InDel molecular marker linked with powdery mildew resistance site PmYZW-6A-1 of wheat-wheatgrass introgression line and application of InDel molecular marker
By developing an InDel molecular marker linked to the powdery mildew resistance locus PmYZW-6A-1 in wheat-ice grass introgression line and using BSA-seq technology to locate the QTL locus PmYZW-6A-1, early and precise screening and breeding in the wheat breeding process were achieved. This solved the problem of low efficiency in broad-spectrum and durable resistance in wheat breeding and improved breeding efficiency and the accuracy of resistance identification.
Patent Information
- Application Number
- CN202610113835.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-28
- Publication Date
- 2026-02-27
- Estimated Expiration
- 2046-01-28
AI Technical Summary
Among existing wheat breeding methods, the cultivation efficiency of broad-spectrum and long-lasting powdery mildew resistant varieties is low, and single resistance is easily lost due to the evolution of pathogens.
We developed an InDel molecular marker linked to the powdery mildew resistance locus PmYZW-6A-1 in the wheat-ice grass introgression line, located the QTL locus PmYZW-6A-1 using BSA-seq technology, and achieved early and precise screening and breeding through InDel molecular marker-assisted selection.
It improves wheat breeding efficiency, enables accurate identification of powdery mildew resistance, enhances the broad-spectrum and durable resistance of wheat to powdery mildew, and simplifies the breeding process.
Smart Images

Figure CN121575153A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, specifically to an InDel molecular marker linked to the powdery mildew resistance site PmYZW-6A-1 in the wheat-ice grass introgression line and its application. Background Technology
[0002] wheat( Triticumaestivum L. Wheat (Triticum aestivum) is a crop belonging to the genus Triticum in the family Poaceae. It is an annual, self-pollinating plant. As one of the world's major food crops, wheat is threatened by numerous diseases throughout its growth cycle. Wheat powdery mildew is caused by the wheat-specific strain of *Brucella brucellosa*. Blumeriagraminisf.sp.tritici (Bgt) Powdery mildew is a fungal disease that is one of the most destructive diseases affecting wheat. Discovering and utilizing powdery mildew resistance genes for disease-resistant breeding is the most economical and effective control strategy.
[0003] Previous studies have shown that wheat resistance to powdery mildew can be divided into different levels according to genetic mechanisms, but relying on a single level of resistance is prone to loss due to the rapid evolution of the pathogen. Even in plants containing known powdery mildew resistance loci, more virulent powdery mildew isolates may still emerge. Therefore, it is essential to construct an efficient disease barrier by integrating multi-level resistance to prevent the adaptive evolution of powdery mildew and its eventual breakthrough in resistance. The widespread genetic diversity of race-specific and quantitative resistance in wheat provides a genetic basis for breeding varieties with broad-spectrum and durable resistance through a combination of phenotypic and marker-assisted selection.
[0004] Currently, identifying and utilizing plant-derived disease-resistance genes has become a core direction in crop disease-resistant breeding. Expanding the wheat powdery mildew resistance gene pool is of great significance for cultivating new disease-resistant varieties. Molecular breeding provides the means and possibilities to accelerate the conventional breeding process. By understanding the parents, especially the functions of major genes, the probability of hybrid combinations can be predicted, enabling targeted variety breeding. Marker-assisted selection can shift phenotypic screening in the breeding process to early, precise screening based on molecular markers, thereby improving breeding efficiency. Further integrating and optimizing marker-assisted selection systems, high-throughput genotyping, and accelerated breeding methods will help accelerate the breeding utilization of powdery mildew resistance genes, increase wheat genetic variation, and provide support for the sustainable control of powdery mildew. Summary of the Invention
[0005] This invention proposes an InDel molecular marker linked to the powdery mildew resistance site PmYZW-6A-1 in the wheat-ice grass introgression line and its application, which solves the problem of low cultivation efficiency of broad-spectrum and durable disease-resistant varieties in traditional wheat breeding methods.
[0006] The technical solution of the present invention is as follows: This invention proposes an InDel molecular marker linked to the powdery mildew resistance site PmYZW-6A-1 in the wheat-ice grass introgression line, wherein the InDel molecular marker is located at positions 231 to 257 of the nucleotide sequence shown in SEQ ID NO.1.
[0007] In this invention, the InDel molecular marker was developed based on the InDel variants obtained from whole-genome sequencing results of anti-infective pools.
[0008] As a further technical solution, the resistance site PmYZW-6A-1 is located at 442,022,338 bp on chromosome 6A of the Pubing 3504 reference genome.
[0009] In this invention, the resistance site PmYZW-6A-1 is a major resistance QTL site for powdery mildew located by analyzing a population of Pubing 3504 × Yekaola recombinant inbred lines using BSA-seq technology.
[0010] This invention also proposes a primer pair for amplifying the InDel molecular marker linked to the powdery mildew resistance site PmYZW-6A-1 in the wheat-wheat introgression line, wherein the primer pair comprises: InDel-F: 5'-TTTTGGACGACAAGATGGTTATTTA-3', as shown in SEQ ID NO.3; InDel-R: 5'-ACTCCATTACAGTCTCACGTACCAG-3', as shown in SEQ ID NO.4.
[0011] The present invention also provides a kit for detecting wheat resistance to powdery mildew, the kit comprising the primer pair described above; If a specific 289 bp band is amplified using the primer pair, the wheat being tested is identified as having a susceptible genotype. If a specific 262bp band is amplified using the primer pair, the wheat being tested is identified as having a disease-resistant genotype. If a specific band of 289 bp and 262 bp is amplified using the primer pair, the wheat to be tested is identified as a heterozygous genotype.
[0012] This invention also proposes the application of the InDel molecular marker linked to the powdery mildew resistance site PmYZW-6A-1 in the wheat-ice grass introgression line, or the primer pair or the kit, in wheat genetic analysis.
[0013] As a further technical solution, the wheat genetic analysis includes analysis of the genetic diversity of wheat resistance to powdery mildew, identification of wheat resistance to powdery mildew, or assisted breeding of powdery mildew-resistant wheat.
[0014] The present invention also proposes a method for identifying wheat powdery mildew resistance, comprising: using the genomic DNA of the wheat to be tested as a template, performing PCR amplification using the primer pair, performing electrophoresis on the amplification products, and determining the wheat powdery mildew resistance based on the electrophoretic banding pattern.
[0015] As a further technical solution, the method for determining wheat powdery mildew resistance based on electrophoretic banding is as follows: If the amplification product shows only one specific band of 289 bp, it is determined that the wheat being tested contains a susceptible genotype. If the amplification product shows only one specific band of 262 bp, it is determined that the wheat being tested contains a disease-resistant genotype. If the amplification product shows both 289bp and 262bp bands, it is determined that a heterozygous genotype exists in the wheat being tested.
[0016] As a further technical solution, the PCR amplification reaction system includes 1µL template DNA, 1µL 10ng / µL primer pair, 3µL ddH2O, and 5µL 2×Taq PCR Master Mix, wherein the primer pair includes InDel-F and InDel-R.
[0017] As a further technical solution, the PCR amplification reaction program includes: denaturation at 94℃ for 3 min; denaturation at 94℃ for 30 sec, annealing at 55℃ for 30 sec, extension at 72℃ for 30 sec, for 35 cycles; and extension at 72℃ for 5 min.
[0018] This invention also proposes a method for breeding wheat resistant to powdery mildew, comprising the following steps: Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the primer pair. The amplification products were electrophoresed, and the powdery mildew resistance of the wheat was determined based on the electrophoretic banding pattern. If the amplification product was 262 bp, the wheat to be tested was retained for breeding.
[0019] The working principle and beneficial effects of this invention are as follows: In this invention, a recombinant inbred line population of Pubing 3504 × Yecora Rojo was constructed for phenotypic identification. Extremely powdery mildew-resistant and extremely susceptible wheat varieties were screened using BSA-seq analysis, which located a major powdery mildew resistance QTL locus, PmYZW-6A-1. The candidate gene TraesPB6AG3308.1 was selected. Based on a 27-base insertion mutation in the candidate gene TraesPB6AG3308.1, an InDel molecular marker was developed. This InDel molecular marker is tightly linked to the powdery mildew resistance locus PmYZW-6A-1. Detecting the association between wheat genomic DNA and the InDel molecular marker allows for marker-assisted selection of wheat powdery mildew resistance genes, which is of great significance for high-quality breeding of powdery mildew-resistant wheat and the identification of germplasm resources. Specifically: 1. In this invention, the InDel molecular marker related to the wheat powdery mildew resistance gene is located at a physical position of 442,022,338 bp on chromosome 6A of the Pubing 3504 reference genome, and is used to detect the polymorphism of a 27 bp insertion variation in the nucleotide sequence.
[0020] 2. In this invention, the InDel molecular marker related to wheat powdery mildew resistance genes can accurately identify wheat's resistance to powdery mildew, providing a theoretical basis for further developing functional markers to accelerate the application of molecular markers in breeding.
[0021] 3. In this invention, the method for identifying wheat powdery mildew resistance using InDel molecular markers related to wheat powdery mildew resistance genes is simple and convenient to operate, and can greatly improve the breeding efficiency of powdery mildew-resistant wheat. Attached Figure Description
[0022] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.
[0023] Figure 1 This is a statistical analysis of the phenotypes of 1220 populations in the F11 generation of the Pubing 3504 × Yekaola recombinant inbred line in Example 1 of the present invention. Figure 2 This is an example of the BSA anti-pool phenotype in Embodiment 1 of the present invention; Figure 3 This is an example of the BSA sensing cell phenotype in Embodiment 1 of the present invention; Figure 4 The BSA-seq technology in Example 1 of this invention calculates the mutation frequency difference between pools, i.e., the ED value, based on the obtained SNP locus set and genotype depth information between pools, and maps the results on chromosome 6A. Figure 5This is a schematic diagram of the insertion site of the second coding region 27bp of the TraesPB6AG3308.1 gene in Example 1 of the present invention; Figure 6 This shows the genotyping of InDel molecular markers in the extreme sensitivity material in Example 3 of the present invention; Figure 7 This document describes the identification of the InDel molecular marker genotype and powdery mildew resistance phenotype in the RIL population in Example 3 of this invention. Figure 8 This shows the typing of the InDel molecular marker in the wheat-ice grass infiltrating material in Example 3 of the present invention. Detailed Implementation
[0024] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0025] Example 1: Determination of the powdery mildew resistance locus PmYZW-6A-1 in wheat-wheat introgression lines 1.1 Constructing the PB3504 / Yecora Rojo RIL population (containing 1220 strains) Using PB3504 as the male parent and Yecora Rojo as the female parent, a hybridization was carried out. Starting from the F2 generation, the single-seed transfer method (SSD) was used for 11 consecutive generations of self-pollination, and finally a PB3504 / Yecora Rojo RIL population containing 1220 lines was created.
[0026] 1.2 Phenotypic identification of powdery mildew resistance in the PB3504 / Yecora Rojo RIL population Resistance to powdery mildew was assessed in the PB3504 / Yecora Rojo RIL population, which included 1220 strains, and its related parents, based on the seedling identification method for powdery mildew.
[0027] The method for identifying powdery mildew in wheat seedlings is as follows: When wheat is at the one-leaf-one-heart stage, E09 powdery mildew conidia are inoculated using the sweeping method and evenly inoculated onto the leaves of the wheat plants to be identified. Ten days after inoculation, the disease condition is investigated according to the Sheng Baoqin wheat powdery mildew seedling identification standard of 0-4, and phenotypic data are obtained. The standards for grades 0-4 are as follows: Type 0: Immunity, no lesions or necrosis in the plant; Type 0;: Necrosis, necrotic spots on the leaves; Type 1: Highly resistant, small lesions (generally less than 1 mm in diameter), thin mycelial layer showing green leaf surface, occasionally larger lesions, but still translucent green, very low spore production; Type 2: Moderately resistant, leaf lesions less than 1 mm in diameter, but thicker mycelial layer, not translucent green, can produce a certain amount of spores; Type 3: Moderately susceptible, many leaf lesions, generally greater than 1 mm in diameter, thick mycelial layer, high spore production, but lesions do not merge; Type 4: Highly susceptible, leaf lesions generally greater than 1 mm in diameter, thick mycelial layer, high spore production, lesions merge. (Note: Types 0 and 0; are both classified as grade 0 in the phenotypic data).
[0028] 1.3 Construct BSA-resistant mixed pools and perform BSA-seq sequencing. Phenotypic identification of powdery mildew resistance at the seedling stage was performed on a population of PB3504 / Yecora Rojo RIL containing 1220 strains. The phenotypic results are as follows: Figure 1 As shown. Phenotypic examples of 50 extremely resistant strains and 29 extremely susceptible strains (phenotypes were identified and photographed 10 days after powdery mildew infection). Figure 2 and Figure 3 As shown. Based on phenotypic data, 50 extremely resistant strains and 29 extremely susceptible strains were selected to construct a mixed pool of resistant and susceptible strains for BSA-seq analysis. The specific steps are as follows: 1.3.1 Genomic DNA Extraction and Quality Inspection After grinding the plant tissue samples into powder, a plant DNA extraction kit using magnetic beads was used. Through core processes such as sample lysis, specific binding of nucleic acids to magnetic beads, gradient rinsing to remove impurities, and targeted elution, high-purity and high-integrity genomic DNA (gDNA) was finally obtained.
[0029] DNA quality control: The concentration of gDNA was detected using Qubit, and the integrity of gDNA was detected using agarose gel electrophoresis.
[0030] 1.3.2 Library Construction and Sequencing Library Construction: After DNA quality control, 100 ng of gDNA was fragmented using enzyme digestion. The fragmented DNA was end-finished, phosphorylated at the 5' end, and the fragmented products were end-repaired with dA tails and ligated with universal sequencing adapters. Magnetic beads were used to purify and sort the fragments, retaining adapter ligation products with insert fragments of 200-300 bp. Sequencing primers (with different barcodes to distinguish different samples) were added to the ligation products, and PCR amplification was performed using a high-fidelity PCR reaction system. The amplified products purified by magnetic beads constituted the final probe capture pre-library, which could be used for probe capture experiments.
[0031] The pre-libraries were quality controlled by using Qubit quantitative PCR or qPCR to determine the pre-library concentration and by using an Agilent 4200 or Qseq 400 bioanalyzer to detect the size of library fragments, ensuring that the quality of the pre-libraries met the requirements of the capture experiment.
[0032] Probe capture: After pre-library quality control, the pre-library samples to be captured are mixed in equimolar amounts to form a DNA library pool. The library pool is dried, and capture probes and capture reagents are added to denature the DNA, reacting at 60°C for 16 hours. The captured hybridization products are enriched and washed using streptavidin magnetic beads, then subjected to PCR amplification and purified using magnetic beads to obtain the final capture library.
[0033] Paired-end sequencing: The concentration of the captured library was determined using Qubit quantitative PCR or qPCR, and the library fragment size was detected using an Agilent 4200 or Qseq 400 bioanalyzer. After passing quality control, sequencing was performed using a DNBSEQ-T7 at a sequencing depth of 30×.
[0034] 1.3.3 ED Analysis of BSA-seq Data Based on sequencing data, ED analysis was performed: the frequency distance between mutants in different pools was calculated, and the difference in frequency distance reflected the linkage strength between the marker and the target region. Here, mut and wt represent mutant and wild-type pools, respectively, and A, C, G, and T represent the proportion of sequencing reads for each mutant at the marker site. Based on the obtained SNP locus sets and genotype depth information between pools, the mutation frequency difference, i.e., the ED value, was calculated. To reduce the bias caused by the calculation of individual SNP loci, the results were fitted using the log-odds ratio (LOR). A threshold was set where the fitted ED value was greater than 99% of the confidence interval, and SNP markers significantly associated with the target trait were selected.
[0035] 1.4 BSA-seq analysis for screening key variant sites and locating candidate genes use Association analysis was performed using the SNP-index method to calculate the proportion of SNP sites in the mixed pool that differed from the reference parent. The difference between the two pools was then used to obtain the results. SNP-index value, with a significance threshold set (p < 0.05), is used to search for SNPs on the genome. SNP-index values significantly deviated from the 0 range. Across the entire genome, the ΔSNP-index values on the vast majority of chromosomes fluctuated randomly around 0, indicating that these regions were not significantly associated with powdery mildew resistance. However, an unusually prominent and continuous peak signal was observed on chromosome 6A, such as... Figure 4 As shown, the significant peak region is concentrated within the physical region of 350-470 Mb on wheat chromosome 6A. Within this associated region, the ΔSNP-index value remains consistently high, far exceeding the significance threshold, indicating the presence of a major-effect powdery mildew resistance QTL locus, named PmYZW-6A-1. This locus exhibits strong effects within this genetic context and is an ideal target for developing functional molecular markers.
[0036] Based on the resequencing variant information of the QTL site PmYZW-6A-1, KASP and InDel molecular markers were set within this region. Among them, a 27-base insertion mutation was found in the gene TraesPB6AG3308.1 within the candidate region. Figure 5 As shown.
[0037] Example 2: Development of InDel molecular markers linked to the powdery mildew resistance locus PmYZW-6A-1 in wheat-wheat introgression lines In this embodiment, an InDel molecular marker was developed based on a 27-base insertion mutation in the candidate gene TraesPB6AG3308.1.
[0038] The primer pairs for the developed InDel molecular markers are: InDel-F: 5'-TTTTGGACGACAAGATGGTTATTTA-3' (SEQ ID NO. 3); InDel-R: 5'-ACTCCATTACAGTCTCACGTACCAG-3' (SEQ ID NO. 4).
[0039] The InDel molecular marker is located at positions 231-257 of the nucleotide sequence shown in SEQ ID NO.1. The insertion nucleotide sequence is shown in SEQ ID NO.1, and the deletion nucleotide sequence is shown in SEQ ID NO.2. TTTTGGACGACAAGATGGTTATTTATCAGCATAAGTTATGTGTATGTTTTGGTAATATCGTTATTTCCACCGCAGATAAAGCAGAGAGATTGATAGCAGAGGCTGCTGGATATGGTTCACAGTTGGTGGTGTTCCCGGAAGCTTTT GTTGGTGGTTATCCTCGTGGATCCACCTTTGGCTTCGGGATCAGTATTAGTATCACTAATCCAAAAGACAAGGGAAAGGGTGAATTCCAGAAGTATTATGCAGCCGCCATAGACGTGCCTGGTACGTGAGACTGTAATGGAGT (SEQ IDNO.1); TTTTGGACGACAAGATGGTTATTTATCAGCATAAGTTATGTGTATGTTTTGGTAATATCGTTATTTCCACCGCAGATAAAGCAGAGAGATTGATAGCAGAGGCTGCTGGATATGGTTCACAGTTGGTGGTGTT CCCGGAAGCTTTGTTGGTGGTTATCCTCGTGGATCCACCTTTGGCTTCGGGATCAGTATTAGTATCACTAATCCAAAAGACAAGGGAAAGGGTGAAGACGTGCCTGGTACGTGAGACTGTAATGGAGT (SEQ ID NO.2).
[0040] Example 3: Validation of InDel molecular marker linked to the powdery mildew resistance locus PmYZW-6A-1 in wheat-wheat introgression line Genomic DNA was extracted from the samples using the CTAB method. The extraction method was as follows: First, a CTAB extraction buffer was prepared: 20g CTAB, 82g NaCl, 7.7g EDTA-2Na, and 12.11g Tris. After dissolving, the pH was adjusted to 8.0 with HCl, and the volume was brought to 1L to obtain the CTAB extraction buffer. 1g of fresh plant tissue sample was placed in a sterile 2mL centrifuge tube, frozen in liquid nitrogen, and ground. The CTAB extraction buffer was added, and total DNA was extracted using the CTAB method. The concentration was determined using a Nano Drop micro-ultraviolet spectrophotometer after extraction.
[0041] Using the extracted DNA as a template, PCR amplification was performed using the primer pair with the InDel molecular marker from Example 2.
[0042] PCR amplification system: total volume 10µL, including 1µL template DNA, 1µL primer pair (primer F concentration 10µM, primer R concentration 10µM), 2µL ddH2O, and 5µL 2×Taq PCR Master Mix; PCR reaction program: 94℃ denaturation for 3 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 30 sec, 35 cycles; 72℃ extension for 5 min; storage at 16℃. InDel molecular markers were identified using 4% agarose gel electrophoresis to verify the correlation between InDel molecular marker genotyping and wheat powdery mildew resistance.
[0043] Using the InDel molecular marker from Example 2, genotyping was performed on extremely resistant and susceptible materials and parents from the PB3504 / Yecora RojoRIL population of 1220 lines in Example 1: if only one specific band of 289 bp appeared in the amplification product, it was determined that the wheat tested was susceptible to powdery mildew; if only one specific band of 262 bp appeared in the amplification product, it was determined that the wheat tested was resistant to powdery mildew; the results are as follows. Figure 6 As shown in the figure. Among them, the genotypes of 5 susceptible powdery mildew patients were completely consistent with the genotypes of 2 susceptible parents and the genotypes of mixed susceptible parents, and the genotypes of 15 resistant powdery mildew patients were consistent with the genotypes of the resistant phenotypes.
[0044] To further verify the relationship between the InDel molecular marker genotyping developed in this invention and wheat powdery mildew resistance, the PB3504 / Yecora Rojo RIL population of 1220 lines from Example 1 was selected as a natural population for genotyping and powdery mildew resistance identification. The identification results are as follows: Figure 7 As shown, if the amplification product shows only one specific band of 289 bp, the wheat sample is identified as having a powdery mildew-susceptible genotype (A); if the amplification product shows only one specific band of 262 bp, the wheat sample is identified as having a powdery mildew-resistant genotype (X); if the amplification product shows both 289 bp and 262 bp bands, the wheat sample is identified as having a heterozygous genotype (H). These 1220 wheat lines showed a clear correlation with powdery mildew resistance and susceptibility phenotypes.
[0045] To further verify the relationship between the genotyping of the InDel molecular marker developed in this invention and wheat powdery mildew resistance, eight wheat-Yecora introgression lines (PB03, PB06, PB09, PB300, PB298, PB3504, PB4201, PB2011-1) and other parental lines (924144-2, Jagger, Zhoumai 18, Zhi 7730, Yecora Rojo, FC Dasui, CMH836, Zhoumai 36, Z559, Fukuho) were selected for genotyping. The results are as follows: Figure 8As shown, the InDel molecular marker can effectively distinguish the resistance and susceptibility of wheat-ice grass introgression line materials to powdery mildew.
[0046] The above results indicate that the InDel molecular marker developed in this invention can distinguish the resistance of wheat to powdery mildew.
[0047] The above are merely preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. An InDel molecular marker linked to the powdery mildew resistance site PmYZW-6A-1 in the wheat-ice grass introgression line, characterized in that, The InDel molecular marker is located at positions 231 to 257 of the nucleotide sequence shown in SEQ ID NO.
1.
2. The InDel molecular marker linked to the powdery mildew resistance site PmYZW-6A-1 in the wheat-wheat introgression line according to claim 1, characterized in that, The resistance site PmYZW-6A-1 is located at 442,022,338 bp on chromosome 6A of the Pubing 3504 reference genome.
3. A primer pair, characterized in that, The primer pair is used to amplify the InDel molecular marker of claim 1, which is linked to the powdery mildew resistance site PmYZW-6A-1 in the wheat-wheat introgression line, and the primer pair comprises: InDel-F: The nucleotide sequence is shown in SEQ ID NO.3; InDel-R: The nucleotide sequence is shown in SEQ ID NO.
4.
4. A reagent kit, characterized in that, The kit is used to detect wheat resistance to powdery mildew, and the kit includes the primer pair as described in claim 3; If a specific 289 bp band is amplified using the primer pair, the wheat being tested is identified as having a susceptible genotype. If a specific 262bp band is amplified using the primer pair, the wheat being tested is identified as having a disease-resistant genotype. If a specific band of 289 bp and 262 bp is amplified using the primer pair, the wheat to be tested is identified as a heterozygous genotype.
5. The application of the primer pair according to claim 3 or the kit according to claim 4 in wheat genetic analysis, wherein the wheat genetic analysis includes analysis of wheat powdery mildew resistance genetic diversity, identification of wheat powdery mildew resistance, or powdery mildew-resistant wheat assisted breeding.
6. A method for identifying wheat powdery mildew resistance, characterized in that, include: Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the primer pair described in claim 3. The amplification products were then subjected to electrophoresis, and the powdery mildew resistance of the wheat was determined based on the electrophoretic banding pattern.
7. The method for identifying wheat powdery mildew resistance according to claim 6, characterized in that, The method for determining wheat powdery mildew resistance based on electrophoretic banding patterns is as follows: If the amplification product shows only one specific band of 289 bp, it is determined that the wheat being tested contains a susceptible genotype. If the amplification product shows only one specific band of 262 bp, it is determined that the wheat being tested contains a disease-resistant genotype. If the amplification product shows both 289bp and 262bp bands, it is determined that a heterozygous genotype exists in the wheat being tested.
8. A method for identifying wheat powdery mildew resistance according to claim 6 or 7, characterized in that, The PCR amplification reaction system includes 1 µL of template DNA, 1 µL of 10 µM primer pair, 3 µL of ddH2O, and 5 µL of 2×Taq PCR Master Mix. The primer pair includes InDel-F and InDel-R. The PCR amplification reaction program includes: denaturation at 94 °C for 3 min; denaturation at 94 °C for 30 sec, annealing at 55 °C for 30 sec, extension at 72 °C for 30 sec, for 35 cycles; and extension at 72 °C for 5 min.
9. A method for breeding wheat resistant to powdery mildew, characterized in that, Includes the following steps: Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the primer pair described in claim 3. The amplification product was subjected to electrophoresis, and the powdery mildew resistance of the wheat was determined based on the electrophoretic banding pattern. If the amplification product was 262 bp, the wheat to be tested was retained for breeding.
Citation Information
Patent Citations
Molecular marker linked to introgression line's stripe rust resistance site from Agropyron P genome in adult-plant stage and application thereof
CN107586868A
High-throughput detection marker for wheat powdery mildew resistant gene Pm2b and application of high-throughput detection marker
CN109468409A
Specific molecular marker linked with wheat powdery mildew resistance gene PmCad as well as identification primer and application of specific molecular marker
CN121137241A