Methods and compositions for treating disease

Abstract

The present invention provides a method and composition for treating a disease, wherein the disease is a condition and / or disease of diffuse connective tissue disease. The invention also provides an MHC deficient modified immune cell and a polynucleotide targeting the cell.

Description

[0001] Cross-referencing related applications

[0002] This application claims priority to PCT application PCT / CN2023 / 109440, filed on July 26, 2023, the entire contents of which are incorporated herein by reference. Technical Field

[0003] This invention relates to a method and composition for preventing and / or treating diseases. Background Technology

[0004] Connective tissue diseases refer to any disease affecting the tissues that connect the various structural parts of the body. There are over 200 types, with causes that may be genetic, environmental, and in many cases, unknown. Connective tissue diseases include, but are not limited to, rheumatoid arthritis (RA), scleroderma, granulomatous polyangiitis (GPA), Churg-Strauss syndrome, systemic lupus erythematosus (SLE), microscopic polyangiitis (MPA), idiopathic inflammatory myopathies (IIMs), such as polymyositis (PM), dermatomyositis (DM), amyopathy-free dermatomyositis (ADM), immune-mediated necrotizing myopathy (IMNM), inclusion body myositis (IBM), and juvenile dermatomyositis (JDM), mixed connective tissue disease (MCTD), and undifferentiated connective tissue disease. Because connective tissue diseases are diverse, their symptoms vary, and they can affect different parts of the body, requiring individualized treatment plans based on the patient's specific condition. Current treatment methods include vitamin supplements, physical therapy, and medications.

[0005] CD19 is a protein expressed on the surface of B cells, which are immune cells that produce antibodies. In patients with connective tissue diseases, B cells produce antibodies that target their own tissues, leading to inflammation and tissue damage.

[0006] Autologous chimeric antigen receptor T-cell (CAR-T) therapy has shown significant efficacy in treating certain connective tissue diseases (Müller F et al., "CD19-targeted CAR T-cell therapy for refractory antisynthetic enzyme syndrome", The Lancet, March 11, 2023; 401(10379):815-818). By using CD19-targeted CAR-T therapy, B cells can be selectively eliminated, reducing the production of antibodies against the patient's own tissues.

[0007] In addition, malignant tumors of the lymphatic system, including lymphocytic leukemia and lymphoma, are tumors that occur on lymphocytes such as B cells, T cells, and NK cells. Both B-cell lymphoma and B-cell leukemia express the CD19 antigen. B-cell lymphoma includes Hodgkin's lymphoma (HL) and non-Hodgkin's lymphoma (NHL), while B-cell leukemia includes acute lymphoblastic leukemia (ALL) and chronic lymphocytic leukemia (CLL).

[0008] CD19-CAR-T cells can recognize the CD19 antigen expressed by B cells and release cytokines such as perforin and granzyme, thereby promoting the body's clearance of B-cell lymphoma or B-cell leukemia.

[0009] However, autologous CAR-T therapy faces challenges in manufacturing and is expensive due to the need for personalized treatment. Therefore, allogeneic CAR-T therapy using allogeneic T cells or "off-the-shelf" T cells has attracted significant attention due to its similar clinical efficacy characteristics to autologous products.

[0010] While allogeneic CAR-T therapy holds promise for reducing product costs and batch-to-batch variability, allogeneic immune cells are easily recognized and rejected by the host immune system, thus hindering the therapeutic efficacy of CAR-T cells. Furthermore, allogeneic CAR-T therapy may be subject to immunosuppression, thereby reducing the effector function and cytotoxicity of CAR-T cells. Therefore, there is a need for novel adoptive cell therapies with stronger effector functions and weaker immunogenicity. Summary of the Invention

[0011] A first aspect of the present invention provides a method for preventing and / or treating a condition and / or disease in a subject in need, comprising administering to the subject an effective amount of modified cells and / or a pharmaceutical composition comprising modified cells; The condition or disease mentioned therein is a condition or disease of diffuse connective tissue disease, or a condition or disease of malignant tumors of the lymphatic system. Wherein, relative to the unmodified corresponding cell, the modified cell: Lack of endogenous major histocompatibility complex and endogenous inhibitory checkpoint molecules; The ligands were modified to express inhibitory checkpoint molecules; The ligand therein is a variant of the ligand that has an enhanced ability to induce immunosuppressive signal transduction relative to its homologous ligand.

[0012] In some embodiments of the present invention, the modified cells are derived from any one or a combination of somatic cells, stem cells, or somatic cells.

[0013] In some embodiments of the present invention, the modified cells are derived from immune cells.

[0014] In some embodiments of the present invention, the modified cells are animal cells or human cells.

[0015] In some embodiments of the present invention, the modified cells are allogeneic relative to the subject's cells.

[0016] In some embodiments of the present invention, the unmodified cell is an immune cell, and the immune cell is any one or a combination of T cells, natural killer cells, NKT cells, B cells, macrophages, monocytes, dendritic cells, and neutrophils.

[0017] In another embodiment of the invention, the unmodified cell is a stem cell, and the stem cell is a hematopoietic progenitor cell, hematopoietic stem cell, CD34+ cell, embryonic stem cell, mesenchymal stem cell or iPSC cell.

[0018] In some embodiments of the present invention, the T cell is any one or a combination of αβ T cells, γδ T cells, helper T cells, and regulatory T cells.

[0019] In some embodiments of the present invention, the T cell is an activated T cell.

[0020] In some embodiments of the present invention, the endogenous major histocompatibility complex is a human major histocompatibility complex or a mouse major histocompatibility complex.

[0021] In some embodiments of the present invention, the human major histocompatibility complex comprises human leukocyte antigen class I. Preferably, the gene encoding human leukocyte antigen class I is any one or more of HLA-A, HLA-B, HLA-C, and HLA-E, or a combination thereof.

[0022] In some embodiments of the present invention, the modified cells lack HLA-A and HLA-B.

[0023] In some embodiments of the present invention, the human major histocompatibility complex comprises human leukocyte antigen class II. Preferably, the gene encoding the human leukocyte antigen class II is any one or more of HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR, or any combination thereof.

[0024] In some embodiments of the present invention, the modified cells also lack human leukocyte antigen class II. For example HLA-DR.

[0025] In some embodiments of the present invention, the mouse major histocompatibility complex comprises histocompatibility-2 class I molecules.

[0026] Preferably, the gene encoding the tissue compatibility-2 class I is any one or more of H-2K and H-2D, or a combination thereof.

[0027] In a preferred embodiment of the invention, the modified cells also lack endogenous inhibitory checkpoint molecules.

[0028] In some embodiments of the invention, the modified cells lack the endogenous inhibitory checkpoint molecule and endogenous major histocompatibility complex as described in the invention, and are modified to express ligands of the endogenous inhibitory checkpoint molecule.

[0029] In some embodiments of the present invention, the endogenous inhibitory checkpoint molecule is any one or more of PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), CTLA-4 (CD152), IDO1, IDO2, TDO, KIR, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329).

[0030] In some embodiments of the present invention, the ligand is any one or more of PD-L1, PD-L2, HMGB1, Ceacam-1, phosphatidylserine (PS), LSECtin, α-synuclein, FGL1, adenosine, HVEM (herpesvirus entry mediator), CD28, B7-H3 (CD276), B7-H4 (VTCN1), PVR (CD155), HLA class I, sialic acid glycoprotein, CD112, CD113, galactolectin 9, CD24, and CD47.

[0031] In some embodiments of the invention, the variant contains at least one mutation that increases the ability to induce immunosuppressive signaling.

[0032] In some embodiments of the present invention, the mutation is any one of substitution, deletion, insertion, or any combination thereof.

[0033] In some embodiments of the present invention, the mutation is the deletion of at least one amino acid residue.

[0034] In some embodiments of the invention, the variant lacks at least a portion of the extracellular domain, transmembrane domain, and / or intracellular domain, relative to a homologous inhibitory checkpoint molecule or its ligand.

[0035] In some embodiments of the present invention, the inhibitory checkpoint molecule is PD-1; and / or its ligand is PD-L1.

[0036] In some embodiments of the present invention, the inhibitory checkpoint molecule is PD-1, and its ligand is PD-L1.

[0037] In some embodiments of the invention, variants of the ligand have the amino acid sequence of SEQ ID NO: 7 or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identity with SEQ ID NO: 7.

[0038] In some embodiments of the invention, the modified cells are engineered to contain chimeric antigen receptors or T-cell receptors.

[0039] In some embodiments of the present invention, the CAR includes an antigen-binding domain, a transmembrane domain, and an intracellular signal transduction domain; further optionally, the CAR also includes a co-stimulatory signal transduction region.

[0040] In some embodiments of the present invention, the antigen is selected from one or more of BCMA, CD7, CD10, CD19, CD20, CD22, CD24, CD30, CD33, CD34, CD38, CD44, CD79a, CD79b, CD123, CD138, CD179b, CEA, CLEC12A, Claudin18.2, CS-1, DLL3, EGFR, EGFRvIII, EPCAM, FLT-3, FOLR1, FOLR3, GD2, gpA33, GPC3, HER2, HM1.24, LGR5, Mesothelin, MSLN, MCSP, MICA / B, PSMA, PAMA, P-cadherin, and ROR1; For example The antigen is CD19.

[0041] In some embodiments of the present invention, the modified cells or their pharmaceutical compositions may be administered alone or in combination.

[0042] In some embodiments of the invention, the diffuse connective tissue disease includes systemic lupus erythematosus (SLE), scleroderma, rheumatoid arthritis (RA), idiopathic inflammatory myopathy (IIM), Churg-Strauss syndrome, and microscopic polyangiitis.

[0043] In some embodiments of the present invention, the idiopathic inflammatory myopathy (IIM) includes, but is not limited to, polymyositis (PM), dermatomyositis (DM), amyopathy-free dermatomyositis (ADM), immune-mediated necrotizing myopathy (IMNM), inclusion body myositis (IBM), and juvenile dermatomyositis (JDM).

[0044] In some embodiments of the invention, the malignant tumors of the lymphatic system include B-cell lymphoma and B-cell leukemia. The B-cell lymphomas include Hodgkin lymphoma (HL) and non-Hodgkin lymphoma (NHL), and the B-cell leukemias include acute lymphoblastic leukemia (ALL) and chronic lymphoblastic leukemia (CLL).

[0045] In a preferred embodiment of the present invention, the modified cells are prepared and / or expanded under in vitro, in vivo or ex vivo conditions.

[0046] In some embodiments of the invention, the subject in need is a subject who has received at least 1, 2, 3 or 4 immunosuppressive treatments; preferably, the treatment comprises one or more of the following: glucocorticoids, hydroxychloroquine, mycophenolate mofetil, tacrolimus, cyclophosphamide, azathioprine, tocilizumab, methotrexate, telitacicept, belimumab and rituximab.

[0047] A second aspect of the invention provides a modified cell or a population thereof, wherein the modified cell is the modified cell defined in the first aspect.

[0048] A third aspect of the invention provides a polynucleotide that targets the major histocompatibility complex, wherein the polynucleotide is capable of inactivating or attenuating the expression of the major histocompatibility complex.

[0049] In some embodiments of the present invention, the gene encodes a major histocompatibility complex class I molecule.

[0050] In some embodiments of the present invention, the polynucleotide is sgRNA.

[0051] In some embodiments of the present invention, the major histocompatibility complex is a human major histocompatibility complex. For example HLA-A, HLA-B, HLA-C and / or HLA-E.

[0052] In some embodiments of the present invention, the sgRNA targets any one of the DNA sequences of SEQ ID NO: 29-45 and 73-168.

[0053] A fourth aspect of the invention provides a method for producing the modified cells of the second aspect, comprising the steps of introducing the polynucleotide and gene editing system of the third aspect.

[0054] In some embodiments of the present invention, the gene editing system is a CRISPR system.

[0055] A fifth aspect of the invention provides a pharmaceutical composition comprising (1) the modified cells of the second aspect, and / or the polynucleotide of the third aspect, and (2) a pharmaceutically acceptable carrier and / or excipient.

[0056] A sixth aspect of the invention provides a kit comprising the modified cells of the second aspect or the pharmaceutical composition of the fifth aspect.

[0057] The seventh aspect of the invention provides modified cells or populations thereof of the second aspect, polynucleotides of the third aspect, pharmaceutical compositions of the fifth aspect, and kits of the sixth aspect for the prevention and / or treatment of symptoms and / or diseases of diffuse connective tissue diseases or malignant tumors of the lymphatic system.

[0058] In some embodiments of the invention, the diffuse connective tissue disease includes systemic lupus erythematosus (SLE), scleroderma, rheumatoid arthritis (RA), idiopathic inflammatory myopathy (IIM), Churg-Strauss syndrome, and microscopic polyangiitis.

[0059] In some embodiments of the present invention, the idiopathic inflammatory myopathy includes, but is not limited to, polymyositis (PM), dermatomyositis (DM), amyopathy-associated dermatomyositis (ADM), immune-mediated necrotizing myopathy (IMNM), inclusion body myositis (IBM), and juvenile dermatomyositis (JDM).

[0060] In some embodiments of the present invention, the malignant tumors of the lymphatic system include B-cell lymphoma and B-cell leukemia.

[0061] In some embodiments of the invention, the B-cell lymphoma includes Hodgkin lymphoma (HL) and non-Hodgkin lymphoma (NHL), and the B-cell leukemia includes acute lymphoblastic leukemia (ALL) and chronic lymphoblastic leukemia (CLL).

[0062] The seventh aspect of the invention provides the use of the modified cells or populations thereof of the second aspect, the polynucleotides of the third aspect, the pharmaceutical compositions of the fifth aspect, and the kits of the sixth aspect in the preparation of medicaments for the prevention and / or treatment of diffuse connective tissue diseases.

[0063] In some embodiments of the invention, the diffuse connective tissue disease includes systemic lupus erythematosus (SLE), scleroderma, rheumatoid arthritis (RA), idiopathic inflammatory myopathy (IIM), Churg-Strauss syndrome, and microscopic polyangiitis.

[0064] In some embodiments of the present invention, the idiopathic inflammatory myopathy includes, but is not limited to, polymyositis (PM), dermatomyositis (DM), amyopathy-associated dermatomyositis (ADM), immune-mediated necrotizing myopathy (IMNM), inclusion body myositis (IBM), and juvenile dermatomyositis (JDM). Attached Figure Description

[0065] Figure 1A A schematic diagram of a chimeric antigen receptor (CAR) expression construct is shown. Figure 1B This diagram illustrates the integration of the CAR expression construct into a lentiviral vector.

[0066] Figure 2 The expression of CD19CAR in 293T cells infected with the CD19CAR-P2A-TrPD-L1 lentiviral expression vector at different viral loads (i.e., 1 μL / well, 10 μL / well, 20 μL / well, 30 μL / well, or 50 μL / well) is shown by flow cytometry.

[0067] Figure 3A and Figure 3B The expression of CD19 CAR and TrPD-L1 in TrPDL1-CART transfected with a lentivirus containing the CD19 CAR-P2A-TrPD-L1 expression cassette, as detected by flow cytometry, are shown.

[0068] Figure 4A and Figure 4B It shows an incubation period of 24 hours ( Figure 4A ) or 48 hours ( Figure 4B The cytolytic effect of TrPDL1-CART cells and TrPDL1-UCART cells on Raji cells (B cells expressing luciferase) at different effector-to-target (E:T) ratios was investigated. Natural T cells were used as a control.

[0069] Figure 5A and Figure 5B This shows that after incubation with Raji cells expressing luciferase (Raji-Luci) for 24 hours, TNF-α in TrPDL1-CART cells and TrPDL1-UCART cells was observed. Figure 5A ) and IFN-γ ( Figure 5B The release of ).

[0070] Figure 6A schematic diagram of plasmid pELPS is shown.

[0071] Figure 7 Some sequences disclosed in this invention are shown.

[0072] Figure 8A and Figure 8B This study demonstrates the therapeutic effect of CAR-T cell therapy on scleroderma patients. The number of B cells and UCART cells, as well as the CAR copy number, both significantly increased. Simultaneously, the secretion level of the cytokine IL-6 was low during treatment.

[0073] Figure 9 The clinical endpoint assessment of scleroderma subjects is shown.

[0074] Figures 10A-10C It shows changes in skin and organ function in scleroderma subjects. Figure 10A Ultrasound elastography was used to assess skin elasticity and firmness, indicating a gradual reversal of skin fibrosis. Left image: Color elastography image (red tones indicate firmer tissue, blue tones indicate softer tissue). Right image: Elastography measurements of skin firmness. Figure 10B HRCT scans showed that both patients experienced improvement in lung inflammation and fibrosis after UCART intervention. Figure 10C Left ventricular short-axis CMR in both patients showed a reduction in myocardial inflammation and fibrosis after UCART intervention.

[0075] Figure 11A The study showed increased expansion of CAR-T cells in the peripheral circulation after injection.

[0076] Figure 11B This showed a significant increase in the number of genomic CAR copies per unit mass after injection. exist In vivo, CAR T cells rapidly increased, accounting for 0.37% of the total circulating T cells on day 0 and 61% on day 8. The number of CAR T cells per microliter was 184 and 210.1 on days 8 and 14, respectively. The CAR copy number per microliter was 63,736 and 84.1, respectively.

[0077] Figure 11C It showed a significant reduction in B cells (the target cells of the CAR-T cells of this invention) in the peripheral circulation after injection, with the number of B cells in the peripheral circulation eventually dropping to zero.

[0078] Figure 12A and Figure 12B The study showed significant improvement in dermatomyositis patients after CAR-T cell therapy. Clinical indicators included LDH, CK, IgG, physical function, and muscle strength.

[0079] Figure 13The study showed a significant reduction in lung inflammation after CAR-T cell therapy.

[0080] Figure 14 The clinical assessments of subject IMNM-01 are shown. A: Primary clinical improvement assessment; B: Other clinical improvement assessments.

[0081] Figure 15 The images show muscle MRI scans, ILD changes, and muscle biopsies of subject IMNM-01. A: MRI scans of the thigh muscles, including coronal and axial STIR sequences and T1-weighted images, were performed to track the extent of myositis and atrophy following UCART treatment; B: Immunohistochemistry of the muscle biopsy showed changes associated with muscle damage (enrichment of anti-SRP antibodies, CD4 and CD8 T cells, and CD68 macrophages in the microenvironment).

[0082] Figure 16 The clinical endpoint assessment of SLE subjects is shown.

[0083] Figure 17 The changes in SLEDAI scores were shown in subjects with refractory SLE.

[0084] Figure 18 The percentage of CART cells in lymphocytes is shown after UCART infusion.

[0085] Figure 19 The CART cell count is displayed after UCART infusion.

[0086] Figure 20 The number of CAR copies after UCART infusion is displayed.

[0087] Figure 21 The percentage of B cells in the peripheral blood of the subjects was displayed.

[0088] Figure 22 The B cell count in the peripheral blood of the subjects was displayed. Detailed Implementation

[0089] definition

[0090] As used herein, terms or expressions are used for the purpose of describing a particular implementation and are not intended to be limiting.

[0091] It should be noted that the terms “an” or “a” entity refer to one or more of the entity; for example, “an antibody” should be understood to represent one or more antibodies. Therefore, the terms “an” (or “a”), “one or more” and “at least one” are used interchangeably in this document.

[0092] Unless the context clearly indicates otherwise, the singular terms “an,” “a,” and “the” include plural objects. For example, reference to “cell” means one or more cells, and reference to “the method” includes reference to equivalent steps and methods disclosed herein and / or known to those skilled in the art, and so on. Similarly, the word “and / or” is intended to include both “and” and “or” unless the context clearly indicates otherwise. Although similar or equivalent methods and materials to those described herein may be used in the practice or testing of the invention, suitable methods and materials are described below. The abbreviation “eg” is derived from the Latin *exempli gratia* and is used herein to denote a non-limiting example. Therefore, the abbreviation “eg” is synonymous with the term “for example.”

[0093] In all instances where a series of numerical values ​​are listed in this application, it should be understood that any of the listed values ​​can serve as an upper or lower limit of the numerical range. It should also be understood that this invention covers all such numerical ranges, i.e., ranges having a combination of upper and lower numerical limits, where each upper and lower limit can be any of the values ​​listed herein. The ranges provided herein should be understood to include all values ​​within that range. For example, 1-10 should be understood to include all values ​​1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, as well as appropriate fractional values. Similarly, ranges defined by “at least” should be understood to include the provided lower limit value and all higher numbers.

[0094] As used herein, “about” should be understood to include within three standard deviations of the mean or within the standard tolerances of a specific domain. In some implementations, “about” is understood to include a variation of no more than 0.5.

[0095] The term "include" in this document means the phrase "including but not limited to" and is used interchangeably with it. Similarly, "such as" in this document means the phrase "such as but not limited to" and is used interchangeably with it.

[0096] As used herein, the terms “comprising” or “including” are used to refer to compositions, methods, and their respective components that are essential to a method or composition but are permitted to include unspecified elements (whether necessary or not).

[0097] The term "composed of" refers to the compositions, methods and their corresponding components as described herein, excluding any elements not listed in the description of the embodiments.

[0098] The term "operably linked" refers to the juxtaposition of two or more target biological sequences in a manner that allows them to function in the intended way, with or without spacers or linkers. When used for proteins, it is intended to indicate that protein sequences are linked in a manner that allows the linked product to have the intended biological function. The term can also be used for polynucleotides. For example, when a polynucleotide encoding a protein is operably linked to a regulatory sequence (e.g., a promoter, enhancer, silencer sequence, etc.), it is intended to indicate that the polynucleotide sequences are linked in a manner that allows the protein to be expressed under the regulation of the polynucleotide.

[0099] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. The term also applies to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of the corresponding naturally occurring amino acids, as well as to both naturally occurring and non-naturally occurring amino acid polymers.

[0100] As used herein, the terms “nucleotide,” “nucleic acid,” or “polynucleotide” include oligonucleotides (i.e., short polynucleotides). They also refer to synthetic and / or non-naturally occurring nucleic acid molecules (e.g., those containing nucleotide analogs or modified backbone residues or links). The term also refers to deoxyribonucleotides or ribonucleotide oligonucleotides in single-stranded or double-stranded form. The term covers nucleic acids containing natural nucleotide analogs. The term also covers nucleic acid-like structures with a synthetic backbone. Unless otherwise specified, a particular polynucleotide sequence also implicitly includes variants of its conserved modifications (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as explicitly stated sequences. Specifically, degenerate codon substitution can be achieved by generating a sequence in which the third position of one or more selected (or all) codons is replaced with a mixture of bases and / or deoxyinosine residues (see Batzer et al., Nucleic Acid Research 19:5081 (1991); Ohtsuka et al., Journal of Biochemistry 260:2605-2608 (1985); and Rossolini et al., Molecular and Cellular Probes 8:91-98 (1994)).

[0101] The "sequence identity percentage (%)" is defined as the percentage of amino acid (or nucleic acid) residues in a candidate sequence that are identical to those in a reference sequence after sequence alignment and the introduction of vacancies (if necessary) to achieve the maximum number of identical amino acids (or nucleic acids). In other words, the sequence identity percentage (%) of an amino acid sequence (or nucleic acid sequence) can be calculated by dividing the number of identical amino acid residues (or bases) relative to the reference sequence with which it is compared by the total number of amino acid residues (or bases) in either the candidate sequence or the reference sequence (whichever is shorter). Conservative substitutions of amino acid residues are not considered identical residues. Alignments performed to determine the percentage of identity in amino acid (or nucleic acid) sequences can be performed, for example, using publicly available tools such as BLASTN, BLASTp (available on the website of the National Center for Biotechnology Information (NCBI), see also Altschul SF et al., *Journal of Molecular Biology* 215:403–410 (1990); Stephen F. et al., *Nucleic Acid Research* 25:3389–3402 (1997)), ClustalW2 (available on the website of the European Institute for Bioinformatics, see also Higgins DG et al., *Enzymological Methods* 266:383-402 (1996); Larkin MA et al., *Bioinformatics* (Oxford, UK) 23(21): 2947-8 (2007)), and ALIGN or Megalign (DNASTAR) software. Those skilled in the art can use the default parameters provided by the tools, or can customize parameters suitable for the alignment, such as by selecting an appropriate algorithm.

[0102] "Conservative substitution" in the context of amino acid sequences refers to the substitution of amino acid residues with different amino acid residues having side chains with similar physiological and chemical properties. For example, conservative substitution can occur between amino acid residues with hydrophobic side chains (e.g., Met, Ala, Val, Leu, and Ile), between residues with neutral hydrophilic side chains (e.g., Cys, Ser, Thr, Asn, and Gln), between residues with acidic side chains (e.g., Asp and Glu), between amino acids with basic side chains (e.g., His, Lys, and Arg), or between residues with aromatic side chains (e.g., Trp, Tyr, and Phe). As is known in the art, conservative substitution generally does not cause significant changes in protein conformation and structure, thus preserving the protein's biological activity.

[0103] As used herein, the term "functional equivalent" refers to a different form of the parent molecule (e.g., variant, fragment, fusion, derivative, and mimic) that retains the essential biological activity of the parent molecule despite differences in amino acid sequence or chemical structure. As used herein, "retaining essential biological activity" means exhibiting at least a portion (e.g., not less than about 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%) or all of the biological activity of the parent molecule. Functional equivalents of parent proteins can include naturally occurring variant forms and non-natural forms, such as those obtained through recombinant methods or chemical synthesis. Functional equivalents may contain non-natural amino acid residues.

[0104] As used herein, the term “deficient” means an insufficient level of activity or activity, and may include, for example, below normal activity or activity, or absence or lack of activity or activity.

[0105] As used herein, the term "CAR" is used interchangeably with the term "chimeric antigen receptor" and refers to a modified or artificial receptor or the polynucleotide encoding it. Modified or synthetic receptors include extracellular domains (including antigen-binding domains), transmembrane domains, and / or intracellular signaling domains that are interconnected or operatively interconnected, and confer specificity to antigens on immune effector cells, bypassing MHC class I and II restrictions.

[0106] The term "chimeric antigen receptor T cell" is used interchangeably with "CAR-T cell" or "CAR-T cell" and refers to (e.g., through genetic engineering) T cells or a population thereof that are modified to express CAR on the surface of T cells. CAR-T cells can be CD4+ helper T cells and / or CD8+ effector T cells. CAR-T cells can bind to target cells expressing target antigens and initiate an immune response against the target cells.

[0107] The term "TCR" as used herein is used interchangeably with "T cell receptor" or "TCR complex," referring to either a natural (or endogenous) TCR or a modified TCR. A TCR is a disulfide-linked membrane-anchored heterodimeric protein complex, typically comprising highly variable α and β chains, which are complexed with CD3γ, CD3δ, two CD3ε chains, and a CD3-zeta chain. The amino acid sequences of the α and β chains differ among different T cells. The transmembrane regions of the α and β chains are surrounded by an open barrel of CD3 transmembrane regions. The intracellular tails of the CD3γ, CD3δ, and CD3ε molecules each contain a single conserved motif called the immunoreceptor tyrosine-based activation motif (ITAM), which is crucial for the signal transduction capabilities of the TCR complex and its ability to initiate signal transduction upon binding to the antigen-MHC complex.

[0108] As used herein, the term "T cell receptor T cell" is used interchangeably with the term "TCR-T cell" and refers to a population of T cells or T cells that have been modified by biological methods (e.g., genetic engineering) to express TCRs on the surface of T cells. TCR-T cells can be CD4+ helper T cells and / or CD8+ effector T cells. TCR-T cells can recognize MHC-binding cells to initiate an immune response and can therefore target intracellular targets on target cells.

[0109] As used herein, the term "B2M" is used interchangeably with "β-2 microglobulin" and refers to a protein that is a component of the major histocompatibility complex (MHC) class I, including the amino acid sequence shown in UniProtKB accession number P61769 or a variant thereof that retains immunomodulatory activity, or to a polynucleotide encoding the aforementioned protein. B2M is essential for the cell surface expression of MHC class I and the stability of peptide binding grooves. In the absence of B2M, MHC class I molecules are barely detectable on the cell surface.

[0110] As used herein, the term “MHC” is used interchangeably with the term “major histocompatibility complex” and refers to a protein or polynucleotide encoding an intracellular peptide that can present intracellular peptides as antigens to the cell surface and form complexes with antigens present on the cell surface. MHC-antigen complexes can interact with the TCR and its co-receptors to induce an immune response (e.g., T cell activation). MHC is classified into MHC class I, MHC class II, and MHC class III. MHC class I molecules, expressed in all nucleated cells and platelets, contribute to cellular immunity against intracellular pathogens such as viruses and bacteria. In humans, MHC class I is referred to as human leukocyte antigen (HLA) class I, which includes HLA-A, HLA-B, HLA-C, HLA-E, HLE-F, and HLA-G molecules. MHC class II is typically found only on macrophages, B cells, and dendritic cells and can mediate immune tolerance to antigens under certain conditions. In humans, MHC class II is referred to as HLA class II. MHC (or HLA) molecules can act as antigens during transplantation, thereby eliciting an immune response in the recipient and causing transplant rejection. Abbas AB, Lichtman AH (2009). pp. Chapter 10, "Immune Responses to Tumors and Transplants." *Basic Immunology: Functions and Disorders of the Immune System* (3rd Edition). Saunders (Elsevier). ISBN 978-1-4160-4688-2.

[0111] As used herein, the term "CIITA" is used interchangeably with the term "class II major histocompatibility complex transactivator," referring to proteins that possess an amino acid sequence with at least approximately 80% sequence identity to NCBI accession number NP_001273331.1 or its functional fragments but still retain immunomodulatory activity, or to polynucleotides encoding such proteins. CIITA is classified as a transcriptional coactivator, which functions by activating transcription factor RFX5, thereby positively regulating the expression of HLA class II genes.

[0112] As used in this article, the term “effective function” for immune cells refers to the specialized functions of the cell, such as phagocytic activity, cytolytic activity, or helper activity, including cytokine secretion by T cells.

[0113] As used in this article, “treatment” of a symptom includes relieving the symptom, slowing the onset or occurrence rate of the symptom, reducing the risk of developing the symptom, preventing or delaying the occurrence of symptoms associated with the symptom, reducing or ending symptoms associated with the symptom, producing complete or partial remission of the symptom, curing the symptom, or some combination thereof.

[0114] As used herein, the term "vector" refers to a medium into which a polynucleotide encoding a protein is operatively inserted to induce the expression of that protein. Vectors can be used to transform, transduce, or transfect host cells to induce the expression of their carried genetic elements within the host cells. Examples of vectors include plasmids, phage particles, granules, artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC), bacteriophages such as λ phage or M13 phage, and animal viruses. Animal viruses used as vectors include retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomaviruses (e.g., SV40). Vectors may contain a variety of elements that control expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, vectors may contain an origin of replication. Vectors may also include substances that facilitate their entry into cells, including but not limited to viral particles, liposomes, or protein coatings. Vectors can be expression vectors or cloning vectors. This invention provides vectors (e.g., expression vectors) containing a nucleic acid sequence encoding a fusion protein as provided herein, at least one promoter operatively linked to the nucleic acid sequence (e.g., SV40, CMV, EF-1α), and at least one selection marker. Examples of vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, papillomaviruses, polycystic papillomaviruses (e.g., SV40), λ phages and M13 phages, plasmids pcDNA3.3, pMD18-T, pOptivec, pCMV, pEGFP, pIRES, pQD-Hyg-GSeu, pALTER, pBAD, pcDNA, pCal, pL, pET, and pGEME. X, pGEX, pCI, pEGFT, pSV2, pFUSE, pVITRO, pVIVO, pMAL, pMONO, pSELECT, pUNO, pDUO, Psg5L, pBABE, pWPXL, pBI, p 15TV-L, pPro18, pTD, pRS10, pLexA, pACT2.2, pCMV-SCRIPT.RTM., pCDM8, pCDNA1.1 / amp, pcDNA3.1, pRc / RSV, PCR 2.1, pEF-1, pFB, pSG5, pXT1, pCDEF3, pSVSPORT, pEF-Bos, etc.

[0115] The term "host cell" as used in this article refers to a cell in which exogenous polynucleotides and / or vectors have been introduced.

[0116] The term “pharmaceutically acceptable” means that the specified carrier, solvent, diluent, excipient and / or salt is generally chemically and / or physically compatible with other components contained in the formulation and physiologically compatible with their receptors.

[0117] As used herein, the terms “subject” or “individual” or “animal” or “patient” refer to a human or non-human animal, including mammals or primates, in need of diagnosis, prognosis, improvement, prevention, and / or treatment of a disease or condition. Mammal subjects include humans, livestock, farm animals, as well as zoo animals, sporting animals, or pet animals, such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, pigs, cattle, bears, etc.

[0118] I. Overview

[0119] Adoptive cell therapy involves the adoption of autologous cells (i.e., cells from the recipient's own body) or allogeneic cells (i.e., cells from a donor different from the recipient). For example, immune cells, or more specifically, T cells, have high therapeutic value. Immune cells or T cells can be modified in vitro to express CARs or TCRs on their cell surface, mediating a specific immune response against target cells (e.g., cancer cells) expressing certain target antigens.

[0120] Although allogeneic cells are in high demand in clinical settings to provide promising off-the-shelf cell therapies, these therapies are also associated with the risk of graft-versus-host disease (GVHD) because the host immune system rejects them by recognizing HLA class I molecules expressed on the surface of allogeneic cells.

[0121] Furthermore, therapeutic immune cells (such as CAR-T or TCR-T cells) may suffer from immunosuppression, leading to reduced effector function and consequently decreased therapeutic efficacy. Immunosuppression can be induced, for example, by the interaction between immune checkpoints such as PD-1 present on these immune cells and immune checkpoint ligands such as PD-L1 expressed on target cells such as tumor cells.

[0122] This invention provides modified cells that, on the one hand, are less sensitive to immune-mediated recognition and destruction from allogeneic receptors, and on the other hand, maintain the desired therapeutic effect (e.g., cytotoxicity) against the target cells to be treated. The invention will be described in more detail below.

[0123] II. Modified cells

[0124] In one aspect, the present invention provides a modified cell or population thereof, said modified cell relative to an unmodified corresponding cell: i) lacking endogenous major histocompatibility complex; and ii) modified to express endogenous inhibitory checkpoint molecules or ligands thereof. In some embodiments, said cell is an immune cell.

[0125] In another aspect, the present invention provides a modified cell or population thereof, said modified cell relative to an unmodified corresponding cell: i) lacking an endogenous inhibitory checkpoint molecule; and ii) being engineered to express a ligand of said lacking endogenous inhibitory checkpoint molecule. In some embodiments, said cell is an immune cell.

[0126] In another aspect, the present invention provides a modified cell or population thereof, said modified cell relative to an unmodified corresponding cell: i) lacking an endogenous inhibitory checkpoint molecule; ii) being modified to express a ligand of said lacking endogenous inhibitory checkpoint molecule; and iii) lacking an endogenous major histocompatibility complex.

[0127] To reduce or avoid immune rejection from the host immune system, allogeneic immune cells can be modified to express ligands of inhibitory immune checkpoint molecules (e.g., PD-L1), such that the expressed ligands can interact with inhibitory immune checkpoint molecules (e.g., PD-1) expressed on host immune cells, thereby protecting the allogeneic immune cells from immune rejection by the host immune system. However, the inventors unexpectedly discovered that when modified allogeneic immune cells endogenously express inhibitory immune checkpoint molecules (e.g., PD-1), it may potentially lead to autosuppression, where the endogenous inhibitory immune checkpoint molecule present on one modified cell (e.g., a modified immune cell) can interact with its ligand present on another modified cell (e.g., a modified immune cell). Therefore, the inventors considered modified cells that, on the one hand, lack endogenous inhibitory immune checkpoint molecules, and on the other hand, are modified to express ligands of the lacking endogenous inhibitory immune checkpoint molecules. This invention shows that such modified cells can be used to reduce autosuppression and provide significantly enhanced therapeutic effects.

[0128] On the other hand, the present invention provides a modified cell or population thereof, which is engineered to express a ligand of an inhibitory immune checkpoint molecule, the ligand being a variant of the homologous ligand, and characterized by having a reduced ability to induce immunosuppressive signaling relative to the homologous ligand. In some embodiments, the variant ligand lacks the functional immunosuppressive signaling domain of the homologous ligand.

[0129] While expression of homologous ligands (e.g., PD-L1) of inhibitory immune checkpoint molecules on allogeneic cells can protect them from immune rejection, the inventors have unexpectedly discovered that expression of such ligands on cells (e.g., immune cells) can also induce immunosuppression in cells expressing the ligands, possibly through the inherent immunosuppressive signaling domains of the homologous ligands. Some ligands of inhibitory immune checkpoint molecules are transmembrane proteins (e.g., PD-L1) and have been found to contain cytoplasmic domains capable of mediating immunosuppressive signaling. Following interaction between the ligand and the corresponding inhibitory immune checkpoint molecule on a host immune cell, the ligand itself can also be activated by mediating immunosuppressive signaling in cells expressing the ligand (e.g., immune cells). Therefore, another aspect of the invention provides modified cells engineered to express variant ligands, which, relative to the homologous ligands, have a reduced ability to induce immunosuppressive signaling, thereby significantly reducing or minimizing potential immunosuppression in allogeneic cells expressing the ligands.

[0130] In another aspect, the present invention provides a modified cell or population thereof, the modified cell relative to the unmodified corresponding cell: i) lacks an endogenous inhibitory immune checkpoint molecule; and ii) is modified to express a ligand of the lacking endogenous inhibitory immune checkpoint molecule, wherein the ligand is a variant of the homologous ligand and has a reduced ability to induce immunosuppressive signaling relative to the homologous ligand (e.g., lacking a functional immunosuppressive signaling domain of the homologous ligand).

[0131] In another aspect, the present invention provides a modified cell or population thereof, wherein the modified cell is engineered to express a ligand of an inhibitory immune checkpoint molecule, wherein the ligand is a variant of a homologous ligand, and is characterized by having a reduced ability to induce immunosuppressive signaling relative to the homologous ligand, and wherein the cell lacks an inhibitory immune checkpoint molecule corresponding to the ligand.

[0132] As used in this article, the term "modified" refers to cells that have undergone structural or functional alterations. For example, cells can be modified by introducing nucleic acids or bioactive agents.

[0133] In some implementations, the modified cells are animal cells or human cells.

[0134] In some embodiments, the modified cells are immune cells or any other type of cell for which cellular activity, such as cytolytic activity or effector function, is desired to be preserved. In some embodiments, the modified cells are immune cells. As used herein, the term "immune cell" refers to a cell that, once activated, is capable of evoking an immune response against a target antigen. Exemplary immune cells include, but are not limited to, T cells (e.g., CD4+ T cells, CD8+ T cells, cytotoxic T cells, terminal effector T cells, memory T cells, naive T cells, regulatory T cells, natural killer T cells, γ-δ T cells, cytokine-induced killer (CIK) T cells and tumor-infiltrating lymphocytes, CD4+ / CD8+ T cells, CD4- / CD8- T cells, helper T cells (e.g., helper T cell 1 (Th1), helper T cell 2 (Th2) cells, or CD4-expressing helper T cells (CD4+ T cells)), natural killer (NK) cells, NKT cells, B cells, macrophages, tumor-infiltrating lymphocytes, monocytes, dendritic cells, neutrophils, and γ-δ T cells).

[0135] Immune cells can be obtained from any location in the subject where they are present, such as blood, cord blood, thymus, pleural effusion, lymph nodes, spleen, splenic tissue, tumors, and bone marrow. Isolated immune cells can be directly engineered or (e.g., by freezing) stored for a period of time.

[0136] In some implementations, immune cells may be T cells, natural killer (NK) cells, NKT cells, B cells, macrophages, tumor-infiltrating lymphocytes, monocytes, dendritic cells, neutrophils, or γδT cells.

[0137] In some embodiments, the immune cells are T cells selected from the group consisting of: CD4+ T cells, CD8+ T cells, cytotoxic T cells, terminal effector T cells, memory T cells, naive T cells, regulatory T cells, natural killer T cells, γ-δ T cells, cytokine-induced killer (CIK) T cells, and tumor-infiltrating lymphocytes. In some embodiments, the T cells are activated T cells. In some embodiments, various techniques known in the art, such as apheresis, can be used to obtain T cells from blood collected from a subject. In some embodiments, CD4+ helper T cells and CD8+ cytotoxic T cells are isolated.

[0138] In some embodiments, the modified cells are stem cells or cells differentiated from stem cells. In some embodiments, the stem cells include one or more gene modifications (e.g., nucleotide insertions, deletions, and substitutions) in their genome. These gene modifications are retained and maintain their functionality in subsequently derived cells (e.g., the recombinant cells provided herein) after differentiation, expansion, passage, and / or transplantation. A detailed description of methods for modifying stem cells (e.g., iPSCs) and differentiating modified stem cells to obtain functional differentiated cells can be found, for example, WO2021011919, the entire text of which is incorporated herein by reference.

[0139] In some implementations, stem cells are hematopoietic progenitor cells (e.g., T cell progenitor cells, NK cell progenitor cells, macrophage progenitor cells), hematopoietic stem cells (HSCs), CD34+ cells, cell lines of embryonic stem cells, mesenchymal stem cells, or iPSCs.

[0140] In some implementations, the cells are adapted for transplantation. The cells can be any type of cell that is suitable for transplantation or that is expected to have reduced immune rejection from the host.

[0141] In one embodiment, the modified cells provided herein may be derived from cells (e.g., immune cells) isolated from a subject (e.g., a human subject, such as a subject suspected of having a specific disease or condition, a subject susceptible to a specific disease or condition, or a subject who will receive, is receiving, or has received treatment for a specific disease or condition). In some embodiments, the modified cells are derived from cells (e.g., immune cells isolated from a subject as a healthy volunteer or healthy donor, or from a blood bank). Therefore, the modified cells provided herein may be autologous or allogeneic for the target subject.

[0142] In some implementations, the modified cells are allogeneic relative to the intended recipient of the modified cells (e.g., modified immune cells).

[0143] In some embodiments, cells are expanded in vitro. In some embodiments, cells are activated prior to transplantation to the intended recipient. In some embodiments, cells are enriched with respect to the presence or absence of certain biomarkers (e.g., CD3).

[0144] In some embodiments, the present invention provides a population of modified cells (e.g., modified immune cells) as described above. Compared to a control population of corresponding cells (e.g., corresponding immune cells), the population of modified cells (e.g., modified immune cells) as described above has one or more of the following characteristics: 1) reduced autoinhibition, 2) improved effector cell function, and 3) improved cell activation and / or expansion.

[0145] In one implementation, the modified cells provided herein exhibit low immunogenicity in an allogeneic environment while maintaining uninhibited effector functions.

[0146] i) Lack of endogenous inhibitory immune checkpoint molecules

[0147] In some implementations, the modified cells lack endogenous inhibitory immune checkpoint molecules.

[0148] In some embodiments, the modified cells lack endogenous suppressive immune checkpoint molecules relative to their unmodified counterparts. As used herein, the term "counterpart cell" means a cell of the same cell type as the modified cell. The counterpart cell may be obtained from the same individual as the modified cell or from a different individual. As used herein, the term "unmodified" means that the counterpart cell does not have the same modifications as the modified cell, or alternatively, does not have any modifications at all. In some embodiments, the unmodified counterpart cell may be a natural or native cell of the same type as the modified cell. In some embodiments, the unmodified counterpart cell (e.g., a counterimmune cell) does not lack endogenous suppressive immune checkpoint molecules. In some embodiments, the unmodified counterpart cell is a natural immune cell.

[0149] As used herein, the term "suppressive immune checkpoint molecule" refers to an inhibitory regulator of the immune system that has a suppressive effect on the host's immune system. Activation of immune checkpoint molecules can suppress immune responses, such as cytokine secretion, NK cell activation, T cell proliferation, and antibody production. Suppressive immune checkpoint molecules mediate immune escape in certain cancer cells that express inhibitory immune checkpoint ligands of these molecules.

[0150] In some implementations, the inhibitory immune checkpoint molecules are endogenous to unmodified cells. As used herein with respect to proteins, "endogenous" means that the protein is naturally or spontaneously expressed in the cell.

[0151] Exemplary inhibitory immune checkpoint molecules include, but are not limited to, PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), CTLA-4 (CD152), IDO1, IDO2, TDO, KIR, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329).

[0152] “PD-1” is an abbreviation for programmed death 1 (PD-1) receptor. An exemplary sequence of human PD-1 includes the human PD-1 protein and the human PD-1 gene. For a more detailed description, see, for example, Philips et al. (January 1, 2015). “Therapeutic Uses of Anti-PD-1 and Anti-PD-L1 Antibodies.” *International Journal of Immunology* 27(1): 39-46.

[0153] "TIM3" is an abbreviation for T-cell immunoglobulin domain and mucin domain 3. For a more detailed description, please refer to, for example, the literature by Zhu et al. (August 11, 2010). "TIM-3 and its Regulatory Role in Immune Response," *Current Issues in Microbiology and Immunology*, Vol. 350, pp. 1-15.

[0154] "TIGIT" is an abbreviation for T-cell immune receptor with Ig and ITIM domains. For a more detailed description, please refer to, for example, the literature of Yu et al. (January 2009). "The surface protein TIGIT inhibits T-cell activation by promoting the generation of mature immune regulatory dendritic cells." Nature Immunology 10(1): 48-57. doi: 10.1038 / ni.1674.

[0155] “LAG3” is an abbreviation for Lymphocyte Activation Gene-3. For a more detailed description, see, for example, Huang et al. (October 1, 2004). “The Role of LAG-3 in Regulatory T Cells.” *Immunology* 21(4): 503–13; Grosso et al. (November 1, 2007). “LAG-3 Regulates the Accumulation and Effector Function of CD8+ T Cells in Mouse Self-Tolerance and Tumor Tolerance Systems.” *Journal of Clinical Research* 117(11): 3383–92.

[0156] “A2AR” is an abbreviation for adenosine A2A receptor. For a more detailed description, please refer to the paper by Leone et al. (April 8, 2015). “A2aR antagonists: next-generation checkpoint blockade for cancer immunotherapy,” Journal of Computational Structural Biotechnology 13: 265–72.

[0157] “BTLA” is an abbreviation for B and T lymphocyte attenuation factor, which is used interchangeably with the term “CD272”. For a more detailed description, see Derré et al. (January 1, 2010). “BTLA mediates the inhibition of human tumor-specific CD8+ T cells, which can be partially reversed by vaccination.” Journal of Clinical Research 120 (1): 157–67.

[0158] “CTLA-4” is an abbreviation for cytotoxic T-lymphocyte-associated protein 4, also known as CD152. For a more detailed description, please refer to the literature by Kolar et al. (January 1, 2009). “CTLA-4 (CD152) controls the homeostasis and inhibitory capacity of regulatory T cells in mice.” Arthritis & Rheumatology 60 (1): 123–32.

[0159] “IDO1” and “IDO2” are abbreviations for indoleamine 2,3-dioxygenase 1 and indoleamine 2,3-dioxygenase 2, respectively. For a more detailed description, please refer to the literature of Prendergast et al. (July 1, 2014). “Indoleamine 2,3-dioxygenase pathway for pathogenic inflammation and immune escape in cancer.” Cancer Immunology & Immunotherapy 63 (7): 721–35.

[0160] "TDO" is an abbreviation for tryptophan 2,3-dioxygenase.

[0161] "KIR" is an abbreviation for killer cell immunoglobulin-like receptor, which is the receptor for MHC class I molecules on natural killer cells.

[0162] "NOX2" is an abbreviation for nicotinamide adenine dinucleotide phosphate NADPH oxidase isoform 2. For a more detailed description, please refer to the literature by Martner et al. (October 1, 2018). "The role of NOX2 in autoimmunity, tumor growth and metastasis." Journal of Pathology 247 (2): 151–154.

[0163] "VISTA" is an abbreviation for V-domain Ig repressor of T cell activation. For a more detailed description, please refer to the literature by Wang et al. (March 14, 2011): "VISTA, a novel mouse Ig superfamily ligand that negatively regulates T cell responses." *Journal of Experimental Medicine* 208(3): 577–92 and the literature by Lines et al. (April 1, 2014): "VISTA is an immune checkpoint molecule of human T cells." *Cancer Research* 74(7): 1924–32.

[0164] PVR (CD155) is an abbreviation for poliovirus receptor and a member of the cohesin-like protein family. PVR is a member of the immunoglobulin superfamily, characterized by the presence of immunoglobulin domain V, C1-like domain, and C2 domain in its extracellular region.

[0165] "SIGLEC7" is an abbreviation for sialic acid-binding immunoglobulin type 7, also known as CD328. "SIGLEC9" is an abbreviation for sialic acid-binding immunoglobulin type 9, also known as CD329. For a more detailed description, see Varki et al. (2007). "Siglecs and their role in the immune system." Nature Reviews Immunology 7 (4): 255-266.

[0166] In some implementations, the inhibitory immune checkpoint molecules are selected from the group consisting of: PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), CTLA-4 (CD152), IDO1, IDO2, TDO, KIR, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329).

[0167] In some implementations, the cells are T cells, and the endogenous suppressive immune checkpoint molecules are selected from the group consisting of: PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), CTLA-4 (CD152), IDO1, IDO2, TDO, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329).

[0168] In some implementations, the cells are NK cells, and the endogenous suppressive immune checkpoint molecules are selected from the group consisting of: PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), IDO1, IDO2, KIR, TDO, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329).

[0169] In some implementations, the cells are dendritic cells (DCs), and the endogenous suppressive immune checkpoint molecules are selected from the group consisting of A2AR, CD47, IDO1, IDO2, and TDO.

[0170] In some implementations, the cells are macrophages, and the endogenous suppressive immune checkpoint molecules are selected from the group consisting of A2AR, CD47, IDO1, IDO2, and CD24.

[0171] As used herein, the term "lack" means the absence, inactivity, or level of endogenous suppressor immune checkpoint molecules in modified cells, or a level lower than normal relative to the activity or level in unmodified corresponding cells. For example, the gene for an endogenous suppressor immune checkpoint molecule in modified cells can be deleted or mutated to produce a loss-of-function phenotype. As another example, endogenous suppressor immune checkpoint molecules can be expressed in modified cells at reduced levels or in a form with reduced activity. The levels and / or activity of endogenous suppressor immune checkpoint molecules can be measured using various techniques known in the art, such as immunohistochemistry, Western blotting, immunofluorescence microscopy, and quantitative flow cytometry.

[0172] Any suitable method can be used to modify cells to lack endogenous suppressor immune checkpoint molecules, such as through gene editing, by interfering with the expression of endogenous suppressor immune checkpoint molecules, or by promoting the degradation of endogenous suppressor immune checkpoint molecules or their encoding mRNA. In some embodiments, the modified cells (e.g., modified immune cells) include a first mutation in the coding or regulatory sequence of a suppressor immune checkpoint molecule in a genomic region, wherein the mutation reduces the expression or activity of the suppressor immune checkpoint molecule. In some embodiments, the modified cells (e.g., modified immune cells) include a first interfering oligonucleotide targeting the mRNA of the suppressor immune checkpoint molecule, wherein the interfering oligonucleotide reduces the expression of the suppressor immune checkpoint molecule. In some embodiments, the modified cells (e.g., modified immune cells) include an introduced protein, peptide, or small molecule that inhibits the expression and / or activity of the suppressor immune checkpoint molecule.

[0173] In some implementations, the inhibitory immune checkpoint molecule is PD-1. In some implementations, the modified cells lack endogenous PD-1.

[0174] PD-1 levels can be measured using methods known in the art, such as immunohistochemistry, Western blotting, immunofluorescence microscopy, and quantitative flow cytometry.

[0175] PD-1 activity (i.e., PD-1-mediated immunosuppression) can be determined by measuring the expression levels of activated forms of PD-1, such as phosphorylated PD-1, like PD-1 with phosphorylated Y248, which is essential for the delivery of PD-1 inhibitory function (Kankana et al., “PD-1-Y248 phosphorylation is a marker of PD-1-mediated inhibitory function in human T cells,” Scientific Reports (2019) 9: 17252). PD-1 activity can also be measured by measuring the expression levels of active forms of PD-1 downstream of proteins that contribute to PD-1 inhibitory function in immune cells, such as phosphorylated phosphoproteins associated with microdomain 1 (PAG), which is rich in glycosphingolipids (Marianne et al., “Transmembrane adaptor protein PAG is a mediator of PD-1 inhibitory signaling in human T cells,” Communications Biology (2021) 4: 672).

[0176] ii) Ligands modified to express inhibitory immune checkpoint molecules

[0177] In some implementations, the modified cells provided herein are engineered to express ligands of inhibitory immune checkpoint molecules.

[0178] In some implementations, the modified cells provided herein are engineered to express ligands of endogenous inhibitory immune checkpoint molecules that are lacking in the present invention.

[0179] As used herein, the term "ligand" in relation to inhibitory immune checkpoint molecules refers to a molecule capable of binding to and activating inhibitory immune checkpoint molecules to exert an immunosuppressive effect. In some embodiments, the ligand includes a transmembrane protein, which includes extracellular, transmembrane, and intracellular domains.

[0180] The ligand can be a homologous ligand of an inhibitory immune checkpoint molecule, a variant of a homologous ligand, or any agonist of an inhibitory immune checkpoint molecule. As used herein, the term "homologous ligand" refers to an endogenous or natural ligand of a protein.

[0181] Cells can be engineered using any suitable method to express ligands for inhibitory immune checkpoint molecules. In some embodiments, the modified cells include a first exogenous polynucleotide comprising the coding sequence of a ligand. In some embodiments, the first exogenous polynucleotide further includes the coding sequence of a signal peptide operatively linked to the coding sequence of the ligand. In some embodiments, the first exogenous polynucleotide further includes a promoter operatively linked to the coding sequence of the ligand. In some embodiments, the first exogenous polynucleotide is mRNA or an expression vector, optionally a viral expression vector.

[0182] In some implementations, the modified cells (e.g., modified immune cells) have introduced expression of the ligand. As used herein with respect to the ligand, "introduced expression" refers to the expression of the ligand by providing the ligand's nucleic acid (e.g., its coding sequence) into the cell. The nucleic acid may be integrated into the cell's genome or may be transiently provided to the cell.

[0183] In some implementations, the ligands are selected from the group consisting of: PD-L1, PD-L2, HMGB1, Ceacam-1, phosphatidylserine (PS), LSECtin, α-synuclein, FGL1, adenosine, HVEM (herpesvirus invasion mediator), CD28, B7-H3 (CD276), B7-H4 (VTCN1), PVR (CD155), HLA class I, sialic acid glycoprotein, CD112, CD113, galactagogue 9, CD24, and CD47. These ligands are known in the art, and their encoding genes can be obtained from public databases using their respective gene IDs, such as the gene databases of the National Center for Biotechnology Information (NCBI) and the National Library of Medicine, for example: PD-L1 (gene ID: 29126), PD-L2 (gene ID: 80380), HMGB1 (gene ID: 3146), Ceacam-1 (gene ID: 634), LSECtin (gene ID: 339390), α-synuclein (gene ID: 6622), FGL1 (gene ID: 2267), HVEM (herpesvirus invasion mediator; gene ID: 8764), CD28 (gene ID: 940), B7-H3 (CD276; gene ID: 80381), B7-H4 (VTCN1; gene ID: 79679), PVR (CD155; gene ID: 5817), HLA Class I, CD112 (gene ID: 5819), CD113 (gene ID: 25945), galactagogue 9 (gene ID: 16859), CD24 (gene ID: 100133941) and CD47 (gene ID: 961).

[0184] a) The expressed ligand pairs with the lacking endogenous inhibitory immune checkpoint molecule.

[0185] In some embodiments, the modified cells provided herein lack an endogenous inhibitory immune checkpoint molecule and are simultaneously engineered to express a ligand of that endogenous inhibitory immune checkpoint molecule. In other words, the lacking inhibitory immune checkpoint molecule pairs with the expressed ligand.

[0186] In some implementations, the missing endogenous inhibitory immune checkpoint molecule is PD-1, and the expressed ligands include at least one of PD-L1 or PD-L2, or their functional equivalents or variants.

[0187] In some embodiments, the lacking endogenous inhibitory immune checkpoint molecule is TIM3, and the expressed ligand includes at least one of the following: galactagogue 9, HMGB1, Ceacam-1, or phosphatidylserine (PS), or a functional equivalent thereof capable of binding TIM3.

[0188] In some embodiments, the lacking endogenous inhibitory immune checkpoint molecule is LAG-3, and the expressed ligand includes at least one of the following: galactagogue-3, LSECtin, α-synuclein, or FGL1 or a functional equivalent thereof capable of binding to LAG-3.

[0189] In some embodiments, the lacking endogenous inhibitory immune checkpoint molecule is TIGIT, and the expressed ligand includes at least one of the following: CD155, CD113, or CD112 or a functional equivalent thereof capable of binding TIGIT.

[0190] In some implementations, the missing endogenous inhibitory immune checkpoint molecule is the adenosine A2A receptor (A2AR), and the ligand includes adenosine.

[0191] In some implementations, the missing endogenous inhibitory immune checkpoint molecule is BTLA, and the expressed ligands include herpesvirus invasion mediators (HVEMs) or their functional equivalents that can bind to BTLA.

[0192] In some implementations, the missing endogenous inhibitory immune checkpoint molecule is CTLA-4, and the expressed ligands include CD28 or its functional equivalents that can bind to CTLA4.

[0193] In some implementations, the missing endogenous inhibitory immune checkpoint molecule is a killer cell immunoglobulin-like receptor (KIR), and the expressed ligands include HLA class I or its functional equivalents that can bind to KIR.

[0194] In some implementations, the missing endogenous inhibitory immune checkpoint molecule is VISTA (a T-cell activation V-domain Ig inhibitor), and the expressed ligand includes at least one of the following: PD-L1 or PD-L2 or a functional equivalent thereof capable of binding VISTA.

[0195] In some implementations, the missing endogenous inhibitory immune checkpoint molecule is sialic acid-binding immunoglobulin type lectin 7 (SIGLEC-7 or CD328), and the ligand is sialic acid glycoprotein or its functional equivalent that can bind to SIGLEC-7.

[0196] In some implementations, the missing endogenous inhibitory immune checkpoint molecule is SIGLEC-9 (CD329), and the ligand is sialic acid glycoprotein or its functional equivalent that can bind to SIGLEC-9.

[0197] In some embodiments, the modified cell includes in its genome: a first mutation in the coding or regulatory sequence of an inhibitory immune checkpoint molecule, and / or an exogenous first polynucleotide including the coding sequence of a ligand of an inhibitory immune checkpoint molecule, wherein the first mutation reduces the expression or activity of the inhibitory immune checkpoint molecule, and the exogenous first polynucleotide leads to the introduction and expression of the ligand of the inhibitory immune checkpoint molecule.

[0198] In some implementations, the cells also lack one or more additional endogenous inhibitory immune checkpoint molecules.

[0199] In some implementations, when the inhibitory immune checkpoint molecule is PD-1, the ligand can be PD-L1 or PD-L2 or their functional equivalents. Binding of PD-L1 or PD-L2 or their functional equivalents to PD-1 recruits phosphatases 1 and 2 (SHP-1 / SHP-2) containing the Src homology 2 domain to the tyrosine-based switch motif (ITSM) of PD-1, leading to dephosphorylation of signal transduction kinases such as CD3ζ, PKCθ, and ZAP70, and resulting in an overall inhibition of T cell proliferation (Yokosuka et al., “Programmed cell death 1 forms negative co-stimulatory microclusters that directly inhibit T cell receptor signaling by recruiting phosphatase SHP2.” *Journal of Experimental Medicine* 2012;209:1201–17).

[0200] The ligands described above can be screened by generating a mutant library of the ligands and testing the binding affinity of the mutants to their inhibitory immune checkpoint molecules and the innate immunosuppressive signaling of the mutants. Mutants that retain high binding affinity to their inhibitory immune checkpoint molecules but exhibit reduced innate immunosuppressive signaling will be selected as ligands for the modified cells (e.g., immune cells) of the present invention. Innate immunosuppressive signaling can be measured by various techniques known in the art, such as FACS, PCR, Western blotting, or by detecting the expression of intracellular signaling proteins or their modified forms.

[0201] In some embodiments, the ligands include secretory agonists or cell surface agonists capable of activating inhibitory immune checkpoint molecules. For example, PD-1 agonists are capable of binding to PD-1 to induce PD-1-mediated inhibitory signaling and can therefore be engineered to release from modified cells (e.g., modified immune cells) or to be expressed on modified cell surfaces. Exemplary PD-1 agonists include, but are not limited to, PD-1-binding proteins or miniproteins that can be computer-designed to interact with PD-1 and inhibit T cell activation (Cassie et al., “Computational Design of PD-1 Synthetic Agonists.” Proceedings of the National Academy of Sciences (PNAS) July 20, 2021, 118 (29) e2102164118). These PD-1 agonists can be engineered onto the surface of modified cells (e.g., modified immune cells) using protein engineering techniques, for example, by fusing the PD-1 agonist to transmembrane domains and other elements required for extracellular expression of the PD-1 agonist, while simultaneously anchoring it to the surface.

[0202] b) Variants of ligands of inhibitory immune checkpoint molecules

[0203] In some implementations, the ligands provided herein are variants of homologous ligands of endogenous inhibitory immune checkpoint molecules.

[0204] As used herein, the term "variant" of a ligand refers to a protein that is different from, but homologous to, its homologous or natural ligand and substantially retains the ability of the homologous or natural ligand to bind to its binding partner (e.g., an immune checkpoint molecule). A variant may differ from the parent peptide in one or more amino acid residues. For example, a variant may have a conserved substitution, deletion, or insertion of one or more amino acid residues of the parent protein. In some embodiments, a variant has at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with the homologous ligand, but substantially retains the homologous ligand's ability to bind to its binding partner (e.g., an immune checkpoint molecule). A "variant" of a natural or natural ligand (e.g., natural PD-L1) may be a naturally occurring or different form of the natural ligand, including, but not limited to, fragments, mutants, fusions, or any combination thereof. Variant ligands do not contain the full length of the natural ligand. However, variants may contain fragments or portions of the natural ligand, or fusion proteins including such fragments or portions. Variant ligands may also include mutated forms of full-length natural ligands or mutated forms of fragments of natural ligands, or fusion proteins including such mutated forms.

[0205] Compared to homologous ligands, variant ligands have a reduced ability to induce immunosuppressive signaling.

[0206] It has been found that at least some homologous ligands of inhibitory immune checkpoint molecules possess signal transduction domains capable of mediating immunosuppressive signal transduction. Following interaction between a homologous ligand and its corresponding inhibitory immune checkpoint molecule, the homologous ligand itself can also be activated by mediating immunosuppressive signal transduction in modified cells expressing the homologous ligand. Without being bound by any theory, we hypothesize that mutations or deletions of the immunosuppressive signaling domain of the corresponding ligand may reduce “reverse signal transduction” in modified cells (e.g., modified immune cells) expressing that ligand. This may contribute to reducing inhibitory signal transduction in modified cells (e.g., modified immune cells) when the ligand binds to its corresponding inhibitory immune checkpoint molecule (e.g., those present on receptor immune cells), and thus increase the effector function of modified cells (e.g., modified immune cells) that would otherwise impair the effector function of modified cells (e.g., modified immune cells).

[0207] In some embodiments, the variant ligand has reduced immunosuppressive signaling relative to the homologous ligand. In some embodiments, the immunosuppressive signaling of the variant is reduced such that it is substantially below (e.g., at least 20%, at least 40%, at least 60%, or at least 80%) the normal or baseline level of immunosuppressive signaling of the homologous ligand.

[0208] In some implementations, the modified cells provided herein are engineered to express ligands of inhibitory immune checkpoint molecules, wherein the ligands are variants of the homologous ligands and lack the functional immunosuppressive signaling domain of the homologous ligands.

[0209] In some embodiments, the variant includes at least one mutation that reduces the ability to induce immunosuppressive signaling. In some embodiments, the at least one mutation includes substitution, deletion, insertion, or any combination thereof.

[0210] In some embodiments, the at least one mutation includes the deletion of at least one amino acid residue, such as at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24. The deletion of at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, or at least 50 or more amino acid residues.

[0211] In some embodiments, the homologous ligand includes a transmembrane protein, which includes an extracellular domain, a transmembrane domain, and an intracellular domain. In some embodiments, the at least one mutation is in the intracellular domain of the homologous ligand, or in the transmembrane domain of the homologous ligand, or in the extracellular domain of the homologous ligand, or any combination thereof.

[0212] In some implementations, the immunosuppressive signaling domain is located in the intracellular or transmembrane domain of the homologous ligand. For example, some ligands of inhibitory immune checkpoint molecules are transmembrane proteins (such as PD-L1) and have been found to contain cytoplasmic domains that can mediate immunosuppressive signaling.

[0213] In some embodiments, the variant is a variant of a homologous ligand of an immunosuppressive immune checkpoint molecule, wherein the homologous ligand is selected from the group consisting of: PD-L1, PD-L2, B7-H3 (CD276), B7-H4 (VTCN1), PVR (CD155), HLA class I, sialic acid glycoprotein, CD112, CD113, galactagogue 9, CD24, and CD47, wherein the variant has a reduced ability to induce immunosuppressive signaling relative to the homologous ligand, and / or lacks the functional immunosuppressive signaling domain of its corresponding homologous ligand.

[0214] The above-described method can be used to modify cells to express variant ligands of inhibitory immune checkpoint molecules by introducing a first exogenous polynucleotide comprising a coding sequence of a ligand into the modified cells. In some embodiments, the first exogenous polynucleotide comprises a coding sequence of a variant ligand. In some embodiments, the first exogenous polynucleotide also includes a coding sequence of a signal peptide operatively linked to the coding sequence of the variant ligand. In some embodiments, the first exogenous polynucleotide also includes a promoter operatively linked to the coding sequence of the variant ligand. In some embodiments, the first exogenous polynucleotide is mRNA or an expression vector, optionally a viral expression vector. In some embodiments, the modified cells comprise the first exogenous polynucleotide, which comprises a coding sequence of a variant ligand.

[0215] c) PD-L1 variant

[0216] In some implementations, the variant ligands of the inhibitory immune checkpoint molecules provided herein are PD-L1 variants or PD-L2 variants.

[0217] PD-L1 is a type I transmembrane protein of approximately 40 kDa, composed of IgV-like and IgC-like extracellular domains, a hydrophobic transmembrane domain, and a short cytoplasmic tail of 30–31 amino acids. (Kythreotou et al., “PD-L1.” Journal of Clinical Pathology 71, 189–194 (2018); Dong et al., “B7-H1, the third member of the B7 family, co-stimulates T cell proliferation and interleukin-10 secretion.” Nature Medicine 1999;5:1365–9; and Chen et al., “Regulation of PD-L1: A novel role of pro-survival signaling in cancer.” Annals of Oncology 2016;27:409–16). PD-L1 is encoded by the PDCDL1 gene, located at p24.1 on human chromosome 9 (NCBI Gene Database: CD274 molecule [Homo sapiens] gene, 2017, https: / / www.ncbi.nlm.nih.gov / gene (accessed June 29, 2017)). The full-length PD-L1 is encoded by seven exons, corresponding to a 290-amino acid protein, including its signal peptide. Recent studies have found that PD-L1 involvement induces T cell apoptosis through the induction of intracellular signaling, a mechanism similar to the signaling of activated PD-1, termed "reverse signaling" (Brian et al., "PD-L1 binding on T cells promotes self-tolerance and suppression of neighboring macrophages and effector T cells in cancer," *Nature Immunology* | Vol. 21, 442 | April 2020 | 442–454).

[0218] In some implementations, PD-L1 or PD-L2 variants have reduced ability to induce immunosuppressive signaling, but essentially retain the ability to bind PD-1 or the affinity for binding PD-1.

[0219] The binding capacity and / or affinity of PD-L1 or PD-L2 variants can be measured by any suitable assay such as ELISA, Western blotting, flow cytometry, and other binding assays. In some embodiments, binding capacity and / or affinity are measured by flow cytometry. Typically, cells expressing PD-L1 are incubated with a range of PD-1-expressing cells or soluble PD-L1 (e.g., the PD-1 extracellular domain, optionally fused to Fc), followed by incubation with a fluorescently labeled secondary antibody, and then the fluorescence signal intensity is analyzed.

[0220] Immunosuppressive signaling by PD-L1 or PD-L2 variants can be determined by any suitable assay. For example, PD-1 knockout (PD-1- / -) T cells can be engineered to express the PD-L1 or PD-L1 variants provided herein, and the resulting engineered T cells can be incubated with PD-1-expressing cells or soluble PD-1 (e.g., the PD-1 extracellular domain, optionally fused with Fc), followed by detection of T cell activation, proliferation, or differentiation. When engineered T cells express full-length PD-L1, PD-1 involvement inhibits the activation, proliferation, or differentiation of the engineered T cells, while engineered T cells expressing the PD-L1 variants provided herein show a weaker inhibitory effect involving PD-1.

[0221] In some embodiments, the PD-L1 or PD-L2 variants provided herein have no more than 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5% immunosuppressive signaling compared to full-length wild-type PD-L1. In some embodiments, the PD-L1 or PD-L2 variants provided herein have undetectable immunosuppressive signaling.

[0222] In some embodiments, the PD-L1 variant lacks the functional immunosuppressive signaling domain of native PD-L1. In some embodiments, the PD-L2 variant lacks the functional immunosuppressive signaling domain of native PD-L2. In some embodiments, the PD-L1 variant does not contain full-length PD-L1. The PD-L1 variant does not contain the full-length native PD-L1. The PD-L2 variant does not contain the full-length native PD-L2. In some embodiments, the PD-L1 variant comprises truncated native PD-L1 or truncated mutant PD-L1. In some embodiments, the truncated variant comprises C-terminally truncated PD-L1.

[0223] In some embodiments, the PD-L1 variant includes at least one mutation relative to native PD-L1 that reduces the ability to induce immunosuppressive signaling. In some embodiments, the PD-L1 variant includes at least one mutation in an intracellular domain (e.g., SEQ ID NO: 1), a transmembrane domain (e.g., SEQ ID NO: 2), or an extracellular domain (e.g., SEQ ID NO: 3), or any combination thereof. In some embodiments, the PD-L1 variant includes at least one mutation in a domain spanning both the extracellular and intracellular domains (e.g., a domain containing or composed of the amino acid sequence of SEQ ID NO: 5). In other embodiments, the at least one mutation includes a mutation outside one or more domains involved in transducing immunosuppressive signaling, but which results in a conformational change that disrupts immunosuppressive signaling.

[0224] In some embodiments, the PD-L1 variant includes at least a partial deletion of the intracellular domain of PD-L1 (e.g., SEQ ID NO: 1), or at least a partial deletion of the transmembrane domain of PD-L1 (e.g., SEQ ID NO: 2), or at least a partial deletion of the extracellular domain of PD-L1 (e.g., SEQ ID NO: 3), or any combination thereof. In some embodiments, the PD-L1 variant includes at least a partial deletion of a domain spanning both the extracellular and intracellular domains (e.g., a domain comprising or consisting of the amino acid sequence of SEQ ID NO: 5).

[0225] In some embodiments, the PD-L1 variant includes the deletion of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, or at least 31 amino acid residues in the region corresponding to the amino acid sequence of native PD-L1.

[0226] In some embodiments, the modified intracellular domain and / or modified transmembrane domain of PD-L1, in the region corresponding to the amino acid sequence of SEQ ID NO: 2 of native PD-L1, in the region spanning positions 1 to 21 of SEQ ID NO: 2, include the deletion of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 amino acid residues.

[0227] In some embodiments, the PD-L1 variant includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least The deletion of 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50 amino acid residues or at least 51 amino acid residues.

[0228] In some implementations, the PD-L1 variant is a C-terminal truncated variant with a C-terminal deletion.

[0229] In some embodiments, the PD-L1 variant (e.g., a C-terminal truncated variant) comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity with native PD-L1 (e.g., SEQ ID NO: 11), or having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity with an equal-length portion of SEQ ID NO: 11 but substantially retaining the ability to bind PD-1. The PD-L1 variant does not include the amino acid sequence of SEQ ID NO: 11.

[0230] In some embodiments, the PD-L1 variant (e.g., a C-terminal truncated variant) comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity with native PD-L1 (e.g., SEQ ID NO: 7), or having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity with an isolong portion of SEQ ID NO: 7 but substantially retaining the ability to bind PD-1.

[0231] In some embodiments, the PD-L1 variant includes a truncated PD-L1 (e.g., a C-terminal truncated PD-L1). The truncated PD-L1 can be a truncated form of natural PD-L1 or a truncated form of mutant PD-L1. In some embodiments, the truncated PD-L1 has no more than 271, no more than 270, no more than 265, no more than 260, no more than 255, no more than 250, no more than 245, no more than 240, no more than 235, no more than 230, no more than 225, and no more than 220 amino acid residues (e.g., 220 to 272, 220 to 271, 220 to 270, 220 to 269, 2...). 20 to 268, 220 to 267, 220 to 265, 220 to 264, 220 to 263, 220 to 262, 220 to 261, 220 to 260, 220 to 259, 220 to 258, 220 to 257, 220 to 256, 220 to 255, 220 to 254, 220 to 253, 220 to 252, 220 to 251, 220 to 250, 220 to 249, 220 to 248, 220 to 247, 220 to 246, 220 to 245, 220 to 244, 220 to 243, 220 to 242, 220 to 241, 241 to 272, 241 to 271, 241 to 270, 241 to 269, 241 to 268, 241 to 267, 241 to 265, 241 to 264, 241 to 263, 241 to 262, 241 to 261, 241 to 260 The length of amino acid residues 241 to 259, 241 to 258, 241 to 257, 241 to 256, 241 to 255, 241 to 254, 241 to 253, 241 to 252, 241 to 251, 241 to 250, 241 to 249, 241 to 248, 241 to 247, 241 to 246, 241 to 245, 241 to 244, 241 to 243, and 241 to 242.

[0232] In some embodiments, the PD-L1 variant includes the amino acid sequence of SEQ ID NO: 7. In some embodiments, the amino acid sequence of the PD-L1 variant is SEQ ID NO: 7.

[0233] The method described above can be used to modify cells to express the PD-L1 variant by introducing a first exogenous polynucleotide comprising a coding sequence of the PD-L1 variant into the modified cells. In some embodiments, the first exogenous polynucleotide comprises a coding sequence of the PD-L1 variant. In some embodiments, the first exogenous polynucleotide further comprises a coding sequence of a signal peptide operatively linked to the coding sequence of the PD-L1 variant. In some embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO:4. In some embodiments, the first exogenous polynucleotide further comprises a promoter operatively linked to the coding sequence of the PD-L1 variant. In some embodiments, the first exogenous polynucleotide is mRNA or an expression vector, optionally a viral expression vector.

[0234] In some embodiments, the modified cells include a first exogenous polynucleotide, which includes a coding sequence for a PD-L1 variant.

[0235] d) Polynucleotides encoding PD-L1 variants, and cells containing these polynucleotides.

[0236] In another aspect, the present invention also provides a protein comprising a PD-L1 variant having a reduced ability to induce immunosuppressive signaling relative to native PD-L1. In some embodiments, the PD-L1 variant lacks the functional immunosuppressive signaling domain of native PD-L1. In some embodiments, the PD-L1 variant includes at least one mutation that reduces the ability to induce immunosuppressive signaling. Other aspects of the PD-L1 variant are the same as described in the foregoing sections.

[0237] In some embodiments, the protein includes a PD-L1 variant linked to the target peptide. In some embodiments, the target peptide may be expressed on the cell surface or may be secreted. In some embodiments, the target peptide may bind to a target antigen (e.g., a target cell antigen) provided herein. In some embodiments, the target peptide is a chimeric antigen receptor (CAR) or a modified TCR or other cell surface receptor or ligand. Further details regarding the target peptide, CAR, and modified TCR are described below and can be applied to the embodiments described herein.

[0238] In some embodiments, the PD-L1 variant is linked to the target peptide via a linker. In some embodiments, the linker is cleavable. In some embodiments, the cleavable linker is a self-cleaving peptide, such as a 2A peptide, such as P2A (e.g., SEQ ID NO: 16), T2A, or F2A. In some embodiments, the nucleotide sequence encoding P2A has the nucleotide sequence of SEQ ID NO: 15.

[0239] In some embodiments, the protein also includes a signal peptide. In some embodiments, the PD-L1 variant also includes a signal peptide.

[0240] In some embodiments, the protein includes a PD-L1 variant linked to a linker (optionally a cleavable linker). In some embodiments, the protein includes a PD-L1 variant linked to P2A. In some embodiments, the protein includes the amino acid sequence of SEQ ID NO: 17.

[0241] In some embodiments, the present invention also provides a polynucleotide encoding the protein provided herein. In some embodiments, the polynucleotide has a nucleotide sequence including SEQ ID NO: 13, 14 or 18 or a homologous sequence having at least 50% sequence identity therewith, optionally encoding the same protein or encoding a protein variant having at least 90% or 95% or 99% sequence identity.

[0242] In some embodiments, the present invention also provides expression vectors comprising the polynucleotides provided herein.

[0243] In some embodiments, the present invention also provides recombinant cells comprising the expression vector provided herein. In some embodiments, the recombinant cells are animal cells or human cells. In some embodiments, the recombinant cells are immune cells. In some embodiments, the recombinant cells are stem cells or cells differentiated from stem cells. In some embodiments, the cells are suitable for transplantation. In some embodiments, the recombinant cells are allogeneic relative to the intended recipient of the recombinant cells.

[0244] On the other hand, the present invention provides recombinant cells or populations thereof, which are modified to express PD-L1 variants or PD-L2 variants.

[0245] On the other hand, the present invention also provides a population of recombinant cells generated in vitro by the method described above. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the cell population express a detectable level of the PD-L1 variant provided herein.

[0246] On the other hand, the present invention also provides a method for generating recombinant cells with increased immune tolerance in an allogeneic host, comprising introducing an expression vector provided herein into the cell under conditions suitable for expressing the polynucleotides provided herein, thereby increasing the immune tolerance of the recombinant cells. As used herein, the term "immune tolerance" refers to the ability to tolerate or reduce immune rejection of the recombinant cells by the immune system of the allogeneic host. In some embodiments, the recombinant cells further lack antigen-presenting proteins, such as MHC class I proteins (HLA class I) and / or MHC class II proteins (HLA class II).

[0247] iii) Expression of other target peptides

[0248] In some embodiments, the modified cells (e.g., modified immune cells) or populations thereof provided herein also express another target polypeptide. In some embodiments, the modified cells (e.g., modified immune cells) or populations thereof provided herein have been modified or further modified to introduce a second exogenous polynucleotide comprising a coding sequence of the target polypeptide, and optionally the modified cells express the target polypeptide.

[0249] In some embodiments, the target peptide may be expressed on the cell surface or may be secreted. In some embodiments, the target peptide may bind to a target antigen, such as a target cell antigen.

[0250] Target cell antigens can be cell surface markers on target cells that are associated with a target disease or condition. In some embodiments, target cell antigens include tumor antigens, inflammation-associated antigens, or infectious agent-associated antigens (e.g., viral antigens). In some embodiments, target cell antigens are associated with diseases selected from the group consisting of cancer, autoimmune diseases, or infectious diseases.

[0251] Examples of tumor antigens include, but are not limited to, BCMA, CD7, CD10, CD19, CD20, CD22, CD24, CD30, CD33, CD34, CD38, CD44, CD79a, CD79b, CD123, CD138, CD179b, CEA, CLEC12A, Claudin18.2, CS-1, DLL3, EGFR, EGFRvIII, EPCAM, FLT-3, FOLR1, FOLR3, GD2, gpA33, GPC3, HER2, HM1.24, LGR5, mesothelin, MSLN, MCSP, MICA / B, PSMA, PAMA, P-cadherin, and ROR1.

[0252] Cells can be modified using any suitable method to further express the target peptide. In some embodiments, the modified cells include a second exogenous polynucleotide comprising a coding sequence of another target peptide. In some embodiments, the second exogenous polynucleotide also includes a coding sequence of a signal peptide operatively linked to a coding sequence of another target peptide. In some embodiments, the second exogenous polynucleotide also includes a promoter operatively linked to a coding sequence of another target peptide. In some embodiments, the second exogenous polynucleotide is mRNA or an expression vector, optionally a viral expression vector.

[0253] In some embodiments, the other target peptide is co-expressed with a ligand of an endogenous inhibitory immune checkpoint molecule. In some embodiments, the other target peptide is expressed as a fusion protein with a ligand or a variant ligand. In some embodiments, the other target peptide is optionally linked to a ligand (or a variant of a homologous ligand) of an endogenous inhibitory immune checkpoint molecule via a linker (e.g., a cleavable linker).

[0254] In some implementations, the cleavable linker is a self-cleaving peptide, such as a 2A peptide. 2A peptides are viral oligopeptides of 18 to 22 amino acid residues in length that mediate polypeptide cleavage during translation in eukaryotic cells. Different viral 2A peptides are typically named after the viruses from which they originate; for example, F2A is from foot-and-mouth disease virus, E2A from equine rhinitis A virus, P2A from teschovirus-1 2A, and T2A from those from the *Thosea asigna* virus (see Liu, Z et al, *Scientific Reports*, volume 7, Article number: 2193 (2017) for details). All different 2A peptides possess a highly conserved C-terminus sequence GDVEXNPGP (SEQ ID NO: 6, where X can be any amino acid residue), which is essential for steric hindrance and ribosome jumping. 2A peptides can be used to induce high levels of downstream protein expression for multi-gene co-expression, and their small size reduces the risk of interfering with the function of co-expressed genes. The 2A peptide has also been successfully used for polycistronic and bicistronic multi-gene expression. In some embodiments, the cleavable linker includes P2A (e.g., SEQ ID NO: 16), F2A (e.g., SEQ ID NO: 9, GSGVKQTLNFDLLKLAGDVESNPGP), T2A (e.g., SEQ ID NO: 71, GSGEGRGGSLLTCGDVEENPGP), and E2A (e.g., SEQ ID NO: 72, GSGQCTNYALLKLAGDVESNPGP). In some embodiments, the nucleotide sequence encoding P2A has the nucleotide sequence of SEQ ID NO: 15.

[0255] In such embodiments, the second exogenous polynucleotide and the first exogenous polynucleotide are contained in a combined polynucleotide encoding a fusion protein comprising a target polypeptide and a ligand (e.g., a variant of a homologous ligand) of an endogenous inhibitory immune checkpoint molecule. The combined polynucleotide may further comprise a signal peptide encoding a sequence operatively linked to the coding sequence of the fusion protein. In some embodiments, the combined polynucleotide may further comprise a promoter operatively linked to the coding sequence of the fusion protein.

[0256] In some implementations, the target peptide is a chimeric antigen receptor (CAR) or a modified TCR or other cell surface receptor or ligand.

[0257] In some implementations, the CAR or modified TCR is able to bind to target cell antigens, such as target cell surface antigens as described above.

[0258] In some embodiments, the modified cells are modified T cells, and optionally the modified T cells further lack endogenous T cell receptors. Details will be described in more detail below.

[0259] a) Chimeric antigen receptor (CAR)

[0260] Chimeric antigen receptors (CARs) are modified chimeric receptors that combine an antigen-binding domain with one or more signaling domains for immune cell activation. Upon binding to their target antigen, CARs can mediate antigen-specific cellular immune activity in modified immune cells (e.g., T cells and NK cells), enabling these CAR-expressing immune cells to eliminate cells expressing the target antigen (e.g., tumor cells). CAR-mediated cellular immune activity may also include the proliferation of CAR-expressing immune cells, the release of cytotoxic factors such as perforin, granzymes, and granzymes, and the initiation of cell lysis and / or apoptosis of target cells.

[0261] In some embodiments, the CAR includes an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the intracellular signaling domain includes a TCR signaling domain.

[0262] In some embodiments, the CAR also includes a co-stimulatory signal transduction region. The co-stimulatory signal transduction region and the intracellular signal transduction domain may be connected to each other randomly or in a specified order, optionally connected by short peptide linkers (e.g., glycine-serine duplex linkers) of suitable length, such as 2 to 10 amino acids.

[0263] In some embodiments, the antigen-binding domain of the CAR includes one or more antigen-binding fragments derived from an antibody against a target antigen. In some embodiments, it is advantageous for the antigen-binding domain to be derived from the same species as the target to which the CAR will ultimately be administered. For example, for use in humans, it may be advantageous for the antigen-binding domain of the CAR to be derived from a human antibody or a humanized antibody. In some embodiments, the antigen-binding domain includes a single-chain variable fragment (scFv). In some embodiments, the antigen-binding domain may be present in a variety of other forms, including, for example, Fv, Fab, and (Fab')2, as well as bifunctional (i.e., bispecific) hybrid antibody fragments (e.g., Lanzavecchia et al., *European Journal of Immunology* 17, 105 (1987)). In some embodiments, the antigen-binding domain includes Fab or scFv.

[0264] In some embodiments, the CAR includes a transmembrane domain fused to the extracellular antigen-binding domain of the CAR. In one embodiment, the transmembrane domain may be selected such that it is naturally associated with one of the domains in the CAR. In some cases, the transmembrane domain may be selected or modified to avoid binding to the transmembrane domains of other members of the T-cell receptor complex.

[0265] The transmembrane domain of the CAR provided herein may be derived from the transmembrane domain of any natural membrane-binding protein or transmembrane protein, such as the α, β, or ζ chain of the T cell receptor, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and CD154. In some embodiments, the transmembrane domain of the CAR may also use various human hinges, such as human Ig (immunoglobulin) hinges. In some embodiments, the CAR further includes an antibody hinge region. For example, the hinge region may include the amino acid sequence of SEQ ID NO: 25. In some embodiments, the CAR further includes a CD8α transmembrane domain (TM), which optionally includes the amino acid sequence of SEQ ID NO: 26.

[0266] Alternatively, the transmembrane domain of the CAR provided herein can be synthetic, for example, comprising primarily hydrophobic residues such as leucine and valine. In one embodiment, the ends of the synthetic transmembrane domain comprise a phenylalanine-tryptophan-valine triplet. Optionally, short oligo or polypeptide linkers of 2 to 10 amino acids in length can form a connection between the transmembrane domain of the CAR and the intracellular signaling domain. Glycine-serine duplexes provide particularly suitable linkers.

[0267] The intracellular signal transduction domain of a CAR can activate CAR-expressing immune cells to perform at least one of the normal effector functions of immune cells, such as cytolytic activity or co-operational activity, including cytokine secretion. The intracellular signal transduction domain can be the full length of the native intracellular signal transduction domain or a fragment thereof sufficient to transduce effector signals.

[0268] Exemplary intracellular signaling domains that can be used in the CARs provided herein include: cytoplasmic sequences of T cell receptors (TCRs) and common receptors that act together to initiate signal transduction upon antigen receptor binding, as well as any derivatives or variants of these sequences and any synthetic sequences having the same functional capabilities.

[0269] In some embodiments, the intracellular signaling domain includes a TCR signaling domain. The stimulatory TCR signaling domain may contain a signaling motif, referred to as an immune receptor tyrosine-based activation motif or ITAM. Examples of ITAM-containing TCR signaling domains used in the CARs provided herein include signaling domains derived from TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In some embodiments, the TCR signaling domain includes a cytoplasmic signaling sequence derived from CD3ζ. In some embodiments, the CAR also includes a CD3ζ signaling domain containing the amino acid sequence SEQ ID NO: 28.

[0270] In some embodiments, the CAR provided herein further includes a co-stimulatory signaling region. The co-stimulatory signaling region acts in an antigen-independent manner to mediate CAR signaling or activation and may be derived from co-stimulatory molecules required for an effective lymphocyte response to an antigen. Exemplary co-stimulatory molecules include CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83. In some embodiments, the CAR further includes a 4-1BB co-stimulatory signaling region comprising the amino acid sequence of SEQ ID NO: 27.

[0271] Examples of CARs include, for example, single-chain variable region fragments (scFvs) derived from monoclonal antibodies fused to the transmembrane and intracellular domains of CD3-ζ. Such CARs result in the transmission of a ζ signal in response to the specific binding of the scFv to its target. Methods for preparing CARs are publicly available (see, for example, Grupp et al., *The New England Journal of Medicine* 368:1509-1518, 2013; Park et al., *Trends in Biotechnology* 29:550-557, 2011; Haso et al., *Hematology* 121, 1165-1174 (2013); Han et al., *Journal of Hematology & Oncology* 6:47, 2013; WO2012 / 079000; U.S. Patent Publication 2012 / 0213783; and WO2013 / 059593, all of which are incorporated herein by reference). For detailed information on CAR, please refer to relevant literature, such as: Cheng et al., “Modifying CAR-T cells”, Biomarker Research (2017) 5:22; Yang et al., “Challenges and opportunities of allogeneic donor CAR-T cells”, Current Status of Hematology, November 2015; 22(6): 509–515.

[0272] In some embodiments, the CAR includes an anti-CD19 scFv. The anti-CD19 scFv is derived from the CD19 antibody FMC63, which includes a light chain variable region comprising the amino acid sequence of SEQ ID NO: 22 and a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 24, optionally linked by a linker (e.g., comprising the amino acid sequence of SEQ ID NO: 23).

[0273] b) Modified T-cell receptor (TCR)

[0274] In some embodiments, the modified TCR includes a modified antigen-binding domain. In some embodiments, the modified TCR may have a higher affinity for target cell surface antigens than the wild-type TCR. In other embodiments, the TCR may include a modified chain, such as a modified α or β chain. Such modifications may include, but are not limited to, N-deglycosylation, altered domains (such as modified variable regions to target specific antigens or increase affinity), the addition of one or more disulfide bonds, all or a fragment of a chain derived from a different species, and any combination thereof.

[0275] Techniques for modifying and expressing TCRs are known in the art. For example, TCRs can be generated as TCR heterodimers, which include native disulfide bonds associated with the corresponding subunits, see: Garboczi et al. (1996) Nature 384(6605): 134-41; Garboczi et al. (1996) Journal of Immunology 157(12): 5403-10; Chang et al. (1994) Proceedings of the National Academy of Sciences 91: 11408-11412; Davodeau et al. (1993) Journal of Biochemistry 268(21): 15455-15460; Golden et al. (1997) Journal of Biochemistry 206: 163-169; U.S. Patent No. 6,080,840. For a detailed description of the modified TCR, see Ping et al., “Modified T cells with T-cell receptors for cancer treatment: current status and future directions”, Protein & Cell, 2018, 9(3):254–266.

[0276] iv) Cells also lack modified antigen-presenting proteins and other proteins.

[0277] In some embodiments, the modified cells provided herein (e.g., modified immune cells) also lack one or more proteins involved in antigen processing, antigen presentation, antigen recognition and / or antigen response, including but not limited to β-2-microglobulin (B2M), major histocompatibility complex transactivator (CIITA) class II and ICP47 peptide.

[0278] In some embodiments, the modified cells provided herein (e.g., modified immune cells) also lack HLA class I proteins, or HLA class II proteins, or both.

[0279] In some embodiments, the modified cells also lack HLA-A, HLA-B, HLA-C, or any combination thereof. In some embodiments, the modified cells also lack both HLA-A and HLA-B.

[0280] Human leukocyte antigens (HLA) are one of the main biomarkers for the immune system to recognize “self” and “non-self” antigens (Hudson et al., “Leukocyte immunoglobulin-like receptors – MHC class I disease-associated models,” Frontiers in Immunology (2016) 7:281. doi:10.3389 / fimmu.2016.00281). In allogeneic transplantation, HLA class I molecules are the main antigens that induce host resistance to graft-versus-graft disease (HVGD). Modifying or knocking down HLA class I molecules in allogeneic cells can reduce the immunogenicity of allogeneic cells; see, for example, WO2021050601, WO2021062227, WO2021011919, all of which are incorporated herein by reference in their entirety.

[0281] HLA class I molecules are heterodimers composed of a highly variable α chain and a constant β chain, the latter also known as β-microglobulin (B2M). The α and β chains of HLA class I molecules bind to intracellular antigenic peptides for assembly, and the assembled HLA-antigen peptide complex is transported to the cell surface. The antigenic peptides to be loaded onto MHC class I molecules are produced in the cytosol and transported to the endoplasmic reticulum (ER) via antigen-processing-associated transporters (TAPs) (Michalek et al., (1993), “The role of ubiquitin-dependent proteolytic pathways in the presentation of MHC class I restricted antigens.” *Nature* 363(6429): 552–554). In the ER, the antigenic peptides can also be pruned by the aminopeptidases ERAP1 and ERAP2 (Saveanu et al., 2005, “Cooperative peptide pruning of the human ERAP1 / ERAP2 aminopeptidase complex in the endoplasmic reticulum.” *Nature Immunology* 6(7): 689–697). Therefore, the absence of the α or β chain of HLA class I molecules or proteins involved in HLA-to-peptide assembly (such as TAP proteins) will negatively impact the assembly of HLA class I molecules into antigenic peptides and their cell surface expression. Furthermore, dysregulation of antigen processing mechanism (APM) proteins (such as TAP-associated glycoproteins) will also lead to decreased HLA class I cell surface expression (Camilla et al., “HLA class I molecule expression levels in glioblastoma are most strongly associated with tapasin compared to other antigen processing proteins.” *British Journal of Cancer* (2015) 113, 952–962).

[0282] In some implementations, immune cells also lack B2M.

[0283] Any suitable method can be used to modify cells to lack HLA class I proteins, such as through gene editing, by interfering with the expression of HLA class I proteins, or by promoting the degradation of HLA class I proteins or their encoding mRNA. In some embodiments, the modified cells (e.g., modified immune cells) include a second mutation in the coding or regulatory sequence of a genomic region of HLA class I proteins or B2M, wherein the mutation (e.g., deletion, substitution, insertion) reduces the expression or activity of HLA class I proteins or B2M. In some embodiments, the modified cells (e.g., modified immune cells) include a second interfering oligonucleotide that targets the mRNA of HLA class I or B2M, thereby resulting in reduced expression of HLA class I proteins or B2M therein.

[0284] In some embodiments, the modified cells provided herein (e.g., modified immune cells) also lack HLA class II proteins. In some embodiments, the immune cells also lack CIITA.

[0285] Any suitable method can be used to modify cells to lack HLA class II proteins, such as through gene editing, by interfering with the expression of HLA class II proteins, or by promoting the degradation of HLA class II proteins or their encoding mRNA. In some embodiments, the modified cells (e.g., modified immune cells) include a third mutation in the coding or regulatory sequence of a genomic region of an HLA class II protein or CIITA, wherein the mutation (e.g., deletion, substitution, insertion) reduces the expression or activity of HLA class II proteins or CIITA. In some embodiments, the modified cells (e.g., modified immune cells) include a third interfering oligonucleotide that targets the mRNA of HLA class I or CIITA, thereby resulting in reduced expression of HLA class II proteins or CIITA therein.

[0286] In some implementations, the modified cells provided herein (e.g., modified immune cells, modified T cells) also lack endogenous T cell receptors.

[0287] "Lack of endogenous T cell receptors" means that even at high immunogen doses (e.g., doses that are close to saturation for induction of the following T cell functions in subjects receiving immunogen doses), the level or number of endogenous TCRs present on modified cells (e.g., modified T cells) does not induce or will induce less than 10% of T cell function (e.g., proliferation, cytokine production, and / or induction of lytic activity). The level or number of TCRs on T cells can be measured by methods such as quantitative flow cytometry, immunofluorescence microscopy, and optical traps; see: Davis et al. (1998), "Determination of cell surface CD4 antigen density: the role of antibody titer, affinity, clonal and conjugation." *Cell Metrology* 33, 197–205; Labrecque et al., "How much TCR do T cells need?" *Immunology* 2001;15:71–82; and James et al., "Mathematical models of chimeric TCR triggering predict the extent of target cell lysis and how it is affected by TCR downregulation." *Journal of Immunology* 2010; 184:4284–94; Wei et al. (1999), “Mapping T-cell sensitivity using optical tweezers: polar characteristics and minimum number of Ca(2+) signaling.” *Proceedings of the National Academy of Sciences* 96, 8471–8476. For example, studies have confirmed that T cells in mice responding to high doses of immunogens have approximately 1000 or fewer (e.g., 200–400, 450) surface TCR molecules (Labrecque et al., “How many TCRs do T cells need?” *Journal of Immunology* 2001; 15:71–82; Wei et al. (1999), “Mapping T-cell sensitivity using optical tweezers: polar characteristics and minimum number of Ca(2+) signaling.” *Proceedings of the National Academy of Sciences* 96, 8471–8476).

[0288] In some embodiments, the modified cells provided herein (e.g., modified immune cells, modified T cells) also lack the T cell receptor α chain constant region (TRAC), T cell receptor β constant region 1 (TRBC1), T cell receptor β constant region 2 (TRBC2), or any combination thereof.

[0289] Any suitable method can be used to modify cells to lack endogenous TCRs, such as through gene editing, by interfering with the expression of endogenous TCRs, or by promoting the degradation of endogenous TCRs or their encoding mRNAs. In some embodiments, the modified cells (e.g., modified immune cells) include a fourth mutation in a coding or regulatory sequence in a genomic region of an endogenous TCR or TRAC or TRBC1 or TRBC2 or any combination thereof, wherein the mutation (e.g., deletion, substitution, insertion) reduces the expression or activity of an endogenous TCR or TRAC or TRBC1 or TRBC2 or any combination thereof. In some embodiments, the modified cells (e.g., modified immune cells) include a fourth interfering oligonucleotide that targets the mRNA of an endogenous TCR or TRAC or TRBC1 or TRBC2 or any combination thereof, thereby resulting in reduced expression therein of an endogenous TCR or TRAC or TRBC1 or TRBC2 or any combination thereof.

[0290] In some embodiments, a second, third, or fourth mutation, or any combination thereof, is introduced by any suitable means in the art (e.g., but not limited to gene editing). Suitable methods will be described in more detail in the following sections of this invention.

[0291] v) Modified combinations in modified cells

[0292] In some embodiments, the modified cells or populations thereof provided herein are modified to be deficient in a set of molecules, such as a combination of endogenous immunosuppressive checkpoint molecules and HLA-I proteins; or a combination of endogenous immunosuppressive checkpoint molecules and HLA-II proteins; or a combination of endogenous immunosuppressive checkpoint molecules, HLA-I proteins, and HLA-II proteins. In some embodiments, when the modified cells are T cells, they are also modified to lack endogenous T cell receptors.

[0293] In some implementations, the modified cells (e.g., modified immune cells) or populations thereof are also engineered to express ligands of the lacking immunosuppressive immune checkpoint molecules.

[0294] In some implementations, the modified cells (e.g., modified immune cells) or populations thereof lack HLA-A and HLA-B relative to their unmodified counterparts.

[0295] In some implementations, the modified cells (e.g., modified immune cells) or populations thereof lack HLA-A, HLA-B, and CIITA relative to their unmodified counterparts.

[0296] In some embodiments, the modified cells (e.g., modified immune cells) or populations thereof lack B2M, CIITA, and PD-1 relative to their unmodified counterparts. In some of these embodiments, the modified cells (e.g., modified immune cells) or populations thereof are also engineered to express PD-L1 or PD-L2 relative to their unmodified counterparts. In some embodiments, PD-L1 is a PD-L1 variant provided herein. In some embodiments, PD-L2 is a PD-L2 variant.

[0297] In some embodiments, the modified cells (e.g., modified immune cells) or populations thereof lack B2M, CIITA, and TIM-3 relative to their unmodified counterparts. In some of these embodiments, the modified cells (e.g., modified immune cells) or populations thereof are also engineered to express a ligand for TIM3 (e.g., galactagogue 9) relative to their unmodified counterparts. In some embodiments, the ligand for TIM3 9 (e.g., galactagogue 9) is a variant with reduced immunosuppressive signaling relative to the natural ligand (e.g., natural galactagogue 9).

[0298] In some embodiments, the modified cells (e.g., modified immune cells) or populations thereof lack B2M, CIITA, and LAG-3 relative to their unmodified counterparts. In some of these embodiments, the modified cells (e.g., modified immune cells) or populations thereof are also engineered to express a ligand for LAG3 (e.g., galactagogue-3, LSECtin, α-synuclein, FGL1, or MHCII) relative to their unmodified counterparts. In some embodiments, the LAG3 ligand is a variant that exhibits reduced immunosuppressive signaling relative to the natural ligand for LAG3.

[0299] In some embodiments, the modified cells (e.g., modified immune cells) or populations thereof lack B2M, CIITA, and TIGIT relative to their unmodified counterparts. In some of these embodiments, the modified cells (e.g., modified immune cells) or populations thereof are also engineered to express a TIGIT ligand (e.g., CD155, CD112, or CD113) relative to their unmodified counterparts. In some embodiments, the TIGIT ligand is a variant that exhibits reduced immunosuppressive signaling relative to the natural TIGIT ligand.

[0300] In some embodiments, the modified cells (e.g., modified immune cells) or populations thereof lack HLA-A, HLA-B, CIITA, and PD-1 relative to their unmodified counterparts. In some of these embodiments, the modified cells (e.g., modified immune cells) or populations thereof are also engineered to express PD-L1 or PD-L2 relative to their unmodified counterparts. In some embodiments, PD-L1 is a PD-L1 variant provided herein. In some embodiments, PD-L2 is a PD-L2 variant.

[0301] In some embodiments, the modified cells (e.g., modified immune cells) or populations thereof lack HLA-A, HLA-B, CIITA, and TIM3 relative to their unmodified counterparts. In some of these embodiments, the modified cells (e.g., modified immune cells) or populations thereof are also engineered to express a ligand for TIM3 9 (e.g., galactagogue 9) relative to their unmodified counterparts. In some embodiments, the ligand for TIM3 9 (e.g., galactagogue 9) is a variant that has reduced immunosuppressive signaling relative to the natural ligand (e.g., natural galactagogue 9).

[0302] In some embodiments, the modified cells (e.g., modified immune cells) or populations thereof lack HLA-A, HLA-B, CIITA, and LAG3 relative to their unmodified counterparts. In some of these embodiments, the modified cells (e.g., modified immune cells) or populations thereof are also engineered to express a ligand for LAG3 (e.g., galactagogue-3, LSECtin, α-synuclein, FGL1, or MHCII) relative to their unmodified counterparts. In some embodiments, the LAG3 ligand is a variant that exhibits reduced immunosuppressive signaling relative to the natural ligand for LAG3.

[0303] In some embodiments, the modified cells (e.g., modified immune cells) or populations thereof lack HLA-A, HLA-B, CIITA, and TIGIT relative to their unmodified counterparts. In some of these embodiments, the modified cells (e.g., modified immune cells) or populations thereof are also engineered to express TIGIT ligands (e.g., CD155, CD112, or CD113) relative to their unmodified counterparts. In some embodiments, the TIGIT ligands are variants that exhibit reduced immunosuppressive signaling relative to the natural TIGIT ligand.

[0304] In some implementations, the modified cells (e.g., modified immune cells) or populations thereof are also engineered to express the target peptide (e.g., CAR or modified TCR or other cell surface receptors or ligands).

[0305] Methods for preparing modified cells (e.g., modified immune cells).

[0306] This document also provides a method for generating modified cells (e.g., modified immune cells) as described above, comprising: providing a starting cell; modifying the starting cell to reduce the expression or activity of an endogenous suppressor immune checkpoint molecule and increase the expression or activity of a ligand of the endogenous suppressor immune checkpoint molecule, thereby obtaining the modified cell (e.g., modified immune cell). The endogenous suppressor immune checkpoint molecule and its ligand may be the same as described in the preceding sections. In some embodiments, the starting cell is an immune cell, e.g., an immune cell expressing an endogenous suppressor immune checkpoint molecule. In some embodiments, the starting cell is an immune cell, e.g., an immune cell expressing both an endogenous suppressor immune checkpoint molecule and a ligand of the endogenous suppressor immune checkpoint molecule.

[0307] This document also provides a method for generating modified cells (e.g., modified immune cells) as described above, comprising: providing a starting cell (e.g., an immune cell) expressing an endogenous suppressor immune checkpoint molecule and a ligand of the endogenous suppressor immune checkpoint molecule; and modifying the starting cell (e.g., the immune cell) to reduce the expression or activity of the endogenous suppressor immune checkpoint molecule, thereby obtaining the modified cell (e.g., the modified immune cell). The endogenous suppressor immune checkpoint molecule and its ligand may be the same as those described in the preceding sections.

[0308] This document also provides a method for generating modified cells (e.g., modified immune cells) as described above, comprising: providing a starting cell (e.g., an immune cell) lacking an endogenous suppressive immune checkpoint molecule; and modifying the starting cell (e.g., the immune cell) to increase the expression or activity of a ligand of the endogenous suppressive immune checkpoint molecule, thereby obtaining the modified cell (e.g., the modified immune cell). The endogenous suppressive immune checkpoint molecule and its ligand may be the same as those described in the preceding sections.

[0309] This document also provides a method for generating modified cells (e.g., modified immune cells) as described above, comprising: providing starting cells; modifying the starting cells to express a ligand of an inhibitory immune checkpoint molecule, wherein the ligand is a variant of a homologous ligand that has a reduced ability to induce immunosuppressive signaling relative to the homologous ligand. The variant of the homologous ligand may be the same as described in the preceding sections.

[0310] In some embodiments, the step of modifying the starting cell (e.g., an immune cell) to reduce the expression or activity of an endogenous inhibitory immune checkpoint molecule includes: a) introducing a first mutation into the coding or regulatory sequence of a genomic region of the inhibitory immune checkpoint molecule in the starting cell, thereby reducing the expression or activity of the inhibitory immune checkpoint molecule therein; or b) introducing a first interfering oligonucleotide targeting the mRNA of the inhibitory immune checkpoint molecule into the starting cell (e.g., an immune cell), thereby reducing the expression of the inhibitory immune checkpoint molecule therein; or c) introducing a protein, peptide, or small molecule that inhibits the expression and / or activity of the inhibitory immune checkpoint molecule into the starting cell (e.g., an immune cell); or d) contacting the starting cell (e.g., an immune cell) with a protein, peptide, or small molecule that inhibits the expression and / or activity of the inhibitory immune checkpoint molecule.

[0311] In some embodiments, the method may further include the step of modifying the starting cell (e.g., immune cell) or modified cells derived from the starting cell to reduce the expression or activity of HLA class I proteins, the step comprising: a) introducing a second mutation into the coding or regulatory sequence of a genomic region of an HLA class I protein (e.g., HLA-A, HLA-B, or B2M) in the starting cell (e.g., immune cell) or modified cells derived from the starting cell, thereby reducing the expression or activity of the HLA class I protein therein; or b) introducing a second interfering oligonucleotide targeting the mRNA of an HLA class I protein (e.g., HLA-A, HLA-B, or B2M) into the starting cell (e.g., immune cell) or modified cells derived from the starting cell, thereby reducing the expression of the HLA class I protein therein; or c) introducing an inhibitory oligonucleotide into the starting cell (e.g., immune cell) or modified cells derived from the starting cell, thereby reducing the expression of the HLA class I protein therein. The expression and / or activity of class I proteins (e.g., HLA-A, HLA-B, or B2M) by proteins, peptides, or small molecules; or d) contacting the initiating cell (e.g., immune cells) or modified cells derived from the initiating cell with proteins, peptides, or small molecules that inhibit the expression and / or activity of HLA class I proteins.

[0312] In some embodiments, the method may further include the step of modifying the starting cell (e.g., immune cell) or a modified cell derived from the starting cell to reduce the expression or activity of an HLA class II protein, the step comprising: a) introducing a third mutation into the coding or regulatory sequence of a genomic region of an HLA class II protein (e.g., CIITA) in the starting cell (e.g., immune cell) or a modified cell derived from the starting cell, thereby reducing the expression or activity of the HLA class II protein therein; or b) introducing a second interfering oligonucleotide targeting the mRNA of an HLA class II protein (e.g., CIITA) into the starting cell (e.g., immune cell) or a modified cell derived from the starting cell, thereby reducing the expression of the HLA class II protein therein; or c) introducing a protein, peptide, or small molecule that inhibits the expression and / or activity of an HLA class II protein (e.g., CIITA) into the starting cell (e.g., immune cell) or a modified cell derived from the starting cell; or d) contacting the starting cell (e.g., immune cell) or a modified cell derived from the starting cell with a protein, peptide, or small molecule that inhibits the expression and / or activity of an HLA class II protein.

[0313] In some embodiments, the method may further include the step of modifying the starting cell (e.g., an immune cell) or a modified cell derived from the starting cell to reduce the expression or activity of an endogenous TCR, the step comprising: a) introducing a fourth mutation into a coding or regulatory sequence in a genomic region of an endogenous TCR (e.g., TRAC, TRBC1, or TRBC2) in the starting cell (e.g., an immune cell) or a modified cell derived from the starting cell, thereby resulting in reduced expression or activity of the endogenous TCR therein; or b) introducing a fourth mutation into the starting cell (e.g., an immune cell) or a modified cell derived from the starting cell, thereby reducing the expression or activity of the endogenous TCR therein; The process involves introducing a third interfering oligonucleotide into the modified cells of the initiating cell that targets the mRNA of the endogenous TCR (e.g., TRAC, TRBC1, or TRBC2), thereby reducing the expression of the endogenous TCR therein; or c) introducing a protein, peptide, or small molecule that inhibits the expression and / or activity of the endogenous TCR into the initiating cell (e.g., an immune cell) or a modified cell derived from the initiating cell; or d) contacting the initiating cell (e.g., an immune cell) or a modified cell derived from the initiating cell with a protein, peptide, or small molecule that inhibits the expression and / or activity of the endogenous TCR.

[0314] In some implementations, the first, second, third, and / or fourth mutations are introduced via gene editing. Many nucleic acid-based compositions and methods can be used for gene editing, such as antisense RNA, antagomir RNA, siRNA, shRNA, and the CRISPR system.

[0315] In some embodiments, gene editing includes introducing into immune cells: i) a protein or polynucleotide encoding a target sequence, and ii) an oligonucleotide complementary to a target sequence in a coding or regulatory sequence of a genomic region of a target molecule (e.g., an inhibitory immune checkpoint molecule, HLA class I proteins and / or HLA class II proteins, or endogenous TCRs). In some embodiments, the protein targeting the sequence includes sequence-guided DNA endonucleases such as Cas9, T7, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, and Fok1.

[0316] In some embodiments, the oligonucleotide includes a guide nucleic acid. The guide nucleic acid sequence includes an RNA sequence, a DNA sequence, a combination thereof (RNA-DNA combined sequence), or a sequence having synthetic nucleotides. The guide nucleic acid sequence can be a single molecule or a pair of molecules. In one embodiment, the guide nucleic acid sequence includes a single guide RNA. In one embodiment, the guide nucleic acid sequence has a length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or more nucleotides.

[0317] In some embodiments, the oligonucleotide includes one or more guide nucleic acids (e.g., guide RNA) that target: a) coding or regulatory sequences in genomic regions of HLA class I proteins (e.g., HLA-A, HLA-B, or B2M); b) coding or regulatory sequences in genomic regions of HLA class II proteins (e.g., CIITA); c) coding or regulatory sequences in genomic regions of inhibitory immune checkpoint molecules (e.g., PD-1, TIM3, LAG3, or TIGIT); or d) coding or regulatory sequences in genomic regions of endogenous TCRs (e.g., TRAC, TRBC1, or TRBC2).

[0318] In some embodiments, the oligonucleotide comprises one or more guide nucleic acids (e.g., guide RNA) that target genomic regions of HLA-A and is complementary to the fragment of SEQ ID NO: 63 or 64.

[0319] In some embodiments, the oligonucleotide includes one or more guide nucleic acids (e.g., guide RNA) that target genomic regions of HLA-B and is complementary to the fragment of SEQ ID NO: 65 or 66.

[0320] In some embodiments, the oligonucleotide comprises one or more guide nucleic acids (e.g., guide RNA) that target genomic regions of B2M and is complementary to the fragment of SEQ ID NO: 67.

[0321] In some embodiments, the oligonucleotide comprises one or more guide nucleic acids (e.g., guide RNA) that target genomic regions of CIITA and is complementary to the fragment of SEQ ID NO: 68.

[0322] In some embodiments, the oligonucleotide comprises one or more guide nucleic acids (e.g., guide RNA) that target genomic regions of PD-1 and is complementary to the fragment of SEQ ID NO: 69.

[0323] In some embodiments, the oligonucleotide comprises one or more guide nucleic acids (e.g., guide RNA) that target genomic regions of TRAC and is complementary to the fragment of SEQ ID NO: 70.

[0324] In some implementations, the steps of modifying initiating cells (e.g., immune cells) to increase the expression or activity of ligands of inhibitory immune checkpoint molecules include: a) introducing an exogenous first polynucleotide comprising the coding sequence of the ligand into the initiating cells (e.g., immune cells), thereby causing the ligand to be expressed therein; b) knocking out or knocking down one or more inhibitory transcription factors; c) editing the regulatory sequences of one or more genes encoding the ligand; or d) knocking in the gene encoding the ligand. For example, Keisuke et al. found that truncation of the 3' untranslated (3'-UTR) region of the PD-L1 transcript led to increased PD-L1 expression in various cancers (Keisuke et al., “Abnormal PD-L1 expression in multiple cancers caused by disruption of the 3'-UTR.” Nature. 2016, 16 June; 534(7607):402-6). Therefore, it can be expected that modified immune cells comprising truncation of the 3'-UTR region of the PD-L1 transcript will lead to increased PD-L1 expression. For methods to disrupt the 3'-UTR region of the PD-L1 transcript, see Keisuke et al., “Abnormal PD-L1 expression induced by 3'-UTR disruption in multiple cancers.” Nature. 2016, 16 June; 534(7607):402-6.

[0325] In some embodiments, the step of modifying a starting cell (e.g., an immune cell) to express a variant of the homologous ligand includes: a) introducing a first exogenous polynucleotide comprising the coding sequence of the variant into the starting cell (e.g., an immune cell) to thereby express the variant therein; or b) knocking in a gene encoding the variant.

[0326] In some embodiments, the first exogenous polynucleotide also includes the coding sequence of a signal peptide operatively linked to the coding sequence of a ligand or a variant of the ligand.

[0327] In some embodiments, the coding sequence of a signal peptide is also included, which is operatively linked to the coding sequence of a ligand or a variant of the ligand.

[0328] In some implementations, the first exogenous polynucleotide also includes a promoter operatively linked to the coding sequence of the ligand.

[0329] In some embodiments, the exogenous first polynucleotide is mRNA, an expression vector, optionally a retroviral vector, lentiviral vector, adenoviral vector, adeno-associated virus (AAV) vector, virus-like particle (VLP), herpes simplex virus (HSV) vector, plasmid, minicircle, nanoplasmid, DNA vector, or RNA vector. In some embodiments, the expression vector is a viral expression vector, optionally a retroviral vector, lentiviral vector, adenoviral vector, adeno-associated virus (AAV) vector, virus-like particle (VLP), or herpes simplex virus (HSV) vector.

[0330] In some embodiments, the starting cell is a natural cell or a differentiated cell. In some embodiments, the starting cell is a natural cell or a genetically engineered cell derived from a differentiated cell.

[0331] In some embodiments, the differentiated cells are derived from stem cells. In some embodiments, the stem cells are hematopoietic progenitor cells (e.g., T cell progenitors, NK cell progenitors, macrophage progenitors), hematopoietic stem cells (HSCs), CD34+ cells, embryonic stem cell lines, mesenchymal stem cells, or iPSCs. Stem cells may be modified first to increase the expression or activity of ligands for inhibitory immune checkpoint molecules, followed by gene editing in endogenous inhibitory immune checkpoint molecules to decrease the expression or activity of endogenous inhibitory immune checkpoint molecules, HLA class I proteins and / or HLA class II proteins, and / or endogenous TCRs. After modification or alteration of the stem cells, the modified or altered stem cells may differentiate under suitable conditions to obtain the modified cells of the present invention. For differentiated hematopoietic cells genetically engineered to express recombinant TCRs or CARs, the cells may be activated and expanded using, for example, the method described in U.S. Patent No. 6,352,694. In some embodiments, the starting cells and / or modified cells may be expanded and / or activated in vitro prior to transfusion.

[0332] The methods described herein may also include obtaining starting cells from a source, culturing cells, activating cells, and expanding cells.

[0333] The methods provided herein may also involve the step of isolating initiating cells (e.g., immune cells) using various techniques known in the art, such as flow cytometry. In short, initiating cells in a sample are labeled with fluorescently labeled antibodies having affinity for markers of initiating cells (e.g., immune cells). Cells are isolated using gating strategies suitable for cells expressing the markers. For example, T cells can be separated from other cells in a sample by using, for example, fluorescently labeled antibodies specific to cell markers (such as CD4, CD8, CD28, and CD45) and corresponding gating strategies. In some embodiments, T cells lacking CD3 are isolated or enriched.

[0334] Polynucleotides and carriers

[0335] Suitable recombination techniques can be used to construct nucleic acids or polynucleotides encoding ligands or variant ligands of inhibitory immune checkpoint molecules, or encoding PD-L1 variants, as provided in this paper. If desired, polynucleotide sequences encoding one or more adapters can also be operatively ligated to allow expression of the desired product.

[0336] The encoding polynucleotide sequence can be mRNA, which can be transcribed in vitro and optionally encapsulated in a suitable delivery vector such as lipid nanoparticles.

[0337] Encoding polynucleotide sequences can also be inserted into vectors using recombination techniques known in the art for further cloning (DNA amplification) or for expression. Many vectors are available. Vector components typically include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter (e.g., prokaryotic promoters such as T7, T7lac, Sp6, araBAD, trp, lac, tac, pLm, A3, lac, lpp, npr, pac, syn, trc, and T3, or eukaryotic promoters such as SV40, CMV, and EF-1α), and a transcription termination sequence.

[0338] On the other hand, the present invention provides expression vectors comprising the polynucleotides provided herein. In some embodiments, the expression vectors provided herein include sufficient cis-acting elements for expression, while other elements for expression are provided by a host cell or in an in vitro expression system. In some embodiments, the expression vectors provided herein further include nucleotide sequences encoding signal peptides for, for example, nuclear, nucleolar, or mitochondrial localization.

[0339] In some embodiments, the expression vectors provided herein include polynucleotides encoding the ligands of the present invention and polynucleotides encoding one or more CARs or TCRs.

[0340] The expression vectors provided herein may also include a DNA endonuclease encoding RNA (e.g., Cas9) and one or more nuclear localization sequences and optionally one or more deaminases.

[0341] The expression vector of the present invention may also include any suitable number of regulatory / control elements, such as promoters, enhancers, introns, polyadenylation signals, Kozak consensus sequences, internal ribosome entry sites (IRES), or peptide 2A (P2A) sequences. These elements are well known in the art.

[0342] Expression vectors can be selected from the group consisting of: viral vectors, virus-like particles (VLPs), plasmids, microcircles, nanoparticles, DNA vectors, or RNA vectors. In some embodiments, the expression vector is a viral expression vector, optionally a retroviral vector, lentiviral vector, adenovirus vector, adeno-associated virus (AAV) vector, virus-like particle (VLP) vector, and herpes simplex virus (HSV) vector. Typically, a viral vector includes a functional origin of replication, a promoter, a restriction endonuclease site, and one or more optional markers that are functional in at least one organism.

[0343] The expression vectors provided in this article can be lentiviral vectors, which facilitate the long-term, stable integration of CAR-encoding polynucleotides into the genome of non-proliferating cells, thereby enabling stable expression of CAR in host cells, such as host T cells. Lentivirals are complex retroviruses capable of infecting mitotic and postmitotic cells and expressing their genes therein. Human immunodeficiency virus (HIV) is considered the most common lentivirus, using envelope glycoproteins from other viruses to target a wide range of cell types. For lentivirus preparation, see Gustabo et al., “Production and Purification of Lentiviral Vectors,” *Nature Laboratory Guide*, Vol. 1, pp. 241-245 (2006).

[0344] Other expression vectors, such as plasmid vectors, phage vectors, phage-derived vectors, granule vectors, transposon vectors, site-directed insertion vectors (e.g., CRISPR, zinc finger nucleases, TALEN), in vitro transcribed RNA vectors, and suicide expression vectors, are also within the scope of this invention.

[0345] The expression vectors provided herein can be delivered to host cells using various techniques known in the art, such as physical, chemical, or biological methods. Physical methods for introducing expression vectors into host cells include, but are not limited to, lipid transfection, calcium phosphate precipitation, particle bombardment, microinjection, and electroporation. Biological methods include, but are not limited to, inserting genes into host cells using viral vectors (particularly retroviral vectors, such as lentiviral vectors). Chemical methods include, but are not limited to, colloidal dispersion systems (e.g., macromolecular complexes, nanocapsules, microspheres, microbeads) and lipid-based systems (e.g., oil-in-water emulsions, micelles, mixed micelles, and liposomes).

[0346] Pharmaceutical Composition

[0347] On the other hand, the present invention also provides pharmaceutical compositions comprising modified cells (e.g., modified immune cells) as provided herein, recombinant cells as provided herein, proteins or polynucleotides as provided herein, and pharmaceutically acceptable mediators. As used herein, the term "pharmaceutical composition" refers to a composition formulated for pharmaceutical use.

[0348] The term “pharmaceutically acceptable” means that the specified carrier, solvent, diluent, excipient and / or salt is generally chemically and / or physically compatible with other components contained in the formulation and physiologically compatible with their receptors.

[0349] "Pharmaceutically acceptable medium" refers to a component of a pharmaceutical preparation that, other than the active ingredient, is biologically acceptable and non-toxic to the subject. Pharmaceutically acceptable media used in the pharmaceutical compositions disclosed herein may include, for example, pharmaceutically acceptable liquids, gels, or solid carriers, aqueous or non-aqueous solvents, antimicrobial agents, buffers, antioxidants, isotonic agents, suspending / dispersing agents, multivalent chelating agents or chelating agents, diluents, adjuvants, excipients, or non-toxic excipients, or various combinations thereof.

[0350] The pharmaceutical compositions of the present invention can be prepared using various techniques known in the art, and specific methods can be found, for example, in Remington: Pharmaceutical Technology and Practice (21st edition, 2005). In short, the modified cells / recombinant cells or populations thereof are mixed with a suitable medium before use or storage. A suitable pharmaceutically acceptable medium typically contains an inert substance that facilitates: 1) administering the pharmaceutical composition to a subject, 2) processing the pharmaceutical composition into a deliverable formulation, and / or 3) storing the pharmaceutical composition prior to administration. In some embodiments, the pharmaceutically acceptable medium contains agents that can stabilize, optimize, or alter the form, consistency, viscosity, pH, pharmacokinetics, and / or solubility of the formulation. Such agents include, but are not limited to, buffers, wetting agents, emulsifiers, diluents, encapsulating agents, and skin penetration enhancers, such as saline, buffer solutions, dextrose, arginine, sucrose, water, glycerol, ethanol, sorbitol, dextran, sodium carboxymethyl cellulose, and combinations thereof.

[0351] Exemplary pharmaceutically acceptable media include sugars (e.g., lactose, glucose, and sucrose), starches (e.g., corn starch and potato starch), cellulose and its derivatives (e.g., sodium carboxymethyl cellulose, methyl cellulose, ethyl cellulose, microcrystalline cellulose, and cellulose acetate), tragacanth powder, malt, gelatin, lubricants (e.g., magnesium stearate, sodium lauryl sulfate, and talc), excipients (e.g., cocoa butter and suppository waxes), oils (e.g., peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil), and glycols. (e.g., propylene glycol), polyols (e.g., glycerol, sorbitol, mannitol, and polyethylene glycol (PEG)), esters (e.g., ethyl oleate and ethyl laurate), agar, buffers (e.g., magnesium hydroxide and aluminum hydroxide), alginate, pyrogen-free water, isotonic saline, Ringer's solution, ethanol, pH buffer, polyester, polycarbonate, polyanhydride, fillers (e.g., peptides and amino acids), alcohols (e.g., ethanol), (sterile) phosphate buffer, Ringer's solution, dextran solution, and other non-toxic and compatible substances used in pharmaceutical formulations.

[0352] The pharmaceutical compositions of the present invention may comprise modified cells as described herein in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may contain buffers, such as neutral buffers, phosphate buffers, etc.; carbohydrates, such as glucose, mannose, sucrose, or dextran, mannitol; proteins; polypeptides or amino acids, such as glycine; antioxidants; chelating agents, such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. The compositions of the present invention are preferably formulated for intravenous administration.

[0353] Reagent test kit

[0354] On the other hand, the present invention also provides a kit comprising modified cells (e.g., modified immune cells) or recombinant cells as provided herein, wherein the modified cells or recombinant cells have reduced autosuppression, improved effector cell function, and improved cell activation and / or expansion. On the other hand, the present invention also provides a kit comprising proteins, polynucleotides, or expression vectors as provided herein, for generating modified cells (e.g., modified immune cells) or recombinant cells expressing CAR or TCR that have reduced autosuppression, improved effector cell function, and improved cell activation and / or expansion.

[0355] In some embodiments, the kit of the present invention includes written instructions for use of the kit. In some embodiments, the instructions include at least one of the following: clinical studies, precautions, warnings, and / or references. The instructions may be printed directly on the container (if any), provided in the container, or provided with the container as a label affixed to the container, or as a separate sheet, booklet, card, or folded sheet. Suitable containers include, for example, bottles, syringes, vials, and test tubes. Containers may be formed from various materials, such as plastic or glass. In some embodiments, the container contains the pharmaceutical composition provided herein and has a sterile inlet.

[0356] In some embodiments, the kit further includes a second container comprising the pharmaceutically acceptable medium as described above. In some embodiments, the kit also includes other commercially desirable or user-friendly materials, such as additional diluents, buffers, needles, filters, syringes, and packaging inserts with instructions for use.

[0357] Treatment

[0358] On the other hand, the present invention provides a method for treating a condition or disease in a subject in need, comprising: administering to the subject a therapeutically effective amount of the modified cells (e.g., modified immune cells) provided herein.

[0359] In some implementations, the subjects suffer from a condition selected from cancer, autoimmune diseases, infectious diseases, aging, metabolic diseases, and cardiovascular diseases. Cell therapy has been approved for the treatment of cancer and has been found to be useful for treating many other different conditions and diseases. For further details, please refer to various publications, such as Chu ET et al., Cell, March 2020; 9(3): 563; Rurik JG et al., “CAR T cells prepared in vivo for the treatment of cardiac injury”, Science 375, 91–96 (2022); Aghajanian H et al., “Targeting cardiac fibrosis with modified T cells”, Nature 573, 430–433 (2019); Amor C et al., “Reversing aging-related pathology with senescence-clearing CAR T cells”, Nature 583, 127–132 (2020); Wagner V et al., “Modified T cells targeting senescence”, Nature 583, 37–38 (2020); Nezhad, M. S et al., “Chimeric antigen receptor-based therapies as potential treatments for autoimmune diseases: How far are we from clinical application?”, Frontiers in Immunology, November 26, 2020. Stewart et al., “Infectious Complications of CAR T-cell Therapy: Clinical Progress Update,” Progress in the Treatment of Infectious Diseases, Jan-Dec 2021; 8:20499361211036773. This reference is incorporated herein by reference.

[0360] In some implementations, the cancer is either a blood cancer or a solid tumor.

[0361] In some implementations, the condition or disease is a blood cancer. In some implementations, the blood cancer is a B-cell cancer. In some implementations, the blood cancer is selected from the group consisting of leukemia, myeloma, lymphoma, and combinations thereof. In some implementations, hematologic malignancies are selected from the group consisting of: T-cell acute lymphoblastic leukemia, mycosis fungoides, Sézary syndrome, peripheral T-lymphoma, NK / T-cell lymphoma, anaplastic large cell lymphoma ALK+, primary cutaneous T-cell lymphoma (CTCL), T-cell large granular lymphoblastic leukemia (T-LGLL), angioimmunoblastic T / NK-cell lymphoma, hepatocellular T-cell lymphoma, primary cutaneous CD30+ lymphoproliferative disorder, extranodal NK / T-cell lymphoma (ENKTL), adult T-cell leukemia / lymphoma (ATLL), T-cell prolymphoblastic leukemia (T-PLL), subcutaneous panniculitis-like T-cell lymphoma (SPTCL), primary cutaneous γ-δ T-cell lymphoma (PCGD-TCL), aggressive NK-cell leukemia (ANKL), and enteropathy-associated T-cell lymphoma (EATL).

[0362] In some embodiments, the symptom or disease is a solid tumor. In some embodiments, the solid tumor is selected from the group consisting of: breast cancer, lung cancer, colorectal cancer, pancreatic cancer, glioma and lymphoma, head and neck tumors, neuroendocrine tumors, colorectal tumors, prostate tumors, breast tumors, lung tumors (e.g., small cell and non-small cell lung tumors), pancreatic tumors, thyroid tumors, ovarian tumors, cervical tumors, kidney tumors, brain tumors, liver tumors, Kaposi's sarcoma, CNS tumors, neuroblastoma, capillary angioblastoma, meningioma, brain metastases, melanoma, gastrointestinal and renal cancers and sarcomas (e.g., gastric cancer), rhabdomyosarcoma, glioblastoma (preferably glioblastoma multiforme), leiomyosarcoma, squamous cell carcinoma, basal cell carcinoma, and skin cancers that can be treated by inhibiting the growth of malignant keratinocytes, such as human malignant keratinocytes.

[0363] In some implementations, autoimmune diseases are selected from the group consisting of: lupus erythematosus, rheumatoid arthritis, and GVHD.

[0364] In some implementations, autoimmune diseases are diffuse connective tissue diseases.

[0365] In some implementations, diffuse connective tissue diseases include systemic lupus erythematosus (SLE), scleroderma, rheumatoid arthritis (RA), idiopathic inflammatory myopathy (IIM), Churg-Strauss syndrome, and microscopic polyangiitis.

[0366] In some implementations, idiopathic inflammatory myopathy (IIM) includes, but is not limited to, polymyositis (PM), dermatomyositis (DM), amyopathy-associated dermatomyositis (ADM), immune-mediated necrotizing myopathy (IMNM), inclusion body myositis (IBM), and juvenile dermatomyositis (JDM).

[0367] In some implementations, malignancies of the lymphatic system include B-cell lymphoma and B-cell leukemia. B-cell lymphoma includes Hodgkin lymphoma (HL) and non-Hodgkin lymphoma (NHL), and B-cell leukemia includes acute lymphoblastic leukemia (ALL) and chronic lymphoblastic leukemia (CLL).

[0368] In some implementations, the infectious diseases are selected from the group consisting of: fungal infections, parasitic / protozoan infections, malaria, coccidioidomycosis, histoplasmosis, onychomycosis, aspergillosis, blastomycosis, candidiasis, paracoccidioidomycosis, microsporidiosis, echinococcidioidomycosis, amoebic keratitis, amoebiasis, ascariasis, babesiosis, balanoposthosis, Bayliss scariasis, and Chagas disease. Diseases, Clonorchiasis, Cochliomyia infection, Cryptosporidiosis, Sparganosis, Gynostemia, Echinococcus, Elephantiasis, Elephantiasis, Pinworm infection, Fasciolopsis buski infection, Fasciolopsis buski infection, Filariasis, Giardiasis, Gnathostoma spinigerum infection, Hymenolepis, Isosporidiosis, Oncomelania fever, Leishmaniasis, Lyme disease, Metaclonorchiasis, Myiasis, Onchocerciasis, Lice infection, SARS-CoV infection, SARS-CoV-2 infection, Scabies, Schistosomiasis, Sleeping spells, Strongyloides infection, Tapeworm infection, Toxocariasis, Toxoplasmosis, Trichinellosis, Whipworm infection, Trypanosomiasis, Helminthiasis, Hepatitis B infection (HBV), Hepatitis C infection (HCV), Herpesvirus, Epstein-Barr virus Virus), HIV-1, HIV-2, cytomegalovirus, herpes simplex virus type I, herpes simplex virus type II, human papillomavirus, adenovirus, Kaposi's West sarcoma-associated herpesvirus epidemic, thin ring virus (also known as Torquetenovirus), human T-lymphovirus I, human T-lymphovirus II, varicella-zoster virus, JC virus, and BK virus.

[0369] In some implementations, the recipient has or is predisposed to graft-versus-host disease (GVHD).

[0370] In some implementations, the recipient has or is predisposed to tumor formation (e.g., leukemia).

[0371] In some embodiments, the methods provided herein also include administering to a subject one or more additional therapeutic agents, such as one or more additional modified immune cells or populations thereof, immune checkpoint inhibitors (e.g., anti-PD-L1 antibodies, anti-PD-1 antibodies), one or more cytokines (e.g., IL-2, IFN-α, IFN-γ). (or combinations thereof) or one or more chemotherapeutic agents (e.g., cyclophosphamide, doxorubicin, vincristine, prednisone, rituximab, oxutuzumab, bendamustine, chlorambucil, cyclophosphamide, ibrutinib, methotrexate, cytarabine, dexamethasone, cisplatin, bortezomib, fludarabine, ederaris, acalatinib, lenalidomide, venetoclax, cyclophosphamide, ifosfamide, etoposide, pentostatin, melphalan, carfilzomib, esazomib, pabistalsis, daratumumab, erlotuzumab, thalidomide, lenalidomide, or pomalidomide, or combinations thereof). One or more additional therapeutic agents as described above may be administered before, simultaneously with, or after the administration of the recombinant or modified cells provided herein.

[0372] On the other hand, the present invention also provides a method for reducing the recipient immune response to a cell graft, comprising: administering to a subject a therapeutically effective amount of the recombinant or modified cell graft provided herein, thereby reducing the recipient immune response.

[0373] On the other hand, the present invention also provides a method for transplanting cells into a subject with a reduced risk of immune rejection, comprising: administering to the subject a therapeutically effective amount of a graft of recombinant cells or modified cells provided herein, wherein the recombinant cells or modified cells are allogeneic to the subject.

[0374] In some embodiments, the modified or recombinant cells of the present invention administered to the recipient proliferate in vivo and can persist for an extended period in the subject. When the modified cells are modified immune cells, the modified immune cells can mature into memory immune cells and remain circulating within the recipient, then generate a population of cells capable of actively responding to relapses of diseased or abnormal cells expressing markers recognized by the CAR of the modified immune cells.

[0375] In some implementations, at least 1 × 10⁻⁶ is administered to the receptor. 4 1 cell, at least 5 × 10 4 10 cells, at least 1×10 5 1 cell, at least 5 × 10 5 10 cells, at least 1×10 6 1 cell, at least 5 × 10 6 10 cells, at least 1×10 7 1 cell, at least 5 × 10 7 10 cells, at least 1×10 8 1 cell, at least 5 × 10 8 10 cells, at least 1×10 9 1 cell, at least 2 × 10 9 1 cell, at least 3 × 10 9 1 cell, at least 4 × 109 1 cell, at least 5 × 10 9 One cell, or at least 1 × 10 10 Cells. In some embodiments, at least 1 × 10⁻⁶ cells are administered to the recipient. 3 Cells / kg body weight, at least 5×10 3 Cells / kg body weight, at least 1×10 4 Cells / kg body weight, at least 5×10 4 Cells / kg body weight, at least 1×10 5 Cells / kg body weight, at least 5×10 5 Cells / kg body weight, at least 1×10 6 Cells / kg body weight, at least 5×10 6 Cells / kg body weight, at least 1×10 7 Cells / kg body weight, at least 5×10 7 Cells / kg body weight, at least 1×10 8 Cells / kg body weight, at least 2×10 8 Cells / kg body weight, at least 3×10 8 Cells / kg body weight, at least 4×10 8 Cells / kg body weight, at least 5×10 8 Cells / kg body weight, or at least 6 × 10 8 Cells per kg of body weight.

[0376] Those skilled in the art will understand that the dosage of the pharmaceutical compositions provided herein can be determined based on various factors of the receptor, such as size, age, sex, weight, and condition. Those skilled in the art can readily determine the dosage according to the present invention and their knowledge in the art.

[0377] Those skilled in the art can readily determine the number of modified / recombinant cells in the composition and applied in the method of the present invention, as well as the amounts of optional additives, solvents, media, and / or carriers. Typically, additives (if any) are present in amounts of 0.001-50% by weight of phosphate buffer, and the active ingredient (e.g., the modified / recombinant cells provided herein) is present in the range of micrograms to milligrams, for example, from about 0.0001 to about 5% by weight, preferably from about 0.0001 to about 1% by weight, more preferably from about 0.0001 to about 0.05% by weight or from about 0.001 to about 20% by weight, preferably from about 0.01 to about 10% by weight, and more preferably from about 0.05 to about 5% by weight.

[0378] It is preferable to determine the toxicity of a given dose, for example by determining the lethal dose (LD) and LD50 in a suitable animal model (e.g., mice). It is also preferable to determine the timing of administration of the composition that elicits a suitable response. Based on the knowledge of those skilled in the art and the present invention, such determination does not require excessive experimentation.

[0379] The pharmaceutical compositions provided herein can be administered using a variety of conventional techniques, including but not limited to infusion, blood transfusion, or parenteral administration. In some embodiments, parenteral administration includes intravascular, intratumoral, intravenous, intradermal, intramuscular, intra-arterial, tracheal, intrathecal, intraperitoneal, subcutaneous, subepidermal, intra-articular, subcapsular, subarachnoid, and intrasternal injection or infusion.

[0380] In some embodiments, the pharmaceutical compositions provided herein are applied topically to the site of disease (e.g., a tumor site). In some embodiments, the pharmaceutical compositions provided herein are administered to a subject by injection, via a catheter, via a suppository, or via an implant (e.g., a porous, non-porous, or gel-like material, such as a membrane, like a sialastic membrane). In some embodiments, the pharmaceutical compositions provided herein are delivered in a controlled-release system.

[0381] If a human subject has not been treated with the pharmaceutical composition provided herein, the treatment by the method provided herein results in an increased survival time for the recipient (e.g., the human subject) compared to the expected survival time of the recipient (e.g., the human subject). In another embodiment, the survival time of the human subject is increased by at least 30 days. The survival time of the human subject may be increased by at least 3 months, at least 6 months, or at least 1 year. In some embodiments, the recipient (e.g., the human subject) is intolerant to and / or unresponsive to one or more other treatments for the disease and / or condition (e.g., cancer). In some embodiments, prior to the treatment method of the present invention, the recipient (e.g., the human subject) has received at least one unsuccessful treatment and / or therapy for the disease and / or condition (e.g., cancer). In some embodiments, the recipient (e.g., the human subject) treated with the method provided herein is a child (e.g., 0-18 years old) or an adult (e.g., 18 years and older).

[0382] In some embodiments, the treatment methods of the present invention involve using modified immune cells (e.g., modified T cells) expressing a CAR. The CAR can specifically target antigens presented on unwanted cells (e.g., cancer cells) in the host. In some embodiments, the modified immune cells (e.g., modified T cells) have an enhanced cytotoxic response against their targets. In some embodiments, the modified immune cells (e.g., modified T cells) induce an enhanced cytotoxic response against their targets compared to reference cells (e.g., native T cells).

[0383] In some embodiments, the modified immune cells (e.g., modified T cells) exhibit at least 1.2-fold, 1.4-fold, 1.6-fold, 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 12-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 21-fold, 22-fold, 23-fold, 24-fold, 25-fold, 26-fold, or more of enhanced cytotoxicity compared to reference cells (e.g., native T cells).

[0384] In some embodiments, the modified immune cells (e.g., modified T cells) may kill at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 60%, at least 80%, at least 100%, at least 120%, at least 200%, at least 500%, at least 1000%, or at least 2000% more target cells than reference cells (e.g., native T cells). In some embodiments, the modified immune cells (e.g., modified T cells) are administered to an allogeneic host, wherein the modified immune cells (e.g., modified T cells) have reduced or no (or negligible or minimal) host rejection.

[0385] Example

[0386] The following embodiments further illustrate the present invention in detail with reference to the accompanying drawings, but the present invention is not limited thereto.

[0387] Although the invention has been specifically shown and described with reference to specific embodiments, some of which are preferred embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention as disclosed herein. It should be understood that the foregoing description of two preferred embodiments is intended purely to illustrate the principles of the invention and not to be exhaustive, and that changes and variations will be apparent to those skilled in the art, and that the invention is not intended to be limited to anything other than what is expressly set forth in the following claims.

[0388] Example 1: sgRNA Design

[0389] sgRNA sequences targeting HLA-A, HLA-B, TRAC, CIITA, and PD-1 were designed at the whole-exon scale based on genome sequences using GPP sgRNA Designer (an online design tool from the Broad Institute, USA) (https: / / portals.broadinstitute.org / gpp / public / analysis-tools / sgrna-design). Tools including “CRISPRko,” “SpyoCas9 NGG,” and “human GRCh38” were selected to generate all potential sgRNAs for these genes (Tables 1 to 4), and the top 10 sgRNAs for each gene were selected as preferred sequences according to priority.

[0390] Based on the "NGG" characteristic in the target gene sequences, multiple sets of sgRNA sequences were designed to target the upstream and downstream DNA sequences of HLA-A and HLA-B genes (Table 1), CIITA (Table 2), and TRAC (Table 3), respectively. Table 1 below lists the target DNA sequences of each sgRNA targeting the upstream (AU), downstream (AD), upstream (BU), and downstream (BD) sequences of HLA-A.

[0391] Table 1. Target genes (HLA-A and HLA-B) and target DNA sequences

[0392] Table 2 Target gene (CIITA) and target DNA sequence

[0393] Table 3 Target Gene (TRAC) and Target DNA Sequence

[0394] Table 4. Target gene (PD-1) and target DNA sequence

[0395] Based on the target DNA sequences listed in Tables 1 to 4 above, sgRNA sequences were designed and synthesized as follows. Each sgRNA in this application consists of a 5' targeting fragment and a 3' Cas binding fragment. The 5' targeting fragment is complementary to the target site in the genome and is otherwise identical to the 20 nucleotides upstream of the PAM sequence NGG (i.e., the target DNA sequences in Tables 1 to 4 above), except that all thymine (T) is replaced by uracil (U). The 3' Cas binding fragment is a shared motif and has the following nucleotide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO: 60).

[0396] Taking the sgRNA targeting PD-1 as an example, the 5' target DNA sequence has the sequence CGACTGGCCAGGGCGCCTGT (SEQ ID NO: 59), but T is replaced by U, which is linked to the shared motif of SEQ ID NO: 59 at the 3' end. The complete sgRNA sequence (5'-3') targeting PD-1 is shown below: CGACUGGCCAGGGCGCCUGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO: 61).

[0397] It should be noted that all sgRNAs in this embodiment have undergone chemical modification. Specifically, the modifications include phosphate thioester linkages at the first three nucleotides of the 5' end and at the second, third, and fourth nucleotides of the 3' end, as well as 2'-O-methyl (2-OMe modified) ribose modification. The final chemically modified sgRNA sequences are shown below, where the modified nucleotides are in bold and italic form, indicated by asterisks (…). )mark: C G A CUGGCCAGGGCGCCUGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC U U U U (SEQ ID NO: 62) Unless otherwise stated, all sgRNA sequences derived from the target DNA sequences (in Tables 1 to 4) were synthesized according to the above rules, and the sgRNAs were prepared by chemical synthesis.

[0398] Example 2: Construction of a chimeric antigen receptor (CAR) expression vector

[0399] This embodiment describes the construction of an expression vector, wherein the CAR expression cassette expresses a CAR ( ) linked to a truncated PD-L1 (SEQ ID NO: 19) via P2A. Figure 1A ).

[0400] CAR contains an anti-CD19 single-chain Fv (scFv) derived from antibody FMC63 (CD19-scFv), followed by the CD8α transmembrane region (CD8αTM), 4-1BB, and CD3ζ.

[0401] Compared to wild-type PD-L1 (1-290 aa, SEQ ID NO: 12), truncated PD-L1 (abbreviated as TrPD-L1 in this article) lacks the sequence from position 260 to 290 at the C-terminus.

[0402] To construct the CAR expression cassette, DNA sequences encoding the following elements were synthesized and linked in 5' to 3' order: signal peptide (amino acid sequence SEQ ID NO: 21), light chain variable region of CD19 antibody FMC63 (amino acid sequence SEQ ID NO: 22), linker (amino acid sequence SEQ ID NO: 23), heavy chain variable region of CD19 antibody FMC63 (amino acid sequence SEQ ID NO: 24), hinge region (amino acid sequence SEQ ID NO: 25), CD8α transmembrane domain (TM; amino acid sequence SEQ ID NO: 26), 4-1BB co-stimulatory signal transduction region (amino acid sequence SEQ ID NO: 27), CD3ζ signal transduction domain (amino acid sequence SEQ ID NO: 28), P2A (amino acid sequence SEQ ID NO: 16), and truncated PD-L1 (TrPD-L1; amino acid sequence SEQ ID NO: 8). The resulting expression cassette encodes the fusion protein CD19 CAR-P2A-TrPD-L1, which has the full-length amino acid sequence of SEQ ID NO: 19 and its polynucleotide sequence is shown in SEQ ID NO: 20.

[0403] A control CAR expression cassette was also constructed by replacing the TrPD-L1 sequence in the CD19 CAR-P2A-TrPD-L1 expression cassette with the wild-type PD-L1 sequence to generate the control CD19 CAR-P2A-wtPD-L1 expression cassette.

[0404] The CD19 CAR-P2A-TrPD-L1 expression cassette or the CD19 CAR-P2A-wtPD-L1 control expression cassette was integrated into the 5' and 3' end LTR sequences of the pELPS lentiviral vector (purchased from Kingsley Biotechnology), respectively. Figure 1B and Figure 6 To construct the CAR expression master plasmid CD19DL1-01 or the control plasmid CD19wtL1, and then package it into lentivirus according to the instructions provided by the supplier.

[0405] Example 3: Lentiviral Packaging and Detection

[0406] The CD19DL1-01 plasmid, along with the lentiviral packaging plasmids PMDLG / PRRE and PRSV / rev (purchased from Wuxi Shengji Medical Technology Co., Ltd.) and the lentiviral envelope plasmid pMD2.G (purchased from Wuxi Shengji Medical Technology Co., Ltd.), were transfected into 293T cells using the transfection reagent PEI (polyetherimide, purchased from Polysciences, Inc.). The transfected 293T cells were cultured, and the culture supernatant was harvested and concentrated by ultrafiltration and ultracentrifugation to obtain lentivirus for expressing CD19 CAR-P2A-TrPD-L1.

[0407] Viral titers were detected by flow cytometry. Specifically, the lentivirus solution for expressing CD19 CAR-P2A-TrPD-L1 was diluted 100-fold and added to 293T cells cultured in 24-well plates at doses of 1 μL / well, 10 μL / well, 20 μL / well, 30 μL / well, or 50 μL / well for 8 hours. After 24 hours, the virus-infected 293T cells were centrifuged, resuspended, and adjusted to a concentration of 1 × 10⁻⁶ cells / well. 6 Cells were prepared at a density of 1 cell / mL, and then biotin-CD19 antigen was added to a final concentration of 1 μg / mL. The cells were then incubated with the secondary antibody APC-streptavidin (purchased from BD). The expression of CD19 CAR on 293T cells was then detected by flow cytometry.

[0408] Experimental results ( Figure 2This indicates that the viral solution prepared by the viral packaging system in this embodiment successfully infected 293T cells, demonstrating good infectivity. The CD19 CAR was also expressed in the virus-transfected 293T cells and was able to recognize the CD19 antigen. Calculations showed a viral titer of 2.79 × 10⁻⁶. 8 TU / mL (transduction units / mL).

[0409] In a similar manner, lentivirus packaging was performed using the control plasmid CD19wtL1 prepared in Example 2 to obtain a control virus expressing CD19 CAR-P2A-wtPD-L1, which was then tested. The results showed that the control virus could also induce CD19 CAR expression in 293T cells (data not shown).

[0410] Example 4: T cell isolation and activation

[0411] Remove PBMC cells from the liquid nitrogen tank, recover and count them. Calculate the total number of PBMC cells based on the cell count. Prepare the incubation system. Add CD4 and CD8 magnetic sorting beads for sorting. Finally, based on the total number of sorted T cells, add in vitro culture medium containing IL-2 and 10% FBS. Add T cell TransAct magnetic beads. After mixing, incubate at 37℃ / 5% CO2 for two days to activate and culture.

[0412] Example 5: Viral transfection of activated T cells

[0413] To prepare T cells expressing CD19-CAR and truncated PD-L1 (TrPD-L1), T cells were activated according to Example 4, and their density was adjusted to 1×10⁻⁶ after 48 hours of activation. 6 Cells were transfected with CD19 CAR-P2A-TrPD-L1 lentivirus obtained from Example 3 at an infection titer (MOI) of 15. Cells were collected 24 hours after viral infection, and the expression of CD19-CAR and truncated PD-L1 (TrPD-L1) was detected by flow cytometry. The results showed that CD19-CAR (see [link to example])... Figure 3A ) and truncated PD-L1 (TrPD-L1; see Figure 3B Both CD19-CAR and TrPD-L1 were highly expressed by infected T cells, and their proportions were synchronized (the positive expression rates of CD19-CAR and TrPD-L1 were 37.42% and 41.49%, respectively), indicating that the gene overexpression system used was effective, stable, and consistent. In this application, the obtained T cells expressing CD19-CAR and truncated PD-L1 (TrPD-L1) are referred to as TrPDL1-CAR cells.

[0414] As a control, using the same method, activated T cells were infected with CD19 CAR-P2A-wtPD-L1 lentivirus obtained from Example 3, and the obtained T cells expressing CD19-CAR and full-length wtPD-L1 are referred to as PDL1-CAR cells in this application.

[0415] Example 6: Preparation of a universal CART for T cell electroporation and flow cytometry

[0416] To prepare universal CAR-T cells (also known as UCART), the target genes TRAC, HLA-A, HLA-B, CIITA, and PD-1 were knocked out from the TrPDL1-CART cells or PDL1-CART cells prepared in Example 5.

[0417] Collect and count TrPDL1-CART or PDL1-CART cells. Before electroporation, gently mix the cells with electroporation buffer and RNP (ribonucleoprotein complex, the main component of which is a complex formed by Cas9 protein and sgRNA prepared in Example 1). After electroporation, culture the mixture in preheated medium. Every 2 days after electroporation, sample and count the cells, recording key parameters such as cell viability, total viable cell count, and cell diameter. After 7 days of culture, assess the knockout efficiency of relevant genes.

[0418] The resulting TrPDL1-CART cells, which have had the above target genes (TRAC, HLA-A, HLA-B, CIITA, and PD-1) knocked out, are called TrPDL1-UCART cells. The resulting PDL1-CART cells, which have had the above target genes (TRAC, HLA-A, HLA-B, CIITA, and PD-1) knocked out, are called PDL1-UCART cells.

[0419] On day 7 after electroporation, the expression of HLA-A, HLA-B, HLA-DR, and CD3 in sufficient numbers of native T cells, TrPDL1-CART obtained from Example 5, and TrPDL1-UCART obtained from this example was detected by flow cytometry. The test antibody was diluted with staining buffer in the dark according to the recommended dilution ratios shown in the table below.

[0420] Table 5. Antibodies used in this embodiment

[0421] The results showed that the above genes were effectively knocked out in TrPDL1-UCART cells, and the positive expression rates of HLA-A, HLA-B, HLA-DR and CD3 decreased to 25.38%, 4.67%, 23.85% and 23.83%, respectively. The experimental results are shown in Table 6 below.

[0422] Table 6. Positive rates of HLA-A, HLA-B, HLA-DR, and CD3 expression in cells

[0423] Example 7: Enrichment of CD3-negative cells

[0424] To enrich CD3-negative cells, the TrPDL1-UCART cells obtained in Example 6 were resuspended at an appropriate density with a suitable amount of enrichment buffer, and then anti-human CD3 magnetic beads were added in proportion to the total number of cells. CD3-negative cells were then enriched by magnetic bead column chromatography. A suitable amount of purified cells was taken for flow cytometry to detect the CD3 positivity rate, and the remaining cells were incubated overnight at 37°C / 5% CO2. Table 7 below shows the enrichment results detected by flow cytometry.

[0425] Table 7. Positive rate of CD3 expression in cells

[0426] The results showed that the CD3 positivity rate was 25.6% before enrichment (i.e., 25.6% of TrPDL1-UCART cells expressed CD3), which decreased to 0.36% after enrichment (i.e., only 0.36% of enriched TrPDL1-UCART cells expressed CD3). This indicates that the purity of CD3-negative TrPDL1-UCART cells was greatly improved.

[0427] Example 8: Cytotoxicity assay of TrPDL1-CART and TrPDL1-UCART

[0428] To test the cytotoxicity of TrPDL1-UCART, CD3-enriched CD3-negative TrPDL1-UCART cells obtained in Example 7 were used as effector cells, and Raji cells (B cells) expressing luciferase were used as target cells in a cell killing assay. As a control, natural T cells or TrPDL1-CART cells obtained in Example 5 were used as effector cells in a parallel control experiment using the same target cells.

[0429] Obtain sufficient effector cells and target cells, and dilute the effector cells to 4.0 × 10⁻⁶. 6 The target cells were diluted to a density of 2.0 × 10⁶ cells / mL. 5The density was measured at cells / mL. The expression rate of anti-CD19 CAR in TrPDL1-CART was 63.05%, and the expression rate of anti-CD19 CAR in TrPDL1-UCART was 75.58%. To ensure that the level of anti-CD19 CAR in these cells was comparable, the volume of TrPDL1-CART and TrPDL1-UCART cells was further adjusted by diluting TrPDL1-UCART at a ratio of 1:1.19.

[0430] Then, TrPDL1-CART and TrPDL1-UCART effector cells were further diluted with X-VIVO complete medium according to gradients of 20:1, 15:1, 10:1, 5:1, 2:1 and 1:1.

[0431] Effector cells (native T cells, TrPDL1-CART, or TrPDL1-UCART) were mixed with target cells at a ratio of 50 μL / well: 50 μL / well. After 24 and 48 hours of culture, 100 μL / well of luciferase substrate was added, and the OD value was read using a microplate reader to detect luciferase activity in the cells.

[0432] result( Figure 4A and Figure 4B The results showed that TrPDL1-CART and TrPDL1-UCART could significantly kill target cells, and the killing effect increased with the increase of effector-to-target ratio (E:T), indicating that the CART and UCART cells expressing truncated PD-L1 constructed according to the present invention have good cytotoxicity to target cells.

[0433] Example 9: ELISA detection of IFN-γ and TNF-α secreted by TrPDL1-CART and TrPDL1-UCART

[0434] To test cytotoxicity, TrPDL1-UCART cells were used as effector cells, and Raji cells (B cells) expressing luciferase were used as target cells. The release of cytokines TNF-α and IFN-γ was detected after 24 hours of incubation between effector and target cells. As controls, parallel control experiments were performed using native T cells or TrPDL1-CART cells obtained from Example 5 as effector cells.

[0435] After co-culturing for 24 hours, the cell supernatant was transferred to a new centrifuge tube, centrifuged to remove cell debris, and the supernatant was used to detect TNF-α and IFN-γ by ELISA.

[0436] result( Figure 5A and Figure 5BThe results showed that both TrPDL1-CART and TrPDL1-UCART could significantly release TNF-α and IFN-γ after co-culturing with target cells, indicating that the universal CAR-T cells constructed according to the present invention have normal cytokine expression capabilities.

[0437] Example 10: MLR (Mixed Lymphocyte Reaction) Experiment Using Allogeneic PBMCs

[0438] To evaluate whether CAR-T cells expressing truncated PD-L1 (TrPDL1) can reduce immune rejection from the immune system in an allogeneic host, a mixed lymphocyte reaction experiment was performed, in which peripheral blood mononuclear cells (PBMCs) from an allogeneic individual were used as effector cells and CAR-T cells expressing truncated PD-L1 (TrPDL1) were used as target cells.

[0439] Different target cells were tested, including: 1) native T cells; 2) TrPDL1-B2M- / --CART cells; 3) TrPDL1-CART cells (prepared in Example 5); and 4) TrPDL1-UCART cells (prepared in Example 6, CD3-negative cells enriched in Example 7).

[0440] TrPDL1-B2M was prepared using a method similar to that described in Example 6. - / - -CART cells. In short, TrPDL1-CART cells obtained in Example 5 were knocked out using sgRNA targeting B2M, and the knockout efficiency was detected using a method similar to that shown in Example 6. The results showed that TrPDL1-B2M - / - The expression rate of B2M in CART cells was 2.25%.

[0441] The mixed lymphocyte reaction between the above target cells and allogeneic PBMCs was carried out as follows.

[0442] Effector cell preparation: Allogeneic monocytes and PBMCs were centrifuged at 1200 rpm and counted, washed with PBS and resuspended. The cell density was adjusted to 2 × 10⁶ cells / year. 5 Units / mL are available for use.

[0443] Preparation of target cells: Native T cells, TrPDL1-B2M- / --CART cells, TrPDL1-CART cells, and TrPDL1-UCART cells were subjected to 2 Gy radiation to disrupt their proliferative capacity, then stained with 5 μM cell proliferation dye CFSE at room temperature for 15 minutes, and the cell density was adjusted to 2 × 10⁻⁶ cells / year. 5 Units / mL are available for use.

[0444] Mixed lymphocyte reaction: Stained target cells and allogeneic PBMCs were co-cultured in a 96-well plate at an appropriate ratio, and the cells were collected after 24 hours of culture.

[0445] CD45 was measured by flow cytometry. + CFSE + The proportion of double-positive cells is used to calculate the efficiency of target cell removal in mixed lymphocyte reactions. If allogeneic PBMCs exhibit immune rejection of target cells, the target cells will lyse, their cell membranes will rupture, and CFSE fluorescence on the target cell surface will become undetectable. CD45 is a panleukocyte marker used to locate leukocytes and exclude non-leukocytes in PBMCs, thereby improving the accuracy of target cell localization.

[0446] The experimental results are shown in Table 8 below. The results indicate that when TrPDL1-UCART is co-cultured with PBMCs from allogeneic individuals, it can significantly inhibit immune rejection from allogeneic PBMCs, thereby preventing clearance by allogeneic PBMCs. Conversely, TrPDL1-B2M... - / - - CAR-T cells and TrPDL1-CAR-T cells were still removed by allogeneic PBMCs. This indicates that TrPDL1-CAR-T significantly reduces immune rejection against allogeneic cells and is significantly more effective than universal CAR-T cells with B2M knockout alone.

[0447] Table 8

[0448] Example 11: The role of PD-1 in the effect of TrPDL1-UCART and PDL1-UCART cells on B cells

[0449] Both PD-1 and PD-L1 can mediate inhibitory signaling against T cells. The full-length PD-L1 sequence contains an intracellular domain. To investigate whether truncating the PD-L1 intracellular domain reduces inhibitory signaling delivered to T cells upon PD-L1 activation, we compared cell proliferation and cytotoxicity in UCAR-T cells expressing full-length wtPD-L1 and those expressing truncated PD-L1 (TrPDL1) in the presence of PD-1-expressing cells.

[0450] Preparation of effector cells: CD19-bound TrPDL1-UCART cells and PDL1-UCART cells were prepared according to Example 6, then stained with 5 μM cell proliferation dye CFSE at room temperature for 15 minutes, and the cell density was adjusted to 2 × 10⁻⁶ cells / year. 5 / mL for later use.

[0451] Preparation of target cells: Raji-luciferase cells (B cells) expressing PD-1 were obtained by recombinantly expressing human PD-1 on the Raji-luciferase cells provided in Example 8. Raji-luciferase cells also naturally express CD19. The cell density was adjusted to 2 × 10⁶ cells / year. 5 Units / mL are available for use.

[0452] Mixed lymphocyte reaction: The effector cells and target cells prepared above were mixed in an appropriate ratio and cultured in 96-well culture plates. Cells were collected at 0 hours, 24 hours, 48 ​​hours and 72 hours, respectively.

[0453] The ratio of CFSE+ positive cells to CD19 positive cells was measured by flow cytometry to assess the efficiency of effector cell proliferation and target cell removal in mixed lymphocyte responses.

[0454] The results are shown in Tables 9 and 10 below. The results indicate that in the presence of cells expressing PD-1, PDL1-UCART cells expressing full-length PD-L1 were significantly inhibited in both proliferation and target cell cytotoxicity, with proliferation only 1-fold after 72 hours and a target cell killing effect of less than 40%. Conversely, UCART cells expressing truncated PD-L1 (TrPDL1) not only maintained high cell proliferation (more than 17-fold increase after 72 hours) but also exhibited significant target cell killing, with 99% target cell killing observed after 72 hours. This suggests that truncated PD-L1 (TrPDL1) can significantly reduce PD-L1-mediated inhibition after PD-1 conjugation and can greatly improve UCART cell proliferation and cytotoxicity.

[0455] Table 9

[0456] Table 10

[0457] Example 12: Evaluation of UCART without PD-1 knockout

[0458] We further tested the proliferation and cytotoxicity of UCAR-T cells expressing truncated PD-L1 with and without PD-1 knockout.

[0459] Effector cell preparation: TrPDL1-UCART cells, in which PD-1 was knocked out and truncated PD-L1 (TrPDL1) was expressed, were prepared according to the method described in Example 6. PD-1 knockout-free TrPDL1-UCART variant cells, expressing both PD-1 and truncated PD-L1, were prepared using a similar method described in Example 6, and were designated PD-1+TrPDL1-UCART. Both TrPDL1-UCART and PD-1+TrPDL1-UCART cells were stained with 5 μM cell proliferation dye CFSE at room temperature for 15 minutes, and the cell density was adjusted to 2 × 10⁶ cells / year. 5 Units / mL are available for use.

[0460] Preparation of target cells: The cell density of the Raji-luciferase cells (B cells) provided in Example 8 was adjusted to 2 × 10⁻⁶. 5 Cells / mL are available for use. This cell also naturally expresses CD19.

[0461] Mixed lymphocyte reaction: The effector cells and target cells described above were mixed in an appropriate ratio in a 96-well culture plate, and 100 μL of the target cell and effector cell suspension was added to each well, with 3 replicates per group. The cells were cultured in a 37°C / 5% CO2 incubator, and collected at 0, 24, 48, and 72 hours.

[0462] The ratio of CFSE-positive effector cells to CD19-positive target cells was measured by flow cytometry to assess the efficiency of effector cell proliferation and target cell clearance in mixed lymphocyte responses. The results are shown in Tables 11 and 12 below.

[0463] Table 11

[0464] Table 12

[0465] The results showed that when UCART cells expressed PD-1 and PD-L1, their cell proliferation and cytotoxicity were significantly inhibited, with a 1.88-fold increase in proliferation after 72 hours and less than 50% cytotoxicity to target cells. Since the target cells used in this experiment did not express PD-1, it is speculated that the interaction between PD-1 expressed on one UCART cell and PD-L1 expressed on another UCART cell led to the autoinhibition of proliferation and cytotoxicity in UCART cells expressing both PD-1 and PD-L1.

[0466] Conversely, when PD-L1-expressing UCART cells were knocked out of PD-1, they not only maintained high cell proliferation (more than 11-fold increase after 72 hours), but also exhibited significantly increased cytotoxicity, killing target cells with 99% efficacy within 72 hours. This indicates that knocking out endogenous inhibitory immune checkpoint molecules on UCART cells, while simultaneously expressing the ligand of the knocked-out checkpoint on UCART cells, can significantly improve UCART cell proliferation and cytotoxicity, and avoid self-inhibition among UCART cells.

[0467] The following examples relate to the treatment of scleroderma, immune-mediated necrotizing myopathy (IMNM), and systemic lupus erythematosus (SLE), respectively. Baseline information of the candidates enrolled in the following studies is shown in Tables 13-1 and 13-2.

[0468] A total of 13 participants were enrolled, including 6 patients with refractory scleroderma, 5 patients with refractory SLE, and 2 patients with refractory IMNM. Among these participants, 4 were male and 9 were female. The mean age of the participants was 41 years (range: 18–63 years), the mean weight was 59.3 kg (range: 35.0–92.0 kg), and the median disease duration was 7 years (range: 1–20 years). All participants had received at least one prior immunosuppressive therapy with no response or poor response, including glucocorticoids, hydroxychloroquine, mycophenolate mofetil, tacrolimus, cyclophosphamide, azathioprine, tocilizumab, methotrexate, telitacicept, belimumab, and rituximab. Baseline characteristics are summarized in Table 13.

[0469] Table 13-1 Subject Baseline

[0470] Table 13-2 Subject Baseline

[0471] The pretreatment and administration methods for lymphocyte clearance are as follows: Lymphocyte clearance pretreatment Candidate subjects were evaluated prior to lymphocyte depletion pretreatment. Eligible subjects were enrolled on day 5 before the first injection of UCART cells prepared according to the method described in Example 6.

[0472] The lymphocyte clearance protocol is as follows: Fludarabine: 25 mg / m 2 Intravenous infusion, on days 3, 4, and 5, for a total of 3 days; Cyclophosphamide: 300 mg / m 2 Intravenous infusion, on days 4 and 5, for a total of 2 days.

[0473] Alternatively, the dosage of fludarabine and cyclophosphamide in the regimen can be adjusted based on the absolute value of peripheral blood lymphocytes.

[0474] After lymphocyte clearance pretreatment, UCART treatment evaluation is performed.

[0475] UCART treatment

[0476] Subjects who passed the assessment received a single intravenous infusion of UCART on day 0 and were hospitalized for at least 7 days. All subjects received fludarabine 25 mg / m². 2 × 3 days and cyclophosphamide 300 mg / m 2 After lymphocyte clearance for 2 days, at 1.0 × 10 6 The dose received was 10 cells / kg via UCART, with a mean total infusion dose of 59.34 × 10⁻⁶. 6 Cells (range: 36.50 × 10) 6 - 91.26 × 10 6 (cells). The DLT observation period begins on the day of infusion and ends on day 30 after infusion.

[0477] Example 13: Evaluation of UCART treatment for scleroderma

[0478] Treatment response assessment

[0479] like Figure 8A and Figure 8B As shown, the number of B cells decreased, while the number of UCART cells and CAR copies increased significantly. Simultaneously, the secretion level of the cytokine IL-6 was low during treatment.

[0480] result

[0481] All subjects achieved a Systemic Sclerosis Comprehensive Response Index (CRISS) score greater than 0.6 two months after administration, with 83.3% (5 / 6) reaching 0.99, indicating significant improvement in all subjects. Forced vital capacity (FVC) percentage improved in 83.3% (5 / 6) of subjects compared to baseline. Modified Rodnan Skin Score (mRSS) significantly decreased in all subjects (100%, 6 / 6) compared to baseline, and Physician Overall Assessment (PGA) also improved. HAQ-DI score decreased in 66.6% (4 / 6) of subjects compared to baseline. These results demonstrate that UCART elicits a good overall response in scleroderma patients and significantly improves their clinical symptoms and indicators. Figure 9 Significant improvement was observed in the involvement of the skin, lungs, and other organs. Figures 10A-10CAt the start of cell therapy, all subjects had discontinued immunosuppressants, and glucocorticoid doses were gradually reduced from high daily doses (mean: 11.1 mg / day, range: 4–20 mg / day) to low daily maintenance levels (mean: 4.9 mg / day, range: 0–15 mg / day).

[0482] For subjects Sd-01 and Sd-02, skin elasticity was further measured by wave elastography at month 18. The elastography color map showed that the tissue changed from predominantly hard (red) tissue to softer (blue) tissue, indicating a decrease in stiffness. At month 1, the skin elasticity of the thighs of both patients was normal. Figure 10A The severity of interstitial lung disease (ILD) was assessed using chest computed tomography (CT), pulmonary function tests, and serum KL-6 concentration. Improvement in ILD with Sd-01 was demonstrated by an increase in FVC from 43.7% to 55% at month 3. Figure 9 Sd-01's chest high-resolution CT (HRCT) axial and coronal scans showed multiple patchy and linear shadows in both lungs, accompanied by interlobular septal thickening. Figure 10B This suggests diffuse inflammatory exudation. At months 3 and 6, a significant reduction in bilateral lung inflammation, interlobar effusion, and fibrous strands was observed. KL-6 decreased from 605 U / mL at baseline to 203 U / mL at month 3. Figure 9 For Sd-02, HRCT scan showed linear fibrous opacities and ground-glass opacities in the posterior basal segment of the right lower lobe, suggesting diffuse inflammatory exudation within the alveoli of the right upper lobe. Right pneumonia almost completely resolved by month 1 and remained at a low level in months 3 and 6.

[0483] Cardiac function was assessed by echocardiography for Sd-01 and Sd-02. Cardiac fibrosis was measured by cardiac magnetic resonance (CMR). For Sd-01, baseline CMR T2-weighted inversion recovery images and mid-mural banded LGE showed localized left ventricular wall edema with fibrosis, which had resolved by month 3. Figure 10B For Sd-02, baseline CMR showed elevated intrinsic T1 values ​​of the left ventricular lateral wall, suggesting acute myocardial injury, which improved at months 3 and 6. Figure 10C Following UCART intervention, T1 mapping values ​​decreased in all myocardial segments in both patients, suggesting a reduction in cardiac fibrosis. Figure 10C ).

[0484] Example 14: Evaluation of UCART treatment for refractory immune-mediated necrotizing myopathy (IMNM)

[0485] Treatment response assessment

[0486] like Figure 11A , Figure 11B and Figure 11C As shown, the number of B cells decreased, while the number of UCART cells and CAR copy numbers increased significantly. Simultaneously, the secretion level of the cytokine IL-6 was low during treatment.

[0487] Treatment response to UCAR T-cell therapy was assessed at baseline and follow-up time points using the Total Improvement Score (TIS). This is a composite response standard based on improvement in six validated core indicators (CSMs), including Physician General Activity (PGA), Patient General Activity (PtGA), Manual Muscle Strength Test (MMT), Health Assessment Questionnaire (HAQ), and Extramuscular Activity (EMDA). Response was defined as an increase in the subject's activity relative to baseline by improvement category (minimum ≥20, moderate ≥40, major ≥60). Extramuscular organ activity, such as systemic, cutaneous, skeletal, gastrointestinal, pulmonary, and cardiac systems, was assessed using the Disease Activity Assessment Tool for Myositis (MDAAT). Muscle inflammatory infiltration was assessed by MRI and thigh muscle biopsy. Anti-SRP autoantibody levels were measured using quantitative Western blot analysis and then adjusted for serum IgG concentrations at each time point. Figure 11A , Figure 11B , Figure 11C , Figure 12A , Figure 12B and Figure 13 ).

[0488] In summary, during the evaluation period, muscle biopsy showed signs of IMNM, with muscle fibers of varying sizes, scattered necrotic and regenerating muscle fibers, increased nuclear fibers, mild to moderate endothelial hyperplasia, and no obvious inflammatory cell infiltration in the intermuscular tissue.

[0489] Clinical results

[0490] Subject IMNM-01 was diagnosed with signal recognition particle (SRP)-IMNM, characterized by the presence of anti-SRP autoantibodies targeting the signal recognition particles, biopsy showing skeletal muscle necrosis and atrophy, and elevated serum muscle enzyme levels. IMNM-01 showed sustained improvement after receiving UCART treatment. Specifically, subject IMNM-01's Total Improvement Score (TIS) increased from 72.5 at baseline to 100 after one month of treatment and remained at that score during subsequent follow-up. Simultaneously, creatine kinase (CK) levels decreased from an initial 2295 U / L to 1383 U / L at one month, further decreased to 606 U / L at two months, and reached 234 U / L at three months, approaching the normal range. Physician Overall Assessment (PGA) and Patient Overall Disease Activity Assessment (PtGA) also showed significant improvement from baseline after three months of treatment. Muscle strength was assessed using the Manual Muscle Testing-8 (MMT-8) test. Results showed improvement from a baseline score of 75 (out of 150) to 85 at 1 month, 117 at 2 months, and 145 at 3 months. Quality of life also significantly improved; the Health Assessment Questionnaire-Disability Index (HAQ-DI) score decreased from 2 at baseline to 1.75 at 1 month, and further to 0.25 at 3 months. Two months after treatment, extramuscular disease activity significantly decreased from 7 to 1, and continued to improve during follow-up. Anti-SRP antibodies decreased from 331 U / L at baseline to undetectable levels one month after treatment, and remained undetectable even after B cells returned to normal at M6. Figure 14 ).

[0491] STIR sequences on magnetic resonance imaging (MRI) showed a significant reduction in myositis inflammation, marked muscle regeneration, and complete resolution of interstitial pneumonia at 3 months compared to baseline. Figure 15 The subject had been bedridden for many years prior to treatment and regained independent walking and self-care abilities after receiving UCART. All immunosuppressants were discontinued at the start of cell therapy, and the hormone therapy dose was reduced from 100 mg / day before cell infusion to 20 mg / day. Notably, after 8 months of treatment, the subject exhibited elevated levels of creatine kinase and anti-SRP antibodies without experiencing discomfort or requiring an increase in glucocorticoid dosage. These indicators decreased the following month, indicating sustained treatment benefit.

[0492] These pathological changes significantly improved after CAR T therapy. Compared with before treatment, there were almost no new damaged muscle cells, very little inflammatory cell infiltration, and a significant reduction in SRP expression.

[0493] Example 15: Evaluation of UCART treatment for refractory systemic lupus erythematosus (SLE)

[0494] result

[0495] Physician Overall Assessment (PGA) scores of 4 subjects were significantly reduced from baseline. 100% (4 / 4) of subjects achieved an SRI-4 response, with a significant decrease in their Systemic Lupus Erythematosus Disease Activity Index (SLEDAI-2000 or SELEN-SLEDAI) scores from baseline. Specifically, 3 subjects' SLEDAI scores decreased from 18, 14, and 14 at baseline to 0 at M3 or M6, and 1 subject's SLEDAI score decreased from 10 at baseline to 2 at M6. All subjects showed varying degrees of improvement in the British Isles Lupus Assessment Group 2004 (BILAG-2004) index, significant reductions in ds-DNA and anti-SM antibodies from baseline, and significant increases in complement C3 and C4 from baseline. For the 3 subjects with high proteinuria levels who were followed up for 6 months, their urine protein / creatinine ratio (UPCR) or 24-hour proteinuria significantly improved, all achieving complete remission at 6 months. These results indicate that UCART has a positive overall response in SLE patients, with significant improvements in clinical symptoms and laboratory tests. Figure 16 and Figure 17 At the start of cell therapy, all subjects had discontinued immunosuppressants, and the glucocorticoid dose was gradually reduced from a high daily dose of 13.1 mg / day (range: 10-20 mg / day) to a low daily maintenance level of 4.6 mg / day (range: 2.5-10 mg / day).

[0496] Example 16: Evaluation of B cell cytotoxic activity in healthy donor PBMCs using UCART

[0497] Multiple PBMC samples were collected from healthy donors. The total number of PBMCs was calculated based on cell counts. An incubation system was prepared. CD19 magnetic beads were added to sort B cells. TrPDL1-UCART obtained in Example 6 was used as effector cells for cell killing experiments.

[0498] The sequences used in this invention are as follows Figure 7 As shown.

[0499] Example 17: Pharmacokinetic and Pharmacodynamic Analysis

[0500] 17.1. Pharmacokinetic Analysis

[0501] UCART amplification and persistence in subjects were monitored by flow cytometry and qPCR. Following UCART infusion, cell amplification occurred in all subjects, with peak peripheral blood levels primarily occurring between 7 and 14 days. The peak CAR-T cell concentration (mean ± standard deviation) for all 13 subjects was 79.94 ± 119.43 cells / μL. In most subjects, the percentage and count of CAR-T cells significantly increased after UCART infusion, indicating successful amplification of the implanted CAR-positive cells in vivo and their potential to sustain long-term B-cell depletion. At follow-up of 1, 2, and 3 months, CAR-positive cell counts gradually decreased, with mean percentages of 9.10%, 2.51%, and 0.79%, and mean counts of 42.02 cells / μL, 27.80 cells / μL, and 18.85 cells / μL, respectively. For the IMNM-01 subject followed up to 9 months, the CAR-positive cell counts at months 6 and 9 were 53.75 cells / μL and 16.07 cells / μL, respectively. Figure 18-19 qPCR showed that after UCART infusion, in vivo CAR copy number and CAR-positive cell count showed a consistent trend, with peak levels occurring between 7 and 14 days. The peak CAR copy number in 12 subjects was 15,170 ± 33,207 copies / μg. CAR copy number gradually decreased at follow-up of 1, 2, and 3 months. Figure 20 The results indicate that UCART can persist in vivo.

[0502] 17.2. Pharmacodynamic Analysis

[0503] Consistent with the in vivo expansion data of UCART, except for one subject with a shorter observation period, 12 subjects experienced a significant reduction in B cells within 7 days after UCART infusion, reaching near-complete depletion by day 7, which coincides with the in vivo expansion time of CAR-T cells. B cell depletion persisted until month 2 or 3, after which B cells gradually recovered. For subject Sd-01, the B cell count was low at baseline (5 cells / μL) and persisted until month 6. At the month 6 follow-up, this subject's B cell count had gradually recovered to 74 cells / μL. In summary, CAR-T cell expansion following UCART infusion led to significant and persistent depletion of B cells in the peripheral blood of the subjects. Figure 21-22 ).

[0504] Example 18: Security Analysis

[0505] The median follow-up time after UCART administration was 148 days (range: 7–293 days). Safety data showed that all subjects receiving UCART tolerated the treatment well. There were no treatment interruptions or withdrawals due to adverse events (AEs), no grade ≥2 CRS, no ICANS, and no GvHD. Most AEs in the study were mild to moderate in severity, indicating manageable safety.

[0506] 18.1. Adverse Events

[0507] Based on the summary of adverse events (AEs) in the study, the top three state-of-the-art (SOC) AEs among the 13 subjects were examinations (56.51%), metabolic and nutritional disorders (16.86%), and hematologic and lymphatic disorders (9%). In terms of severity, most AEs (79%) were mild to moderate (CTCAE: grade 1-2). The clinical manifestations of AEs observed in the study were mainly hematologic toxicity caused by lymphocyte-clearing drugs and common complications in subjects with autoimmune diseases. Following clinical observation or symptomatic treatment, most AEs (72%) recovered or resolved within an average of 12 days after UCART infusion.

[0508] 18.2. Adverse Events of Special Concern (AESI)

[0509] Regarding adverse events (AEs) associated with CAR-T cell therapy, UCART had a very good safety profile in 13 subjects with refractory autoimmune diseases. Only 2 subjects with SLE experienced grade 1 CRS, and no serious infections (grade 3 / 4), ICANS, or GvHD were observed in the 13 subjects.

[0510] 18.3.CRS

[0511] In this study, only two patients with refractory SLE (SLE-04 / SLE-05) developed grade 1 CRS on days 4 and 5, respectively, with clinical manifestations of fever (body temperature as high as 39.1°C). The other vital signs were stable, and there was no hypotension or hypoxemia.

[0512] Overall, UCART was well tolerated in subjects with refractory autoimmune diseases. Of the 13 subjects treated with UCART, only 2 experienced Grade 1 CRS; no ICANS or GvHD were observed in any subjects. Although B cells began to deplete gradually from day 6 to 8 after UCART infusion, no treatment-related hypogammaglobulinemia or serious infections were observed in this study, suggesting a better safety profile for UCART in subjects with refractory autoimmune diseases compared to the toxicities reported with CAR-T cell therapies for hematologic malignancies. Furthermore, a review of AEs observed during the program revealed that the most common AEs were primarily hematologic toxicities and laboratory abnormalities, consistent with known adverse reactions to lymphocyte-clearing drugs and complications of autoimmune diseases. AEs that may be associated with UCART during the study, such as decreased lymphocyte and leukopenia, were mostly reversible after symptomatic treatment.

[0513] in conclusion

[0514] Regarding efficacy, one patient with idiopathic myopathy showed sustained improvement during the 9-month monitoring period following UCART treatment. All four SLE participants achieved an SRI-4 response after treatment. All six scleroderma participants had CRISS scores greater than 0.6 three months after treatment; five of them showed improvement in FVC percentage compared to baseline; and all six participants showed a significant decrease in modified Rodnan skin score (mRSS) compared to baseline, indicating significant improvement in all participants.

[0515] Furthermore, UCART cells exhibited sustained and stable expansion in treated subjects, reaching a significant peak around day 14, and remained detectable in peripheral blood up to 3 months post-treatment. Consistent with in vivo pharmacokinetic (PK) data for UCART, except for one subject with a shorter observation period, 12 subjects experienced a significant reduction in B cells within 7 days of UCART infusion, achieving near-complete depletion by day 7. This depletion persisted for approximately two months, indicating that sustained and profound B cell depletion was achieved in subjects with refractory autoimmune diseases as UCART expanded in vivo.

[0516] The results of this IIT study demonstrate that UCART achieved rapid, significant, and durable expansion in subjects, accompanied by deep and sustained B-cell depletion. Subjects experienced mild adverse reactions during treatment and tolerated UCART well. Clinical assessments showed significant improvement in all subjects with refractory scleroderma, systemic lupus erythematosus, and myositis, achieving serological remission and recovery of organ function.

Claims

1. A method for preventing and / or treating a condition and / or disease in a subject in need, comprising administering to the subject an effective amount of modified cells and / or a pharmaceutical composition comprising therethe; The condition or disease mentioned therein is a condition or disease of diffuse connective tissue disease or malignant tumor of the lymphatic system; in, Compared to the unmodified corresponding cell, the modified cell: Lack of endogenous major histocompatibility complex and endogenous inhibitory checkpoint molecules; The ligands were modified to express inhibitory checkpoint molecules; The ligand therein is a variant of the ligand that has an enhanced ability to induce immunosuppressive signal transduction relative to its homologous ligand.

2. The method according to claim 1, wherein the modified cell is derived from any one or a combination of autologous cells and stem cells; the somatic cells are preferably immune cells; And / or, the modified cells are animal cells or human cells; Preferably, the modified cells are allogeneic relative to the subject's cells.

3. The method according to claim 1 or 2, wherein the unmodified cell is an immune cell, and the immune cell is any one or a combination of T cells, natural killer cells, NKT cells, B cells, macrophages, monocytes, dendritic cells, and neutrophils; or, The unmodified cells are stem cells, and the stem cells are hematopoietic progenitor cells, hematopoietic stem cells, CD34+ cells, embryonic stem cells, mesenchymal stem cells, or iPSC cells. Preferably, the T cell is any one or a combination of αβ T cells, γδ T cells, helper T cells, and regulatory T cells; and / or, the T cell is an activated T cell.

4. The method according to any one of claims 1-3, wherein the endogenous major histocompatibility complex is a human major histocompatibility complex or a mouse major histocompatibility complex; Preferably, the human major histocompatibility complex comprises human leukocyte antigen class I; and / or, the mouse major histocompatibility complex comprises histocompatibility-2 class I molecules; More preferably, the gene for human leukocyte antigen class I is HLA-A, HLA-B, HLA-C, HLA-E or a combination thereof; and / or, the gene for histocompatibility-2 class I is H-2K, H-2D or a combination thereof.

5. The method according to any one of claims 1-4, wherein the endogenous inhibitory checkpoint molecule is any one or more of PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), CTLA-4 (CD152), IDO1, IDO2, TDO, KIR, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329); And / or, the ligand is any one or more of PD-L1, PD-L2, HMGB1, Ceacam-1, phosphatidylserine (PS), LSECtin, α-synuclein, FGL1, adenosine, HVEM (herpesvirus entry mediator), CD28, B7-H3 (CD276), B7-H4 (VTCN1), PVR (CD155), HLA class I, sialic acid glycoprotein, CD112, CD113, galactolectin 9, CD24, and CD47.

6. The method according to any one of claims 1-5, wherein the variant comprises at least one mutation that increases the ability to induce immunosuppressive signaling; Preferably, the mutation is any one of substitution, deletion, insertion, or any combination thereof; More preferably, the mutation is the deletion of at least one amino acid residue.

7. The method according to any one of claims 1-6, wherein the variant lacks at least a portion of the extracellular domain, transmembrane domain, and / or intracellular domain relative to the homologous inhibitory checkpoint molecule or its ligand; Preferably, the inhibitory checkpoint molecule is PD-1; and its ligand is PD-L1; More preferably, the variant of the ligand has the amino acid sequence of SEQ ID NO: 7 or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identity with SEQ ID NO:

7.

8. The method according to any one of claims 1-7, wherein the modified cells are further modified to include a chimeric antigen receptor or a T-cell receptor; Preferably, the CAR includes an antigen-binding domain, a transmembrane domain, and an intracellular signal transduction domain; more optionally, the CAR also includes a co-stimulatory signal transduction region. More preferably, the antigen is selected from BCMA, CD7, CD10, CD19, CD20, CD22, CD24, CD30, CD33, CD34, CD38, CD44, CD79a, CD79b, CD123, CD138, CD179b, CEA, CLEC12A, Claudin18.2, CS-1, DLL3, EGFR, EGFRvIII, EPCAM, FLT-3, FOLR1, FOLR3, GD2, gpA33, GPC3, HER2, HM1.24, LGR5, mesothelin, MSLN, MCSP, MICA / B, PSMA, PAMA, P-cadherin, and ROR1; for example, the antigen is CD19.

9. The method according to any one of claims 1-8, wherein the modified cells or the pharmaceutical composition thereof may be administered alone or in combination; And / or, the diffuse connective tissue disease includes systemic lupus erythematosus (SLE), scleroderma, rheumatoid arthritis (RA), idiopathic inflammatory myopathy (IIM), Churg-Strauss syndrome, and microscopic polyangiitis; preferably, the idiopathic inflammatory myopathy includes polymyositis (PM), dermatomyositis (DM), amyopathy-free dermatomyositis (ADM), immune-mediated necrotizing myopathy (IMNM), inclusion body myositis (IBM), and juvenile dermatomyositis (JDM). And / or, the malignant tumors of the lymphatic system include B-cell lymphoma and B-cell leukemia; preferably, the B-cell lymphoma includes Hodgkin lymphoma (HL) and non-Hodgkin lymphoma (NHL), and the B-cell leukemia includes acute lymphoblastic leukemia (ALL) and chronic lymphoblastic leukemia (CLL).

10. The method according to any one of claims 1-9, wherein the modified cells are prepared and / or expanded under in vitro, in vivo, or ex vivo conditions; And / or, the subject in need is a subject who has received at least 1, 2, 3 or 4 immunosuppressive treatments; preferably, the treatment comprises one or more of the following: glucocorticoids, hydroxychloroquine, mycophenolate mofetil, tacrolimus, cyclophosphamide, azathioprine, tocilizumab, methotrexate, telitacicept, belimumab and rituximab.

11. A modified cell or a population thereof, wherein the modified cell is a modified cell as defined in any one of claims 1-10.

12. A polynucleotide targeting the major histocompatibility complex, wherein the polynucleotide is capable of inactivating or attenuating the expression of the major histocompatibility complex; Preferably, the major histocompatibility complex is a major histocompatibility complex class I; and / or, the polynucleotide comprises sgRNA; More preferably, the major histocompatibility complex is the human major histocompatibility complex. For example HLA-A, HLA-B, HLA-C and / or HLA-E; and / or, the sgRNA targets any one or more of the DNA sequences of SEQ ID NO: 29-45 and 73-168.

13. A method for producing the modified cells of claim 11, comprising the step of introducing the polynucleotide and gene editing system of claim 10 into the corresponding unmodified cells; Preferably, the gene editing system is a CRISPR system.

14. A pharmaceutical composition comprising (1) the modified cells of claim 11, and / or the polynucleotide of claim 12, and (2) a pharmaceutically acceptable carrier and / or excipient.

15. A kit comprising the modified cells of claim 11 or the pharmaceutical composition of claim 14.

16. The modified cells or populations thereof of claim 11, the polynucleotide of claim 12, the pharmaceutical composition of claim 14, and the kit of claim 15, for the prevention and / or treatment of symptoms and / or diseases of diffuse connective tissue disorders; Preferably, the diffuse connective tissue disease includes systemic lupus erythematosus (SLE), scleroderma, rheumatoid arthritis (RA), idiopathic inflammatory myopathy (IIM), Churg-Strauss syndrome, and microscopic polyangiitis; more preferably, the idiopathic inflammatory myopathy includes polymyositis (PM), dermatomyositis (DM), amyopathy-free dermatomyositis (ADM), immune-mediated necrotizing myopathy (IMNM), inclusion body myositis (IBM), and juvenile dermatomyositis (JDM). And / or, Preferably, the malignant tumors of the lymphatic system include B-cell lymphoma and B-cell leukemia; more preferably, the B-cell lymphoma includes Hodgkin lymphoma (HL) and non-Hodgkin lymphoma (NHL), and the B-cell leukemia includes acute lymphoblastic leukemia (ALL) and chronic lymphoblastic leukemia (CLL).

17. Use of the modified cells or populations thereof of claim 11, the polynucleotide of claim 12, the pharmaceutical composition of claim 14, and the kit of claim 15 in the preparation of a medicament for the prevention and / or treatment of symptoms and / or diseases of diffuse connective tissue disorders; Preferably, the diffuse connective tissue disease includes systemic lupus erythematosus (SLE), scleroderma, rheumatoid arthritis (RA), idiopathic inflammatory myopathy (IIM), Churg-Strauss syndrome, and microscopic polyangiitis; more preferably, the idiopathic inflammatory myopathy includes polymyositis (PM), dermatomyositis (DM), amyopathy-free dermatomyositis (ADM), immune-mediated necrotizing myopathy (IMNM), inclusion body myositis (IBM), and juvenile dermatomyositis (JDM). And / or, Preferably, the malignant tumors of the lymphatic system include B-cell lymphoma and B-cell leukemia; more preferably, the B-cell lymphoma includes Hodgkin lymphoma (HL) and non-Hodgkin lymphoma (NHL), and the lymphocytic leukemia includes acute lymphoblastic leukemia (ALL) and chronic lymphocytic leukemia (CLL).

Images