat and wheatgrass YrYZW-6A Linked KASP molecular markers, characterized by, The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO:4, where M is C or T.

2. The KASP molecular marker according to claim 1, characterized in that, The resistance site YrYZW-6A It is located at 440, 339, 352 bp on chromosome TraesPB6A in the wheat reference genome Pubing 3504.

3. The KASP molecular marker according to claim 2, characterized in that, The genotype of the KASP molecular marker in the genome of the wheat to be tested was detected. Wheat with the TT homozygous genotype is resistant to stripe rust.

4. A primer set for amplifying the KASP molecular marker according to any one of claims 1 to 3, characterized in that, This includes forward-specific primer F1, forward-specific primer F2, and reverse universal primer; The sequence of the forward specific primer F1 is shown in SEQ ID NO:1; The sequence of the forward specific primer F2 is shown in SEQ ID NO:2; The sequence of the reverse universal primer is shown in SEQ ID NO:

3.

5. The primer set according to claim 4, characterized in that, The 5' ends of the forward specific primers F1 and F2 are each independently connected to different fluorescent reporter groups.

6. A reagent kit, characterized in that, It contains the primer set as described in claim 4 or 5.

7. The primer set according to claim 4 or 5, or the kit according to claim 6, for use in any one of the following A to C: A. To identify or assist in the identification of wheat stripe rust resistance; B. Identify or assist in identifying wheat as either stripe rust-resistant or stripe rust-susceptible; C. Breed wheat varieties resistant to stripe rust.

8. A method for identifying stripe rust resistance in wheat-wheat-ice grass distant hybrid progeny, characterized in that, Includes the following steps: S1. Extract genomic DNA from the distant hybrid offspring of wheat and icewort to be tested; S2. Perform PCR amplification using the primer set described in claim 4 or 5, determine the genotype by fluorescence detection of the amplification results, and determine whether the genotype has stripe rust resistance.

9. The method according to claim 8, characterized in that, The determination is based on the genotyping results to determine the stripe rust resistance of the wheat-ice grass distant hybrid offspring to be tested: if the genotype is TT homozygous, the wheat-ice grass distant hybrid offspring to be tested has stripe rust resistance; if the genotype is CC homozygous, the wheat-ice grass distant hybrid offspring to be tested has stripe rust susceptibility.

10. A method for breeding wheat resistant to stripe rust, characterized in that, Includes the following steps: Genomic DNA is extracted from the wheat sample to be tested, and PCR amplification is performed using the primer set described in claim 4 or 5. The genotype is determined by fluorescence detection of the amplification results. If the determined genotype is TT, the wheat sample to be tested is retained for breeding.

Citation Information

Patent Citations

  • Wheat stripe rust resistance genes and methods of use

    CA3003903A1

  • Molecular marker linked with wheat stripe rust resistance gene YrZ41-2AL and application of molecular marker

    CN119193902A

  • KASP molecular marker linked with wheat stripe rust resistance gene Yr85 and application of KASP molecular marker

    CN119242846A