Kit and method for multiplex immune PCR

Abstract

The present invention relates to a kit for performing multiplex immune PCR. The product, the composition, the kit and the method for implementing the kit can be advantageously used for diagnosing non-alcoholic steatohepatitis (NASH).

Description

Technical Field

[0001] This invention relates to a kit for performing multiplex immunoassay PCR. The product, composition, kit, and method of administering the kit are advantageous for the diagnosis of non-alcoholic steatohepatitis (NASH). Background Technology

[0002] Nonalcoholic fatty liver disease (NAFLD) is a progressive liver disease that ranges from simple steatosis to nonalcoholic steatohepatitis (NASH). NASH is also a progressive liver disease characterized histologically by fatty acid accumulation, hepatocellular damage, and inflammation similar to that seen in alcoholic hepatitis. NASH is a key stage in the progression of liver disease, which can lead to cirrhosis, liver failure, and / or hepatocellular carcinoma (HCC). NASH is one of the most common causes of elevated transaminase levels in patients referred to a hepatologist for evaluation.

[0003] Because if a patient is diagnosed early enough, the disease can potentially be reversed or at least its consequences can be limited, it is crucial to provide the medical field with the appropriate tools that allow for such early, rapid, and accurate diagnosis.

[0004] However, patients with NASH are often asymptomatic before progressing to severe stages, making it difficult to diagnose NASH early and / or determine its activity, stage, or severity.

[0005] Despite several attempts to develop non-invasive methods for diagnosing and determining the activity, stage, or severity of NASH, histological analysis of liver biopsy remains the best method to date for differentiating NASH from early steatosis. However, liver biopsy has several significant drawbacks. First, the material collected from a liver biopsy represents only a very small portion of the liver of the diagnosed subject, thus raising questions about whether the collected sample represents the overall condition of the organ and whether it includes the variability known among and within hepatologists. Furthermore, liver biopsy is a highly invasive procedure that can be troublesome, distressing, and painful for patients, raising concerns about morbidity and mortality. Finally, given the foregoing, it is not reasonable to propose liver biopsy as a routine procedure for determining whether a person has significant liver fibrosis.

[0006] The limitations of liver biopsy-based diagnoses have led to the active development of non-invasive methods for detecting NASH. Several NITs (non-invasive tests) have been developed.

[0007] For example, WO2017046181 and WO2017167934 provide non-invasive diagnostic methods based on the measurement of circulating biomarker levels. These methods measure several independent circulating biomarkers (either proteins or miRNAs). Specifically, WO2017167934 describes a non-invasive NASH diagnostic method for measuring the levels of YKL-40 (or chitosanase 3-like protein 1, CHI3L1) and hsa-miR-34. In this method, biomarkers, particularly protein biomarkers and miRNA biomarkers, need to be measured separately by different assays, such as polymerase chain reaction (PCR) assays for detecting miRNA biomarkers and immunoassays, such as enzyme-linked immunosorbent assays (ELISA), for detecting protein biomarkers. To date, there are no methods that allow the simultaneous detection of miRNA and protein biomarkers in the same sample using the same and distinct platform.

[0008] Compared to ELISA, immunoPCR (IPCR) is a faster and more sensitive method for detecting proteins. ImmunoPCR relies on the use of antibodies conjugated to oligonucleotides. These oligonucleotides are then amplified by PCR, and the conjugate acts as a bridge between the immune reaction and DNA amplification. This method combines the versatility and robustness of immunoassays with the exponential signal amplification capabilities of PCR. Typically, IPCR allows for a 10-1,000-fold increase in sensitivity compared to similar ELISAs. However, improvements to IPCR devices are still needed to make them suitable for the simultaneous detection or quantification of miRNA biomarkers in single samples.

[0009] This invention provides a novel method for the simultaneous detection or quantification of miRNAs and proteins in a sample. This invention is particularly useful in the diagnosis of NASH and liver fibrosis. Summary of the Invention

[0010] The inventors have successfully developed a kit containing all the necessary components that allow simultaneous PCR for detecting nucleic acid targets and IPCR for detecting proteins in a single recipient. The inventors have also developed several oligonucleotides that do not interfere with any circulating human serum DNA / RNA and can be readily attached to specific antibodies against proteins of interest to be detected or quantified. Furthermore, the inventors have developed DNA-antibody conjugates containing the said nucleic acids and kits containing the conjugates and suitable components for performing multiplex PCR to simultaneously detect or quantify protein and nucleic acid targets.

[0011] In particular, the kit of the present invention provides a unique platform for performing diagnostic tests, offering several advantages over using multiple platforms or tests. Some of the key benefits are as follows:

[0012] 1. Standardization: A unique platform can provide standardization of testing procedures, which can help reduce variability in results due to differences in testing methods or equipment. This can improve the reliability and accuracy of diagnostic tests and improve patient outcomes.

[0013] 2. Efficiency: Using a single platform for diagnostic testing can improve laboratory efficiency by reducing the time and resources required for the maintenance, calibration, and training of multiple instruments. This can lead to faster turnaround times for test results, which is crucial for patients requiring urgent diagnostic or treatment decisions.

[0014] 3. Cost-effectiveness: A unique platform can also be cost-effective compared to using multiple tests or instruments. This can be especially important in resource-constrained environments where cost may be a barrier to accessing diagnostic tests.

[0015] 4. Integration: The unique platform can provide integration with electronic medical records and other laboratory systems, thereby improving the overall efficiency and quality of patient care.

[0016] 5. Flexibility: Depending on the specific platform, a unique platform can provide the flexibility to perform a wide range of tests, allowing for more comprehensive diagnostic testing from a single instrument.

[0017] In summary, unique platforms for diagnostic testing offer several advantages, including standardization, efficiency, cost-effectiveness, integration, and flexibility. These benefits can help improve the quality and efficiency of diagnostic testing, thereby improving patient outcomes.

[0018] In one specific embodiment, the kit of the present invention allows for the simultaneous detection and / or quantification of cyclic YKL-40 and hsa-miR-34 in a sample.

[0019] In one aspect, the present invention relates to nucleic acid molecules comprising or composed of oligonucleotides having the following sequences: sequences SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, or sequences having at least 90% identity with SEQ ID NO: 1, 2 or 3.

[0020] In one specific implementation, the nucleic acid molecule further includes a linker.

[0021] In another respect, the present invention relates to DNA-antibody conjugates comprising (i) the nucleic acid molecule of the present invention and (ii) an antibody against a protein of interest.

[0022] In one specific implementation, the antibody is an anti-YKL-40 antibody.

[0023] In another aspect, the present invention relates to an immunoPCR kit for detecting or quantifying protein targets, the kit comprising:

[0024] -The DNA-antibody conjugate of the present invention, and

[0025] - A pair of primers for amplifying the oligonucleotides of the DNA-antibody conjugate.

[0026] Specifically, the kit may further comprise a fluorescent nucleic acid probe that specifically binds to an oligonucleotide of a DNA-antibody conjugate. In a more particular embodiment, the probe has the sequence of SEQ ID NO: 4, 9, or 10.

[0027] The present invention also relates to the use of the aforementioned immunoPCR kit for detecting or quantifying protein target levels in a sample.

[0028] In another aspect, the present invention relates to a multiplex immunoPCR kit for the simultaneous detection or quantification of protein targets and nucleic acid targets, the kit comprising:

[0029] -The DNA antibody conjugate according to the present invention

[0030] -A pair of primers for amplifying the oligonucleotides of the DNA-antibody conjugate, and

[0031] - A pair of primers used to amplify nucleic acid targets.

[0032] In one specific implementation, the kit further comprises:

[0033] - Fluorescent nucleic acid probes that specifically bind to oligonucleotides of DNA-antibody conjugates, and

[0034] - A fluorescent nucleic acid probe that specifically binds to the amplification product of a nucleic acid target.

[0035] More specifically, the fluorescent nucleic acid probe that specifically binds to the oligonucleotide of the DNA-antibody conjugate may have the sequence of SEQ ID NO: 4, 9 or 10.

[0036] In one specific embodiment of the above aspect, the multiplex immunoPCR kit contains a pair of primers for amplifying miRNAs, particularly hsa-miR-34, more particularly hsa-miR-34a, and even more particularly hsa-miR-34a-5p.

[0037] In another specific embodiment of the above aspect, the DNA-antibody conjugate of the kit contains an anti-YKL-40 antibody.

[0038] In a more specific embodiment of the above aspects, the multiplex immunoPCR kit comprises:

[0039] -DNA antibody conjugate comprising anti-YKL-40 antibody and oligonucleotide of SEQ ID NO: 1,

[0040] -A pair of primers for amplifying oligonucleotides of DNA-antibody conjugates.

[0041] -A pair of primers for amplifying hsa-miR-34, more particularly hsa-miR-34a, and even more particularly hsa-miR-34a-5p.

[0042] In yet another, more specific embodiment, the multiplex immunoPCR kit described above further comprises:

[0043] Internal control for the PCR process.

[0044] - At least one positive control against hsa-miR-34, and / or

[0045] - At least one positive control for YKL-40.

[0046] The present invention also relates to the use of the above-described multiplex immunoPCR for detecting or quantifying the levels of protein targets and nucleic acid targets in samples, particularly for detecting or quantifying the levels of YKL-40 and hsa-miR-34 in samples.

[0047] The present invention also provides a method for quantifying the levels of protein targets and nucleic acid targets in a sample, the method comprising the following steps:

[0048] - To bring the sample into contact with the components of the multiplex immunoPCR kit of the present invention, and

[0049] - Perform multiplex immunoPCR to measure the levels of the protein target and the nucleic acid target.

[0050] The present invention also relates to a method for quantifying the levels of YKL-40 and hsa-miR-34 in a sample, the method comprising the following steps:

[0051] - To bring the sample into contact with the components of the multiplex immunoPCR kit of the present invention, and

[0052] - Perform multiplex immunoPCR to measure the levels of YKL-40 and hsa-miR-34.

[0053] Another aspect of the invention relates to a method for diagnosing nonalcoholic steatohepatitis (NASH) and / or for determining the activity, stage, or severity of NASH in a subject, and / or for classifying a subject as a recipient or non-recipient of NASH treatment, and / or for assessing the efficacy of medical treatment, and / or for determining the progression or regression of pathology in a NASH patient, and / or for classifying a patient as a potential responder or non-responder to medical treatment, by measuring the levels of circulating hsa-miR-34 and YKL-40 in blood, serum, or plasma samples from said subject or patient, said method comprising the following steps:

[0054] - To bring the sample into contact with the components of the multiplex immunoPCR kit of the present invention, and

[0055] - Perform multiplex immunoPCR to measure the levels of YKL-40 and hsa-miR-34. Attached Figure Description

[0056] Figure 1 Fibrosis x NAS spectrum from training (A) and validation (B) cohorts of patients from screening visits (SV).

[0057] Figure 2 Correspondence diagrams for three different miR-34a quantification dosages: old quantification data using conventional PCR (represented as "oriD"), new quantification data using conventional PCR (represented as "newD"), and quantification data extracted from data using the multiplex immunoPCR (miPCR) procedure of this invention (represented as "immuPCR"). A: Correspondence diagram between quantification data "oriD" and "newD"; B: Correspondence diagram between quantification data "immuPCR" and "newD"; C: Correspondence diagram between quantification data "immuPCR" and "oriD".

[0058] Figure 3 Box plots of the distribution of quantitative data for three miR-34a types, namely “immuPCR”, “newD”, and “oriD”, and ANOVA for summarizing repeated measures.

[0059] Figure 4Correspondence graphs for three different YKL-40 quantification methods: old quantification data using the standard ELISA procedure (represented as "oriD"), new quantification data using the standard ELISA procedure (represented as "newD"), and quantification data extracted from data using miPCR (represented as "immuPCR"). A: Correspondence graph between quantification data "oriD" and "newD"; B: Correspondence graph between quantification data "immuPCR" and "newD"; C: Correspondence graph between quantification data "immuPCR" and "oriD".

[0060] Figure 5 Box plots for different YKL-40s, namely “immuPCR”, “newD”, and “oriD”, and ANOVA for summarizing repeated measurements.

[0061] Figure 6 A graph showing the correspondence between standard techniques and miR-34a (A) and YKL-40 (B) quantification values ​​from miPCR. Data were obtained from the training cohort (n=163). Corrected data for miR-34a and YKL-40 were extracted from data using the multiplex immunoPCR procedure of this invention.

[0062] Figure 7 Box plots of the data distribution of miR-34a(A) and YKL-40(B) quantitative data obtained from the training cohort (n=163), and ANOVA of repeated measures results. "ImmuPCR": Data obtained from miPCR; "newD": New quantitative data using standard techniques; "ImmuPCR_Corr": Corrected data extracted from the miPCR data.

[0063] Figure 8 : A graph showing the correspondence between standard techniques and miR-34a (A) and YKL-40 (B) quantification values ​​from miPCR. Data were obtained from the validation cohort (n=327). Corrected data for miR-34a and YKL-40 were extracted from data using the miPCR procedure.

[0064] Figure 9 Box plots of the data distribution for miR-34a(A) and YKL-40(B) quantitative data obtained from the validation cohort (n=327), and ANOVA of the repeated measurements. "ImmuPCR": Uncorrected data obtained from the miPCR process; "newD": New quantitative data using standard techniques; "ImmuPCR_Corr": Corrected data extracted from the multiplex immunoPCR data.

[0065] Figure 10Plots showing the correspondence between NIS2+ scores on the logit scale based on data from three procedures used for biomarker concentration assessment: standard technique (NIS2+-newD), uncorrected miPCR (NIS2+-immunoPCR), and corrected miPCR (NIS2+-immunoPCRCorr). Data were obtained from the validation cohort (n=327). A: Plot showing the correspondence between NIS2+ scores obtained via “NIS2+-newD” and scores obtained via “NIS2+-immunoPCR”; B: Plot showing the correspondence between NIS2+ scores obtained via “NIS2+-immunoPCRCorr” and scores obtained via “NIS2+-immunoPCR”; C: Plot showing the correspondence between NIS2+ scores obtained via “NIS2+-newD” and scores obtained via “NIS2+-immunoPCRCorr”.

[0066] Figure 11 Box plots of the NIS2+ score distribution obtained from the training cohort (n=163), and ANOVA of repeated measures results. NIS2+ scores were obtained through uncorrected miPCR (ImmuPCR), corrected miPCR (ImmuPCR_Corr), and the standard procedure (newD), respectively. Detailed Implementation

[0067] Nucleic acid molecules

[0068] This invention provides nucleic acid molecules that can be used to detect targets in samples.

[0069] As used herein, the term “nucleic acid molecule” refers to an analogue of a single-stranded or double-stranded DNA fragment or nucleic acid molecule derivative that can be amplified by PCR.

[0070] The nucleic acid molecule may contain or consist of oligonucleotides suitable for amplification during polymerase chain reaction (PCR).

[0071] As used herein, the term “oligonucleotide” refers to single-stranded DNA having 50 to 200 nucleotides, particularly 60 to 180 nucleotides, more particularly 70 to 150 nucleotides, and even more particularly 80 to 120 nucleotides.

[0072] The oligonucleotide may comprise natural deoxyribonucleotides and ultimately non-natural nucleotides.

[0073] Typically, the oligonucleotide sequence has less than 50% identity with any circulating DNA sequence that may be present in the sample to be tested. This ensures that, on the one hand, the oligonucleotide will not be used for amplification of any primer pair amplifying the circulating DNA / RNA of the sample, and on the other hand, the primer pair used to amplify the oligonucleotide will be specific to the oligonucleotide.

[0074] In one embodiment, the oligonucleotide has a sequence with less than 50%, particularly less than 40%, and more particularly less than 30%, 20%, 10%, or 5% identity to any circulating human serum DNA / RNA sequence.

[0075] In a more specific embodiment, the oligonucleotide has the sequence shown in SEQ ID NO: 1, 2 or 3, or a sequence having at least 90% identity with SEQ ID NO: 1, 2 or 3.

[0076] More specifically, the oligonucleotide has the sequence of SEQ ID NO: 1.

[0077] Sequence identity can be determined by comparing positions in each sequence that can be compared for comparative purposes. When positions in the compared sequences are occupied by the same bases, the molecules are identical at that position. The degree of identity between nucleic acid sequences is a function of the number of identical or matching nucleotides at the same positions in the nucleic acid sequences. Sequence identity can be calculated using any conventional tool, such as Blastn (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome) proposed by the National Center for Biotechnology Information, particularly by using Blastn's pre-selected parameters and procedures.

[0078] The nucleic acid molecules of the present invention may further include linkers. The linkers are attached to the aforementioned oligonucleotides. Typically, the linkers may include a carbon chain or PEG chain as a spacer and a reactive group that allows the nucleic acid molecule to be conjugated to a protein or peptide. The reactive group can be any reactive group that can react directly with protein residues or indirectly with the protein via a compatible reactive group carried by the protein. Suitable reactive groups include, but are not limited to, thiols, carboxyl groups, amines, hydroxyl groups, aldehydes, biotin, streptavidin, and chemical groups suitable for click chemistry, such as alkyne groups or azide groups. The linkers included in the nucleic acid molecules of the present invention can be any linker described in the art suitable for oligonucleotide-antibody conjugation. Examples of linkers include, but are not limited to, linkers containing biotin groups, amino C6-C18 linkers (e.g., amino C3 linkers, amino C6 linkers, amino C12 linkers), and linkers containing click chemistry linkers (e.g., linkers containing alkyne groups or azide groups).

[0079] In one specific embodiment, the nucleic acid molecule comprises or is composed of an oligonucleotide of sequence SEQ ID NO: 1, which is attached to a biotin group.

[0080] The nucleic acid molecules of this invention can be produced by any conventional method. More specifically, methods for producing biotinylated oligonucleotides are well known in the art.

[0081] DNA-antibody conjugates

[0082] The present invention also provides DNA-antibody conjugates comprising (i) a nucleic acid molecule as described above and (ii) an antibody against a protein of interest.

[0083] As used herein, the term “DNA-antibody conjugate” refers to a complex formed of an oligonucleotide and an antibody, wherein the oligonucleotide is attached to the antibody via a linker.

[0084] According to the present invention, the oligonucleotide of the DNA-antibody conjugate has the sequence of SEQ ID NO: 1, 2 or 3, or the sequence having at least 90% identity with SEQ ID NO: 1, 2 or 3.

[0085] In particular, the oligonucleotides of the DNA-antibody conjugate have the sequence of SEQ ID NO: 1.

[0086] The antibodies in the DNA-antibody conjugates of this invention can be antibodies against any protein of interest. Examples of proteins of interest include, but are not limited to, α2 macroglobulin (A2M), glycated hemoglobin (HbA1c), insulin, C-peptide, PIIINP N-terminal propeptide of type III collagen, CK18-M30 (cytokeratin 18 fragment 30), CK18-M65, HSCRP (high-sensitivity HSCRP), TSP-2 (platelet-reactive protein 2), and soluble vascular cell adhesion molecule (sVCAM). The antibodies can be monoclonal or polyclonal antibodies, chimeric antibodies, human antibodies, humanized antibodies, nanobodies, full-length or fragments thereof, including Fab, Fab' or F(ab')2, scFV, aptamers, or biantibodies.

[0087] In one specific embodiment, the antibody is an antibody against protein YKL-40 (also known as chitosanase 3-like protein 1, CHI3L1). A suitable anti-YKL-40 antibody can be any anti-YKL-40 antibody described in the prior art or produced according to conventional methods.

[0088] DNA-antibody conjugates can be produced by any conventional method described in the prior art (Wiener. J., Kokotek. D., Rosowski. S., Lickert. H. & Matthias Meier, Scientific Reports (2020) 10:1457). Typically, DNA-antibody conjugates can be produced by reacting an antibody with a nucleic acid molecule containing a linker or by reacting an antibody and an oligonucleotide together with the linker. The antibody, oligonucleotide, and linker can carry suitable reactive groups. For example, oligonucleotides containing biotin or alkyne groups can react with proteins containing streptavidin or azide groups, respectively.

[0089] In a more specific embodiment, the DNA-antibody conjugate comprises an oligonucleotide of sequence SEQ ID NO: 1 and an anti-YKL-40 antibody, wherein the oligonucleotide is attached to the antibody via a biotin-streptavidin-biotin linker.

[0090] · Reagent test kit

[0091] This invention also provides kits for detecting or quantifying protein targets by immunoPCR. More specifically, this invention relates to kits for detecting or quantifying protein and nucleic acid targets by multiplex immunoPCR.

[0092] The term "immunoPCR" refers to the detection or quantification of proteins by using polymerase chain reaction to specifically amplify oligonucleotides attached to the protein. ImmunoPCR allows for the detection or quantification of protein targets via PCR.

[0093] The term "multiplex immunoPCR" refers to the use of polymerase chain reaction to simultaneously amplify at least one oligonucleotide of a DNA-antibody conjugate and at least one other DNA. Therefore, multiplex immunoPCR allows for the simultaneous detection or quantification of more than one target by PCR. The target can be a protein target or a nucleic acid target. Examples of protein targets include, but are not limited to, human serum circulating proteins, particularly those expressed in patients with NASH. Examples of nucleic acid targets include, but are not limited to, human serum circulating nucleic acids, such as microRNAs, particularly those expressed in patients with NASH. More specifically, the protein target is the circulating YKL-40 protein, and the nucleic acid target is miR-34, particularly hsa-miR-34, more particularly hsa-miR-34a, and even more particularly hsa-miR-34a-5p.

[0094] In one embodiment of the invention, the kit comprises a DNA-antibody conjugate as described herein.

[0095] In one specific embodiment, the present invention relates to an immunoPCR kit for detecting protein targets, the kit comprising:

[0096] - DNA-antibody conjugates as described in this invention, and

[0097] - A pair of primers for amplifying the oligonucleotides of the DNA-antibody conjugate.

[0098] In a more specific embodiment, the kit comprises a DNA-antibody conjugate containing an anti-YKL-40 antibody and an oligonucleotide with sequence SEQ ID NO: 1, 2, or 3.

[0099] The primer sequences for amplifying the oligonucleotides of the DNA-antibody conjugate can be designed according to any conventional method used for designing PCR primers and based on the sequence of the oligonucleotides of the DNA-antibody conjugate. In a specific embodiment of the kit, the forward and reverse primers for amplifying the oligonucleotide of sequence SEQ ID NO: 1 have the sequences of SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

[0100] In another specific embodiment of the kit, the forward and reverse primers for amplifying the oligonucleotide of sequence SEQ ID NO: 2 have the sequences of SEQ ID NO: 11 and SEQ ID NO: 12, respectively.

[0101] In another specific embodiment of the kit, the forward and reverse primers for amplifying the oligonucleotide of sequence SEQ ID NO: 3 have sequences of SEQ ID NO: 13 and SEQ ID NO: 14, respectively.

[0102] In one specific embodiment, the immunoPCR kit of the present invention further comprises a fluorescent nucleic acid probe that specifically binds to an oligonucleotide of a DNA-antibody conjugate.

[0103] The fluorescent nucleic acid probe can be used to indicate the amount of amplified products in real time and is suitable for use in quantitative PCR. The fluorescent nucleic acid probe, in particular, is a TaqMan probe, i.e., a nucleic acid probe consisting of a fluorescent dye covalently attached to the 5' end of the probe and a quencher covalently attached to the 3' end of the probe. Suitable fluorescent dye and quencher pairs can be selected according to rules known in the art, i.e., the fluorescence emission of the fluorescent dye should be effectively inhibited by the quencher before the probe is degraded by DNA polymerase during PCR cycles. An example of a suitable fluorescent dye and quencher pair that can be cited is Cy5 fluorescent dye / BHQ-2.

[0104] The sequence of the fluorescent nucleic acid probe can be designed using conventional methods and based on the sequence of oligonucleotides in DNA-antibody conjugates. The probe binds to oligonucleotides in the region to be amplified.

[0105] In one specific embodiment, the fluorescent nucleic acid probe has the sequence of SEQ ID NO: 4, 9 or 10.

[0106] The probe of sequence SEQ ID NO: 4 can specifically bind to the oligonucleotide of sequence SEQ ID NO: 1.

[0107] The probe of sequence SEQ ID NO: 9 can specifically bind to the oligonucleotide of sequence SEQ ID NO: 2.

[0108] The probe of sequence SEQ ID NO: 10 can specifically bind to the oligonucleotide of sequence SEQ ID NO: 3.

[0109] More specifically, the probe has the sequence of SEQ ID NO: 4, and has Cy5 fluorescent dye at the 5' end and BHQ-2 as a quencher at the 3' end.

[0110] ImmunoPCR kits containing the aforementioned fluorescent nucleic acid probes are particularly suitable for quantitative PCR.

[0111] In another specific embodiment, the present invention relates to a multiplex immunoPCR kit for detecting protein targets and nucleic acid targets, the kit comprising:

[0112] - DNA-antibody conjugates as described in this invention

[0113] -A pair of primers for amplifying the oligonucleotides of the DNA-antibody conjugate, and

[0114] - A pair of primers used to amplify nucleic acid targets.

[0115] In a more specific embodiment, the kit comprises a DNA-antibody conjugate containing an anti-YKL-40 antibody and an oligonucleotide with sequence SEQ ID NO: 1, 2, or 3.

[0116] The primer sequences for the oligonucleotides used to amplify the DNA-antibody conjugate can be designed based on the sequence of the oligonucleotides, according to conventional methods for designing PCR primers.

[0117] In the specific implementation of the kit, the forward and reverse primers for amplifying the oligonucleotide of sequence SEQ ID NO: 1 have the sequences of SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

[0118] In the specific implementation of the kit, the forward and reverse primers for amplifying the oligonucleotide of sequence SEQ ID NO: 2 have the sequences of SEQ ID NO: 11 and SEQ ID NO: 12, respectively.

[0119] In the specific implementation of the kit, the forward and reverse primers for amplifying the oligonucleotide of sequence SEQ ID NO: 3 have the sequences of SEQ ID NO: 13 and SEQ ID NO: 14, respectively.

[0120] The sequences of primers used to amplify nucleic acid targets can be designed using any conventional method and based on the sequence of the nucleic acid target.

[0121] In one specific embodiment, the multiplex immunoPCR kit contains a pair of primers for amplifying miRNAs, particularly those selected from hsa-miR-34, hsa-miR-132, hsa-miR-125, hsa-miR-505, hsa-miR-365, hsa-miR-22, hsa-miR-378, hsa-miR-320, hsa-miR-885, hsa-miR-483, hsa-miR-30, hsa-miR-422a, hsa-miR-100, hsa-miR-4324, hsa-miR-193, and hsa-miR-452.

[0122] More specifically, the multiplex immunoPCR kit contains a pair of primers for amplifying hsa-miR-34a and, more specifically, hsa-miR-34a-5p (SEQ ID NO: 7).

[0123] In a more specific implementation, the multiplex immunoPCR kit includes forward and reverse primers for amplifying hsa-miR-34a-5p. These primers are those included in the Taqman MicroRNA assay (Applied Biosystems, reference 4440886).

[0124] In a preferred embodiment, the kit further comprises:

[0125] - A fluorescent nucleic acid probe that specifically binds to an oligonucleotide of a DNA-antibody conjugate as described above, and

[0126] - A fluorescent nucleic acid probe that specifically binds to the amplification product of a nucleic acid target.

[0127] Generally speaking, fluorescent nucleic acid probes for oligonucleotides and fluorescent nucleic acid probes for nucleic acid targets contain distinguishable fluorescent dyes.

[0128] In one specific embodiment, the fluorescent nucleic acid probe has the sequence of SEQ ID NO: 4, 9 or 10.

[0129] Fluorescent nucleic acid probes that bind to the amplification products of nucleic acid targets can be designed based on the sequence of the nucleic acid targets.

[0130] The above kit is particularly suitable for quantitative multiplex PCR.

[0131] The multiplex immunoPCR kit of the present invention may further include:

[0132] Internal control for the PCR process.

[0133] - At least one positive control against hsa-miR-34, and

[0134] - At least one positive control for YKL-40.

[0135] During quantitative PCR, especially quantitative multiplex PCR, internal controls and / or at least one positive control of the target to be detected or quantified can be used to normalize the amplification data of the target.

[0136] A suitable internal control can be selected based on general knowledge in the art. For example, the internal control can be exogenous DNA from the sample, such as miRNA molecules found in species other than humans, like miRNA molecules from *Caenorhabditis elegans*. In one specific embodiment of the kit, the internal control is cel-miR-40-3p (SEQ ID NO: 8: 5'-UCACCGGGUGUACAUCAGCUAA-3') from *Caenorhabditis elegans*.

[0137] In one specific embodiment, the kit further comprises a pair of primers for amplifying an internal control and a fluorescent nucleic acid probe that specifically binds to the amplification product of the internal control.

[0138] More specifically, the fluorescent nucleic acid probe used for the internal control cel-miR-40-3p is TaqMan MicroRNAAssay (Applied Biosystems, reference CCU001L).

[0139] To quantify hsa-miR-34 levels during quantitative PCR, at least one positive control with a known hsa-miR-34 value can be used. Specifically, three positive controls with different known hsa-miR-34 values ​​can be used. These positive controls can cover the range of hsa-miR-34 levels in the NASH population. With three positive controls, one corresponds to a low hsa-miR-34 level, one to a moderate level, and another to a high level. The moderate level, also known as a calibrator, is used in the assay to calculate the fold change value.

[0140] In one specific implementation, the kit contains three positive controls for hsa-miR-34 at concentrations of 24.8 fM, 2.48 fM, and 0.99 fM. The Cq values ​​for each positive control of hsa-miR-34a-5p are C1 = 28 + / - 2SD, C2 = 30.7 + / - 2SD, and C3 = 32 + / - 2SD (SD standard deviation).

[0141] To quantify YKL-40 levels during quantitative PCR, at least one positive control with a known YKL-40 value can be used. Specifically, three positive controls with different known YKL-40 values ​​can be used. In one specific embodiment, the kit contains three positive controls for YKL-40 at concentrations of 30,000 pg / mL, 85,000 pg / mL, and 200,000 pg / mL.

[0142] The kit of the present invention may further comprise a DNA polymerase, such as TaqMan® polymerase, several deoxynucleotides, and one or more reaction buffers.

[0143] In one specific implementation, the reaction buffer may contain salts and any conventional reagents to optimize DNA polymerase activity and / or PCR assays.

[0144] • Uses of the reagent kit

[0145] The immunoPCR kit of the present invention can be used to detect or quantify the level of protein targets in a sample.

[0146] The multiplex immunoPCR kit of the present invention has a particular advantage because it can be used to simultaneously detect or quantify the levels of protein targets and nucleic acid targets in a sample.

[0147] Specifically, the kit described above can be used to simultaneously detect or quantify the levels of YKL-40 and miR-34, two biomarkers used in diagnostic methods as described in WO2017167934.

[0148] Therefore, the multiplex immunoPCR kit of the present invention allows for the simultaneous detection and / or quantification of levels of circulating biomarkers used for NASH diagnosis. The multiplex immunoPCR kit of the present invention allows for a faster and easier method for measuring these biomarkers.

[0149] Therefore, the present invention relates to the use of the immunoPCR kit of the present invention for detecting or quantifying the level of protein targets in a sample.

[0150] This invention also relates to the use of the multiplex immunoassay PCR kit of the present invention for detecting or quantifying the levels of protein targets and nucleic acid targets in a sample. More specifically, this invention relates to the use of the kit described above for detecting or quantifying the levels of YKL-40 and hsa-miR-34 in a sample.

[0151] Advantageously, the present invention relates to the use of kits as described above for diagnosing non-alcoholic steatohepatitis (NASH) and / or for determining the activity, stage, or severity of NASH in a subject, and / or for classifying a subject as a recipient or non-recipient of NASH treatment, and / or for assessing the efficacy of medical treatment, and / or for determining the progression or regression of pathology in a NASH patient, and / or for classifying a patient as a potential responder or non-responder to medical treatment.

[0152] The present invention also provides a method for quantifying the levels of protein targets and nucleic acid targets in a sample, the method comprising the following steps:

[0153] - To bring the sample into contact with the components of the multiplex immunoPCR kit of the present invention,

[0154] - Perform multiplex immunoPCR to measure the levels of the protein target and the nucleic acid target.

[0155] More specifically, the present invention provides a method for quantifying the levels of YKL-40 and hsa-miR-34 in a sample, the method comprising the following steps:

[0156] - To contact the sample with components of a multiplex immunoPCR kit, the multiplex immunoPCR kit comprising:

[0157] (i) A DNA-antibody conjugate comprising an anti-YKL-40 antibody and an oligonucleotide with sequence SEQ ID NO: 1, 2, or 3.

[0158] (ii) A pair of primers for amplifying the oligonucleotides of the DNA-antibody conjugate.

[0159] (iii) A pair of primers used to amplify hsa-miR-34,

[0160] - Perform multiplex immunoPCR to measure the levels of YKL-40 and hsa-miR-34.

[0161] Multiplex PCR can be performed using any conventional method, such as using the "TaqMan" probe.

[0162] This invention also provides methods for diagnosing nonalcoholic steatohepatitis (NASH) and / or for determining the activity, stage, or severity of NASH in a subject, and / or for classifying a subject as a recipient or non-recipient of NASH treatment, and / or for assessing the efficacy of medical treatment, and / or for determining the progression or regression of pathology in NASH patients, and / or for classifying patients as potential responders or non-responders to medical treatment, by measuring the levels of circulating hsa-miR-34 and YKL-40 in blood, serum, or plasma samples from said subject or patient, said methods comprising the following steps:

[0163] - Contact the sample with the reagents of the multiplex immunochromatographic PCR kit, the multiplex immunochromatographic PCR kit comprising:

[0164] (i) A DNA-antibody conjugate comprising an anti-YKL-40 antibody and an oligonucleotide with sequence SEQ ID NO: 1, 2, or 3.

[0165] (ii) A pair of primers for amplifying the oligonucleotides of the DNA-antibody conjugate.

[0166] (iii) A pair of primers used to amplify hsa-miR-34,

[0167] - Perform multiplex immunoPCR to measure the levels of YKL-40 and hsa-miR-34.

[0168] In one specific implementation, the method further includes the step of correcting the levels of the measurements of YKL-40 and hsa-miR-34a by applying mathematical correction.

[0169] In one specific implementation, the mathematical correction can be obtained by using linear modeling, and can be one of the following:

[0170]

[0171] In one specific implementation, the diagnostic method may further include the step of combining the results using a mathematical algorithm to obtain a NASH score. The NASH score can be calculated according to mathematical algorithms described in the prior art, such as the method "NIS2+" using the following equation:

[0172]

[0173] in

[0174] y = β0 + β1 log10(miR-34a-5p (multiple)) + β2 log10(YKL-40 (ng / ml)) + β3 Gender + β4 log10(miR-34a-5p (multiple)) Gender; and

[0175] If the subject is female, then the gender is 0; or if the subject is male, then the gender is 1.

[0176] In one specific embodiment, β0 is included between -3 and 3, particularly between -2 and 2. In one specific embodiment, β1 is included between 1 and 5, particularly between 2 and 4. In one specific embodiment, β2 is included between 0 and 4.5, particularly between 0.5 and 3. In one specific embodiment, β3 is included between -2 and 2, particularly between -1 and 1. In one specific embodiment, β4 is included between -1 and 2, particularly between 0 and 2. In another specific embodiment, β0 is included between -3 and 3, β1 is included between 1 and 5, β2 is included between 0 and 4.5, β3 is included between -2 and 2, and β4 is included between -1 and 2. In yet another specific embodiment, β0 is included between -2 and 2, β1 is included between 2 and 4, β2 is included between 0.5 and 3, β3 is included between -1 and 1, and β4 is included between 0 and 2.

[0177] For example, the following equation can be used to diagnose at-risk NASH:

[0178] Equation 1:

[0179] y = -1.4539 + 2.3003 log10(miR-34a-5p (multiple)) + 1.0598 log10(YKL-40 (ng / ml)) – 0.0533 Gender + 0.4514 log10(miR-34a-5p (multiple)) gender

[0180] Equation 2:

[0181] y = -0.8756 + 3.3957 log10(miR-34a-5p (multiple)) + 2.5248 log10(YKL-40 (ng / ml)) – 0.6496 Gender + 0.2873 log10(miR-34a-5p (multiple)) gender

[0182] Equation 3:

[0183] y = 1.1543 + 2.5678 log10(miR-34a-5p (multiple)) + 1.7859 log10(YKL-40 (ng / ml)) + 0.3514 Gender + 0.7264 log10(miR-34a(5p (multiple)) gender

[0184] The score calculated from the mathematical function can then be compared with predetermined cutoff values ​​(such as low and high cutoff values). In this context, a calculated S-score below the low cutoff value indicates that the subject is not at high risk of NASH, and a calculated S-score greater than or equal to the high cutoff value indicates that the subject is at high risk of NASH.

[0185] In one embodiment, the low cutoff value is included between 0.24 and 0.5, particularly between 0.41 and 0.49. In one embodiment, the high cutoff value is included between 0.6 and 0.95, particularly between 0.62 and 0.74. In another embodiment, the low cutoff value is equal to 0.4564. In another embodiment, the high cutoff value is equal to 0.6815. In yet another embodiment, both the low cutoff value and the high cutoff value are equal to 0.4564 and 0.6815.

[0186] The score calculated from the mathematical function can then be compared with predetermined cutoff values ​​(such as low and high cutoff values). In this context, a calculated S-score below the low cutoff value indicates that the subject is not at high risk of NASH, and a calculated S-score greater than or equal to the high cutoff value indicates that the subject is at high risk of NASH.

[0187] In one embodiment, the low cutoff value is included between 0.24 and 0.5, particularly between 0.41 and 0.49. In one embodiment, the high cutoff value is included between 0.6 and 0.95, particularly between 0.62 and 0.74. In another embodiment, the low cutoff value is equal to 0.4564. In another embodiment, the high cutoff value is equal to 0.6815. In yet another embodiment, both the low cutoff value and the high cutoff value are equal to 0.4564 and 0.6815. Example

[0188] Materials and methods

[0189] Patient cohort

[0190] The study utilized a cohort of 492 patients from the RESOLVE-IT trial. RESOLVE-IT is a multicenter, randomized, double-blind, placebo-controlled phase III study designed to evaluate the efficacy and safety of Elafibranor in patients with NASH and fibrosis. It was conducted under Subpart H (FDA) and Conditional Approval (EMA) approval.

[0191] The sample referred to as "SV" (used for "screening visits") corresponds to a blood sample collected 12 to 4 weeks prior to the start of treatment or placebo intake. (=screening period).

[0192] A dataset from the V3 (Visit 3) samples was obtained to validate the potential mathematical correction for biomarker (BM) concentrations, thereby validating the NIS2+ score. It is important to note that YKL-40 has not been re-dosed using ELISA, as a high correlation has been observed between the initial values ​​(those in the GFT database) and the re-dosed values ​​based on the SV results.

[0193] To robustly analyze this novel miPCR procedure, another dataset containing data from SV serum samples (n=492) was randomly split: one-third was used to train different models for potential mathematical corrections to concentrations, and two-thirds were used to validate these corrections and the clinical performance of NIS2+ obtained using miPCR compared to clinical performance using conventional techniques. Two patients had missing YKL-40 values, and the total number of patients in this cohort was n=490; therefore, it was split into a training dataset of n=163 patients and a validation dataset of n=327 patients. The overall characteristics of these two cohorts are reported in Table 1.

[0194] Table 1: Descriptive characteristics of the SV sample queue (n=490)

[0195]

[0196] Note: p-values ​​are calculated using the Chi2 test for proportion comparisons and the Wilcoxon test for numerical features.

[0197] The two cohorts (training and validation) were very similar in terms of major factors, but differed significantly in the prevalence of type 2 diabetes (T2D) and the distribution of NAS scores. The prevalence of high-risk NASH was 55% in the training cohort and 51% in the validation cohort.

[0198] Figure 1The fibrosis and NAS histological profiles of the two cohorts are reported graphically. The training cohort was rich in F2 patients (30.7%), while the validation cohort had the highest proportions of F1 and F3 patients (28.1% and 32.4%, respectively).

[0199] Positive control and internal control

[0200] Positive controls for hsa-miR-34a-5p, named C1mir, C2mir, and C3mir, were prepared from biomatrix of voluntary blood donors with added synthetic hsa-miR-34a-5p. These positive controls mimicked high, intermediate, and low expression levels of this microRNA in the NASH population, respectively. The concentrations of hsa-miR-34a-5p in the positive controls were 24.8 fM, 2.48 fM, and 0.99 fM, respectively. The Cq values ​​for each positive control of hsa-miR-34a-5p were C1 = 28 + / - 2SD, C2 = 30.7 + / - 2SD, and C3 = 32 + / - 2SD, respectively.

[0201] Positive controls of YKL-40, named C1YKL, C2YKL, and C3YKL, were prepared from a biomatrix of voluntary blood donors. Recombinant YKL-40 protein conjugated to an oligonucleotide of sequence SEQ ID NO: 1 was introduced and diluted to three different concentrations corresponding to clinically relevant values: C1 = healthy individuals, C2 = approximate medical decision threshold, and C3 = average observed in disease. The concentrations of YKL-40 in the positive controls were 30,000 pg / ml, 85,000 pg / ml, and 200,000 pg / ml, respectively.

[0202] An internal control (internal process control (IPC)) was used. The internal control served as a control throughout the entire process of hsa-miR-34a-5p assay from extraction to PCR, and was prepared from biomatrix of voluntary blood donors and Cel-miR-40-3p (microRNA from Caenorhabditis elegans).

[0203] PCR for measuring hsa-miR-34a levels

[0204] Quantitative PCR was performed to measure hsamiR-34a levels in serum samples obtained from the patient cohort.

[0205] Total RNA was extracted from patient serum samples using the Promega magnetic bead extraction method with the Maxwell® Plasma and Serum Kit (AS1680, Promega) and the RCS48 instrument (AS8500, Promega). To monitor extraction efficiency and minimize inter-sample variability, synthetic vesicles containing *C. elegans* Cel-miR-40-3p (mature miRNA sequence UCACCGGGUGUACAUCAGCUAA-3' (SEQ ID NO:8), Integrated DNA Technologies, purified RNase-free HPLC) were used as IPCs and added to each sample prior to RNA extraction. Three positive controls with known miR-34a Cq values ​​(low [C1=32Cq], intermediate (also known as calibrator [C2=30.7Cq], and high [C3=28Cq] has-miR34a-5p levels) covering the miR-34a expression range in the NASH population were simultaneously treated with the test samples. The intermediate standard was also used as a calibrator for the assay to calculate the fold change. Total RNA (containing IPC) from serum samples and total RNA (also containing IPC) from positive controls were simultaneously reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit (4366597, AppliedBiosystems, Thermo Fisher Scientific). The reverse transcription reaction was performed in a 24 μL final mixture containing 3 μL of TaqMan microRNAAssay 5X and incubated in a Thermal Cycler T100 (Biorad). The cDNA was stored in low-binding tubes at -20 °C until further use. According to the manufacturer's instructions, the expression of mature miRNAs was quantified using the TaqMan miRNA RT-qPCR Assay 20X and TaqMan Universal Master Mix II (Uracil-N-glycosylation-free (UNG)) (4440040, Applied Biosystems, ThermoFisher Scientific). A fixed volume of 5 μL of total cDNA was used as the template for the qPCR assays using a CFX96 real-time PCR detection system.miR-34a was determined using TaqMan (the sequence of mature hsa-miR-34a-5p = UGGCAGUGUCUUAGCUGGUUGU (SEQ ID NO:7), miR-base number = MIMAT0000255; and the sequence of mature Cel-miR-40-3p = UCACCGGGUGUACAUCAGCUAA (SEQ ID NO:8), miR-base number = MIMAT0000011). The Cq determination pattern was regression. For each patient sample, miRNA levels were expressed as fold changes using both IPC and calibrator Cq according to the following equation:

[0206] - Step 1: Normalization of calibrator C2 relative to the internal process control

[0207] ΔCq C2 miR-34 = Cq C2 miR-34a – Cq C2中的C2 miR-40

[0208] - Step 2: Normalization of the sample relative to the internal process control

[0209] ΔCq 样品miR-34a = Cq 样品miR-34a – Cq 样品miR-40

[0210] Step 3: Calculation of miR-34a δ expression in Cq samples

[0211] ΔΔCq 样品miR-34 = ΔCq 样品 - ΔCq C2

[0212] Step 4: Sample delta expression of miR-34a expressed as multiples

[0213] hsa-miR-34a fold change (FC) = 2 -ΔΔCq

[0214] ELISA for measuring YKL-40

[0215] ELISA was performed to measure YKL-40 levels in serum samples obtained from the patient cohort. ELISA was performed using the manufacturer's protocol (Quantikine® ELISA Human Chitinase 3-like 1 Immunoassay Kit (RUO), DC3L10, R&D Systems, Minneapolis, USA) and automated. The washing step was performed using a Tecan HydroSpeed™ plate washer (Tecan, Männedorf, ref. 30054550 Switzerland), and readings were determined using a Thermo Scientific™ Multiskan™ GO microplate spectrophotometer (ThermoFisher, ref. 51119200 Massachusetts, USA) set to 450 nm.

[0216] Positive controls were processed in the same manner as serum samples and tested in duplicate.

[0217] Multiplex ImmunoPCR

[0218] Multiplex immunoPCR was performed according to the following protocol to measure the levels of hsa-miR-34a and YKL-40 in serum samples obtained from the patient cohort.

[0219] • Sample preparation for measuring hsa-miR-34a:

[0220] The methods for extracting total RNA from serum samples and for reverse transcription are the same as those described in "PCR for measuring hsa-miR-34a levels" above.

[0221] • Sample preparation for measuring YKL-40 protein:

[0222] Capture antibody coating: The capture antibody was immobilized on the plate by nonspecific adsorption overnight at room temperature. The capture antibody was a rat monoclonal antibody specific to the human YKL-40 protein. The antibody was pre-diluted in phosphate-buffered saline (PBS) and then deposited at a concentration of 360 μg / ml.

[0223] Washing plate: Repeat washing 3 times, with a 1-minute interval between each wash. Prepare the wash buffer using a concentrated wash buffer solution containing PBS and 1% bis(trimethylsilyl)acetamide (BSA). Dilute the solution in 1 L of water, then add 1 mL of Tween 20.

[0224] Plate saturation: Saturate the plate with a saturation buffer containing 1% BSA, 1 g / L salmon sperm DNA, and 0.1 mM EDTA. Incubate at 37 °C for 1 hour. Then wash three times with the same washing buffer as the previous step.

[0225] Preparation of Standards: To prepare a series of standards for YKL-40 protein, recombinant YKL-40 was diluted. This series of standards consists of eight points (same as the ELISA range) with decreasing YKL-40 concentrations, obtained by sequential cascade dilutions of YKL-40 protein in saturated buffer (500 μL standard + 500 μL saturated buffer). The first range point (std 1) has a YKL-40 concentration of 8000 pg / ml. The concentrations of the second through eighth range points are 4000 (std 2), 2000 (std 3), 1000 (std 4), 500 (std 5), 250 (std 6), 125 (std 7), and 62.5 pg / ml (std 8), respectively.

[0226] The standards and positive controls were then diluted in saturated buffer. The positive control was diluted 100-fold in saturated buffer.

[0227] Add samples: Add 25 μL of serum sample to each well of the plate. Also add standards and positive controls to separate wells. Incubate at 37 °C for 1 hour.

[0228] Adding the second anti-YKL-40 antibody: After plate incubation and three washes, add the biotinylated detection antibody (a goat polyclonal antibody against human YKL-40 protein) to the wells. Use the detection antibody at a concentration of 0.05 μg / ml. Incubate the plate at 37 °C for 1 hour.

[0229] A stock solution of streptavidin (1 nM) was diluted 50,000-fold in saturated buffer. The biotinylated oligonucleotide of sequence SEQ ID NO:1 was prepared at a concentration of 0.35 M. Streptavidin and the biotinylated oligonucleotide were then mixed in equal volumes and incubated at 4 °C for 45 min. 25 μL of the resulting complex was then added to a previously washed 96-well plate. The plate was incubated at room temperature for 10 min.

[0230] Preparation of PCR mixture: The mixture contains three pairs of PCR primers and three specific “TaqMan” probes for each of the following targets, master mix and sterile water: oligonucleotide of sequence SEQ ID NO: 1, miR-34a and miR-40 (internal process control).

[0231] Add 15 μL of the PCR mixture and 5 μL of cDNA to each well. Positive controls were also added to each well. The PCR program was then started on a CFX96™ IVD Real-Time PCR Systems thermal cycler (Bio-rad, reference 185-5095 IVD) using the following program: one cycle at 95 °C for 10 minutes, followed by 50 cycles at 95 °C for 15 seconds and 60 °C for 1 minute.

[0232] Calculation of NASH score

[0233] The NIS2+ method described above is used to calculate the NASH score.

[0234] result

[0235] 1. Comparison between conventional methods and the method of this invention

[0236] To verify the accuracy of the method of the present invention for measuring the levels of hsa-miR-34a-5p and YKL-40, pairwise comparisons were made of data from three different sources of these biomarkers.

[0237] These data sources are:

[0238] -Historical quantitative data is available in the ResolveIT queue's internal database.

[0239] - New data obtained using standard procedures (PCR for hsa-miR-34a-5p, ELISA for YKL-40)

[0240] - New data obtained from the new miPCR process.

[0241] Using data from these three different sources, any potential biases in the distribution of NIS2+ and its biomarkers were evaluated. In this section, only the training dataset (n=163) was used to measure and analyze the correspondences between data from different sources, and mathematical corrections for concentrations were developed where necessary. These corrections will then be further validated using a validation dataset.

[0242] 1.1 Analysis of hsa-miR-34a-5p

[0243] Head-to-head graphical representations of three types of HSA-MIR-34A-5P data were performed, and... Figure 2 The data is shown in the figure. It should be noted that these data were extracted from the training dataset (n=163), and the concentrations are reported in log10 transform form to improve the reliability of the modeling and graphical representation.

[0244] When comparing newly obtained hsa-miR-34a-5p data obtained by standard PCR with data obtained by miPCR, we observed a strong correlation between the two datasets (corr=0.98), even with a slight shift. In summary, we observed strong correlations between data from all sources. Figure 2 ).

[0245] ANOVA modeling was performed on repeated measures. The results are summarized in Table 2 and presented graphically. Figure 3 middle.

[0246] Table 2: Head-to-head comparisons of miR34-a – ANOVA for repeated measures – n=163

[0247]

[0248] For simplicity, we assume that all three measurements were obtained simultaneously from the same serum samples for ANOVA modeling. This approach, assuming the sole source of difference is the method used, is not entirely accurate and explains why significance is reached here, although we can observe very similar distributions. Aside from this consideration, we observe that all three distributions are similar, with means of -0.138, -0.162, and -0.214. Furthermore, it is worth noting that while the ANOVA test concludes that the dataset used has a significant effect, Figure 3 The impact reported in the report is very low (η = 0.007, i.e. < 0.01), indicating that the impact is negligible.

[0249] Conclusion: Based on these results, we conclude that mathematical correction is needed to correct for the small offset of the hsa-miR34a-5p values ​​obtained by miPCR compared to those obtained from PCR.

[0250] 1.2. Analysis of YKL-40

[0251] Head-to-head graphical representations of three types of YKL-40 data were performed, and... Figure 4 The data is shown in the figure. It should also be noted that this data was extracted from the training dataset (n=163), and the concentrations are reported in log10 transform form to improve the reliability of the modeling and graphical representation.

[0252] Correlation and correspondence among YKL-40 values ​​obtained using ELISA technology ( Figure 4A) Very high, R²=0.96, linear regression close to y=x. This confirms the high robustness of the ELISA technique and its stability in quantifying YKL-40 over time. Strong correlation was also observed when comparing YKL-40 values ​​obtained by ELISA and miPCR techniques, respectively. Figure 4 (B, 4C). However, we observed an important bias: almost all values ​​obtained using miPCR assays were higher than those obtained using ELISA (except for two points), which required mathematical correction.

[0253] These graphical results were formalized using ANOVA modeling on repeated measures, as previously done for the hsa-miR34a-5p analysis. The results are summarized in Table 3 and presented graphically. Figure 5 middle.

[0254] Table 3: Head-to-head comparisons of YKL-40 – ANOVA for repeated measures – n=163

[0255]

[0256] ANOVA modeling confirmed that, for miR34-a, strong associations were observed among data from all sources. However, mathematical corrections are needed to correct for the small shift in the YKL-40 values ​​obtained via miPCR compared to those obtained using ELISA.

[0257] 2. Modeling for concentration correction

[0258] Because miPCR has a high linear correlation with the standard techniques used to quantify YKL-40 and hsa-miR-34a-5p, linear modeling was applied to provide an equation to correct for biomarker (BM) values ​​obtained using miPCR.

[0259] The equations derived from the linear regression trained on the training dataset, used to correct the two BM values, are as follows:

[0260]

[0261] To verify the mathematical corrections provided above, the new corrected concentrations extracted from miPCR were compared with data obtained using standard techniques. Figure 6 The report is presented in a graphical format.

[0262] Mathematical correction of the data from miPCR assays using linear regression equations showed that there was no longer any discrepancy between the concentrations of the two parameters quantified using standard techniques and the concentrations obtained from miPCR assays.

[0263] ANOVA modeling was performed to confirm that there was no bias between the standard technique and the corrected data obtained from miPCR on this training dataset. The results are summarized in Table 4 and reported graphically. Figure 7 middle.

[0264] Table 4: ANOVA results for the corrected concentrations of BM – n=163

[0265]

[0266] ANOVA modeling confirmed that the concentrations derived from miPCR were effectively corrected to match those obtained using standard techniques (i.e., PCR for hsa-miR-34a-5p and ELISA for YKL-40).

[0267] 3. Verification

[0268] The corrected model obtained in the training queue was then tested in the validation queue. The levels of hsa-miR-34a-5p and YKL-40, obtained by miPCR and corrected for by the linear regression described above, were compared with the levels of these biomarkers obtained by standard techniques.

[0269] The graph showing the correspondence between corrected miPCR data and data obtained using standard techniques is shown below. Figure 8 As shown. These results confirm the validity of the mathematical corrections obtained from the training dataset. The return values ​​are uniformly distributed around the y=x axis. The dataset of hsa-miR-34a-5p values ​​achieves very high correlation, and the value of YKL-40 is associated with a lower but still high correlation of 0.87.

[0270] ANOVA modeling was performed on repeated measures to formally validate the mathematical corrections. The results are summarized in Table 5 and presented graphically. Figure 9 middle.

[0271] Table 5: ANOVA results for the corrected concentration of BM – Validation (n=327)

[0272]

[0273] The mathematical correction applied to the two BM concentrations obtained via miPCR effectively corrected these values, returning concentrations similar to those obtained using standard techniques. In fact, for both BMs, we obtained no significant difference in distribution when comparing the corrected miPCR values ​​with those obtained using standard techniques. These results validate the mathematical correction and modeling obtained from the training dataset.

[0274] 4. NIS2+ score calculation

[0275] To further evaluate the accuracy of miPCR values, particularly corrected miPCR values, NIS2+ scores were compared, calculated from corrected miPCR BM values, uncorrected miPCR BM values, and BM values ​​obtained using standard techniques.

[0276] The corresponding diagram is shown graphically in Figure 10 In the middle. We are Figure 10 In C, it was observed that the two NIS2+ scores obtained using BM values ​​from standard techniques and corrected BM values ​​from miPCR techniques were highly correlated (corr=0.97 on the logit scale), with the midpoints well distributed around the y=x axis.

[0277] To further formalize and validate these results, ANOVA modeling with repeated measures was performed. The results are summarized in Table 6 and presented graphically. Figure 11 middle.

[0278] Table 6: ANOVA head-to-head results for NIS2+ – Validation (n=327)

[0279]

[0280] These results confirm that the mathematical correction applied to the miPCR data effectively provides NIS2+ values ​​similar to those obtained using standard techniques. It is important to note that the analysis was also performed on the logit scale, and no significant differences were found regarding the distribution of NIS2+ values ​​between the two groups. These data further validate the data modeling and mathematical correction.

[0281] Since biopsy results were indeed available for these patients, NIS2+ scores obtained from different measurement methods were compared with their clinical presentations to identify high-risk NASH patients (NAS score ≥4 and fibrosis stage ≥2). AUROC values ​​have been calculated and reported in Table 7.

[0282] Table 7: AUROC-validation of different NIS2+ for detecting high-risk NASH (n=327)

[0283]

[0284] No significant differences were observed in AUROC values ​​among NIS2+ scores obtained from different BM measurement methods, ranging from 0.807 to 0.814. To assess whether all NIS2+ scores obtained through different measurement methods resulted in similar clinical presentations, we calculated presentations in both exclusion and inclusion of high-risk NASH using the NIS2+ value cutoff described above. These results are reported in Figure 8.

[0285] Table 8: Comparison of Clinical Performance of NIS2+

[0286]

[0287] These results indicate that, compared to NIS2+ scores calculated from conventional BM measurements, NIS2+ scores based on BM directly quantified via miPCR were associated with increased sensitivity and decreased specificity. This performance difference was corrected for after applying mathematical corrections.

[0288] In summary, for both high-risk NASH patients excluded and included in this validation dataset, the NIS+ score obtained from the corrected miPCR BM provided clinical manifestations similar to those obtained using standard techniques.

Claims

1. A nucleic acid molecule comprising or composed of oligonucleotides having the following sequences: sequences SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, or containing sequences having at least 90% identity with SEQ ID NO: 1, 2 or 3.

2. The nucleic acid molecule according to claim 1, wherein the nucleic acid molecule further comprises a linker.

3. A DNA-antibody conjugate comprising (i) a nucleic acid molecule according to claim 1 or 2 and (ii) an antibody against a protein of interest.

4. The DNA-antibody conjugate according to claim 3, wherein the antibody is an anti-YKL-40 antibody.

5. An immunoPCR kit for detecting or quantifying protein targets, said kit comprising: - The DNA-antibody conjugate according to claim 3 or 4 - A pair of primers for amplifying the oligonucleotides of the DNA-antibody conjugate, and -Optionally one or more reaction buffers.

6. The immunoPCR kit of claim 5, wherein the kit further comprises a fluorescent nucleic acid probe that specifically binds to an oligonucleotide of the DNA-antibody conjugate, particularly the probe having the sequence of SEQ ID NO: 4, 9 or 10.

7. A multiplex immunoPCR kit for detecting or quantifying protein targets and nucleic acid targets, said kit comprising: - The DNA-antibody conjugate according to claim 3 or 4 - A pair of primers for amplifying the oligonucleotide of the DNA-antibody conjugate, - A pair of primers used to amplify the nucleic acid target, and -Optionally one or more reaction buffers.

8. The multiplex immunoPCR kit according to claim 7, wherein the kit further comprises: - A fluorescent nucleic acid probe that specifically binds to the oligonucleotide of the DNA-antibody conjugate, particularly having the sequence of SEQ ID NO: 4, 9, or 10, and - A fluorescent nucleic acid probe that specifically binds to the amplification product of the nucleic acid target.

9. The multiplex immunoPCR kit according to claim 7 or 8, wherein the kit comprises a pair of primers for amplifying miRNA, particularly hsa-miR-34, more particularly hsa-miR-34a, and even more particularly hsa-miR-34a-5p.

10. The multiplex immunoPCR kit according to any one of claims 7 to 9, wherein the DNA-antibody conjugate comprises an anti-YKL-40 antibody.

11. The multiplex immunoPCR kit according to any one of claims 7 to 10, wherein the kit further comprises: Internal control for the PCR process. - At least one positive control against hsa-miR-34, and - At least one positive control for YKL-40.

12. Use of the immunoPCR kit according to claim 5 or 6 for detecting or quantifying the level of a protein target in a sample.

13. The use of the multiplex immunoassay PCR kit according to any one of claims 7 to 11 for detecting or quantifying the levels of protein targets and nucleic acid targets in a sample, particularly for detecting or quantifying the levels of YKL-40 and hsa-miR-34 in a sample.

14. A method for quantifying the levels of protein targets and nucleic acid targets in a sample, the method comprising the following steps: - Contact the sample with the components of the multiplex immunoassay PCR kit according to any one of claims 7 to 11, - Perform multiplex immunoPCR to measure the levels of the protein target and the nucleic acid target.

15. A method for quantifying the levels of YKL-40 and hsa-miR-34 in a sample, the method comprising the following steps: - Contact the sample with the components of the multiplex immunoassay PCR kit according to any one of claims 9 to 11, - Perform multiplex immunoPCR to measure the levels of YKL-40 and hsa-miR-34.

16. A method for diagnosing nonalcoholic steatohepatitis (NASH) and / or for determining the activity, stage, or severity of NASH in a subject, and / or for classifying a subject as a recipient or non-recipient of NASH treatment, and / or for assessing the efficacy of medical treatment, and / or for determining the progression or regression of pathology in a patient with NASH, and / or for classifying a patient as a potential responder or non-responder to medical treatment, comprising measuring the levels of circulating hsa-miR-34 and YKL-40 in blood, serum, or plasma samples from said subject or patient, said method comprising the following steps: - Contact the sample with the components of the multiplex immunoassay PCR kit according to any one of claims 9 to 11, - Perform multiplex immunoPCR to measure the levels of YKL-40 and hsa-miR-34.

Images