Mononuclear fruiting pleurotus citrinopileatus strain and cultivation method
By isolating and cultivating the mononuclear Pleurotus ostreatus strain ZNS001, the problem of mononuclear fruiting of Pleurotus ostreatus has been solved, enabling in-depth research on the genetic laws of edible fungi and accelerating hybridization breeding.
Patent Information
- Application Number
- CN202511978783.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-25
- Publication Date
- 2026-03-03
- Estimated Expiration
- 2045-12-25
Smart Images

Figure CN121592503A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a mononuclear fruiting strain of Pleurotus ostreatus and its cultivation method. Background Technology
[0002] Golden-topped oyster mushroom, commonly known as elm yellow mushroom, belongs to the phylum Basidiomycota, class Agaricales, order Agaricales, family Pleurotaceae, and genus Pleurotus. It is a fungus used for both food and medicinal purposes, rich in protein and essential amino acids. Long-term consumption can lower blood pressure and cholesterol. Wild golden-topped oyster mushrooms grow on dead or fallen logs of broad-leaved trees such as elm and oak. They thrive in low to medium temperatures; the mycelium grows in the range of 5℃-32℃, with an optimum temperature of 20℃-25℃; the fruiting body forms and grows at temperatures between 8℃-22℃, with the best quality at 13℃-18℃. Cultivation of golden-topped oyster mushrooms includes agricultural and factory-style cultivation methods, categorized by cultivation containers as bag cultivation, bottle cultivation, and bed cultivation. The cultivation substrate is a mixture of corn cobs, cottonseed hulls, wheat bran, and corn flour in a specific ratio, providing the necessary carbon and nitrogen sources for growth. With the continuous development of science and technology, the related technologies of Golden Top Pleurotus ostreatus will continue to innovate, making greater contributions to the prosperity of the Golden Top Pleurotus ostreatus industry and people's healthy lives.
[0003] Common *Pleurotus ostreatus* mycelia include two types: monokaryotic and binucleate. Monokaryotic mycelia form from germinating basidiospores, with only one nucleus per cell. Monokaryotic mycelia grow slowly and generally do not produce fruiting bodies. Binucleate mycelia, on the other hand, form from plasmogamy between two different mating types of monokaryotic mycelia. Binucleate mycelia grow rapidly and can produce fruiting bodies under suitable conditions. The question of whether monokaryotic mycelia can produce fruiting bodies has prompted researchers to consider this. Previous studies have found that some *Flammulina velutipes* germplasm can produce fruiting bodies from monokaryotic mycelia. Monokaryotic mycelial cells contain only one set of chromosomes, resulting in a simple genetic background, which is beneficial for studying gene function, expression, and regulation. Furthermore, monokaryotic fruiting directly reflects the genetic characteristics of monokaryotic mycelia, helping to screen for monokaryotic mycelia with superior traits for hybridization breeding and shortening the hybridization selection process. However, no strains of Pleurotus ostreatus that can produce fruiting fruit from a single nucleus have been found. Therefore, the identification and cultivation of Pleurotus ostreatus can provide a deeper understanding of the genetic laws and developmental mechanisms of edible fungi, which is of great significance for the genetic improvement and variety selection of edible fungi. Summary of the Invention
[0004] The purpose of this invention is to provide a mononuclear fruiting Pleurotus ostreatus strain and its cultivation method to solve the problems existing in the prior art. For the first time, a mononuclear strain ZNS001 was isolated from a single spore of Pleurotus ostreatus. The mononuclear mycelium of this strain produces fruiting bodies, providing materials for studying the sexual reproduction and development process of fungi. It is also beneficial for screening large mycelia with excellent traits for hybridization breeding, thus shortening the hybridization breeding process.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides a single-nucleus fruiting Pleurotus citrinopileatus strain ZNS001, which has the accession number CGMCC No.42480, the accession date of which was December 23, 2025, and the depositary institution is the China General Microbiological Culture Collection Center, located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0007] Preferably, the cap of the *Pleurotus ostreatus* strain is trumpet-shaped with a diameter of 1.9-4.4 cm; the stipe is relatively short, with a length of 0.8-3.2 cm and a thickness of 0.5-3.9 cm.
[0008] The present invention also provides a method for cultivating the aforementioned *Pleurotus ostreatus* strain, comprising the following steps:
[0009] After activating the Pleurotus ostreatus strain, the mycelium-free spawn blocks were inoculated into culture bottles containing cottonseed hull substrate for mycelial growth. Once the mycelium had fully grown in the bottles, they were transferred to fruiting boxes for fruiting management.
[0010] The components of the cottonseed hull cultivation substrate include cottonseed hulls, wheat bran, and lime.
[0011] Preferably, the activation conditions are as follows: the *Pleurotus ostreatus* strain is inoculated into PDA medium and cultured in the dark at 28°C for 7 days.
[0012] Preferably, the cottonseed hull cultivation substrate comprises the following components by weight percentage: 94% cottonseed hulls, 5% wheat bran, and 1% lime; the moisture content of the cottonseed hull cultivation substrate is 63%-65%.
[0013] Preferably, the conditions for the mycelium incubation treatment are: room temperature incubation in the dark for 30-40 days, with a relative humidity of 60% to 70%.
[0014] Preferably, the conditions for mushroom cultivation management are: temperature of 15-20℃ and relative air moisture content of 90%-98%.
[0015] The present invention also provides the application of the aforementioned Pleurotus ostreatus strain in the cultivation and hybridization breeding of mononuclear Pleurotus ostreatus.
[0016] The present invention discloses the following technical effects:
[0017] The strain of this invention is ZNS001, the first strain isolated from *Pleurotus ostreatus*. Its hyphal cells lack cord-like fusion, and each cell contains only one nucleus. This strain belongs to *Pleurotus ostreatus*. Experiments have shown that the monokaryotic mycelium of this new species produces fruiting bodies, providing material for studying the sexual reproduction and developmental processes of fungi. This contributes to a deeper understanding of the biological processes of fungal cell differentiation and morphogenesis, thereby enabling more effective hybridization breeding.
[0018] The mononuclear strain ZNS001 isolated in this invention can produce fruiting bodies under normal conditions. The fruiting bodies are trumpet-shaped, with short stipes and inwardly rolled cap edges, which have their own unique characteristics compared to the dinuclear Pleurotus ostreatus, and the yield is considerable. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 Morphological and microscopic structure diagram of strain ZNS001 of this invention; Scale bar: 200 μm;
[0021] Figure 2 Image of DAPI staining in the nuclei of mycelial cells of strain ZNS001 of this invention; Scale bar: 200 μm;
[0022] Figure 3 Transmission electron microscopy image of the mycelial cell nucleus of strain ZNS001 of this invention; scale bar: 5.0 μm;
[0023] Figure 4 This is a phylogenetic tree diagram of the strain ZNS001 of this invention;
[0024] Figure 5 The images show the fruiting bodies of the control strain ZNS001 and the strain of this invention; A: Control mononuclear strain S02; BD: Left is binuclear strain D101, right is mononuclear strain ZNS001. Detailed Implementation
[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0028] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0029] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0030] Example 1
[0031] 1. Isolation and culture of mononuclear Pleurotus ostreatus strains
[0032] 1) Spore collection
[0033] Select robust, uncontaminated, 80% mature fruiting bodies. Using a sterilized inoculation knife in a laminar flow hood, cut the area where the cap and stipe meet. Wipe the surface of the fruiting body with 75% alcohol, rinse several times with sterile water, and then blot dry with sterile gauze. Place the cap gills down in a sterile Petri dish and cover. Incubate the Petri dish overnight in a dark environment at room temperature for 1–2 days. Once spores are observed falling into the Petri dish, remove the cap under sterile conditions to obtain spore imprints. Seal the Petri dish for later use.
[0034] 2) Spores were obtained and examined under a microscope using the single-spore dilution isolation method.
[0035] In a clean bench, open the petri dish containing the spore print, scrape a small amount of spore powder with an inoculation loop, and transfer it to a 1.5 mL centrifuge tube containing 1 mL of sterile water. Use a 1 mL pipette to mix the spores thoroughly to prepare a spore suspension. Then, divide the spore suspension into 10... -1 10 -2 10 -3 10 -4 Four dilutions were performed. For each dilution, 200 μL of spore suspension was evenly spread onto the surface of PDA medium using a spreader, with five replicates per dilution. The plates were incubated at 28°C in the dark for approximately 5 days. Single colonies were then picked and cultured on PDA medium for purification, and examined under a microscope twice.
[0036] 3) Microscopic examination method
[0037] Take the above-mentioned single-spore hyphae and inoculate them into a plate of culture medium with a coverslip inserted at an angle. When the hyphae just touch the coverslip, place the coverslip with hyphae facing down on a slide with a drop of sterile water. Observe the presence or absence of clamp connections using an inverted optical microscope. Strains without clamp connections are monokaryotic strains and are numbered for later use. The morphology and microstructure of strain ZNS001 are shown in [reference needed]. Figure 1 .
[0038] 2. Collection of microbial strains
[0039] The obtained monokaryotic strains were inoculated onto PDA medium, with ten replicates for each strain. They were cultured at 28°C in the dark for 5-7 days. Five plates with uniform growth and relatively round shape were selected for collection and stored in an ultra-low temperature freezer (-80°C). Additionally, each monokaryotic strain was transferred from PDA medium to PDA test tube medium for in vitro preservation in a low-temperature freezer (4°C) for immediate use, and simultaneously preserved in liquid nitrogen.
[0040] 3. Molecular biological identification of mycelium
[0041] The mononuclear strain ZNS001 was inoculated onto PDA culture medium and cultured in the dark at 28°C for 5-7 days. Its hyphal growth rate was slower than that of the binuclear strain Pleurotus ostreatus. Microscopic examination showed that its hyphal cells did not contain clamp connections.
[0042] (2) The mycelial cells were stained with 10 μM DAPI solution in the dark for 20 min and observed under excitation light of 358 nm and emission wavelength of 455 nm. DAPI staining revealed that the ZNS001 monokaryotic strain contained only one nucleus in its cells. (See...) Figure 2 .
[0043] (3) Biological transmission electron microscopy observation experiments showed that the ZNS001 mononuclear strain contained only one nucleus in its cells, see Figure 3 .
[0044] Using DNA from ZNS001 mycelial cells as a template, and ITS-F (5′-TCCGTAGGTGAACCTGCGG-3′, SEQ ID NO.2) and ITS-R (5′-TCCTCCGCTTATTGATATGC-3′, SEQ ID NO.3) as primers, PCR amplification was performed under the following conditions: 95℃ for 5 min, 1 cycle; 95℃ for 20 s, 60℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min, 1 cycle. The ITS sequence was obtained, and BLAST comparison showed that the ITS sequence of the sample had 100% homology with the Pleurotus citrinopileatus sequence in NCBI. The phylogenetic tree is shown below. Figure 4 This indicates that strain ZNS001 is a strain of Pleurotus ostreatus.
[0045] ITS sequence (SEQ ID NO.1):
[0046] TCCGTTTAGGGTACCTGCGGAAGGATCATTAATGAATTCGCTTTTGAAGCTGAATGCTGGCCCTTAGGGGCATGTGCACGCTTCATTAGTCCCCTTTCACACCCCTGTGCACCTTTGATAGATTCGCTGGAAAGACGGTCGCCTCACGGTGACTTGAACTCCGGTGGGTCTATAACCATTACACACACAAACGTATGTCTACGAATGTCATTTATATGGGCCATGCTGCCTATAAAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACCTACCTTTTGCTTTGCTGTAAATCGTAGTGTTTGGATTGTTGGGGGTTGCTGGCTTGTCACCGAGTCGGCTCCTCTTAAATGCATTAGCGGGACTTTGTTGTTGCCTCTGCTACATGGTGTGATAATTATCTACGCCAGACCGTACGCAATGATACTTATTGGAGTCCAGCTCTCTAATCGTCTTCGGACAGCTTTTTGACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCCGGAGGA。
[0047] 4. Detection of fruiting body morphological characteristics and detection results
[0048] (1)Detection of fruiting body morphological characteristics
[0049] The monokaryotic strain ZNS001 and the binuclear strain D101 were inoculated twice onto PDA medium for activation. After 7 days of mycelial growth, they were transferred to cottonseed hull cultivation bags, with ten replicates for each strain. Mycelial blocks were evenly cut using a 15 mm punch, and three blocks were placed in each bottle. After inoculation, the blocks were transferred to an incubation room for mycelial growth treatment, incubated at room temperature in the dark for 30-40 days (34 days in this example) at a relative humidity of 60%-70% (65% was used in this example). Frequent ventilation was maintained during mycelial growth to facilitate the removal of harmful gases and prevent the growth of contaminating bacteria. Once the mycelium had filled the bottles, they were transferred to an intelligent fruiting box for further cultivation. During this period, the temperature in the incubator was maintained at 15-20℃ and the air moisture content at 90%-98% (18℃ and 95% moisture content were used in this example). Once the primordia have risen, open the cultivation bag lid to manage the mushroom growth. Record and photograph the agronomic traits at different stages, including the primordia stage, the young mushroom stage, and the mature fruiting body stage. Finally, calculate the growth rate, growth period, etc.
[0050] The cottonseed hull culture medium formula used is: 94% cottonseed hulls, 5% wheat bran, 1% lime, with a moisture content of approximately 65%. Prepare 1kg cultivation bags (approximately 400g of dry material) using standard methods. (Cottonseed hull cultivation bags: Prepare and mix the materials according to the formula, controlling the moisture content to 63%–65%. After filling the bags, sterilize the medium in an autoclave at 121℃ for 2 hours, and then cool to 25℃ before inoculation.)
[0051] The mononuclear non-fruiting strain S02 was simultaneously inoculated using the same method as a control.
[0052] (2) Test results
[0053] like Figure 5 As shown in BD, the young fruiting body of *Pleurotus ostreatus* has a hemispherical cap, golden yellow in color, with a slightly involute edge. When mature, the cap becomes trumpet-shaped or funnel-shaped, 1.9-4.4 cm in diameter, with a smooth surface. The color gradually lightens towards the edge, becoming thin and involute. The flesh is milky white, with a certain degree of elasticity and toughness. The gills are decurrent, slightly dense, unequal in length and width, and milky white or pale yellow in color. The stipe is relatively short, cylindrical, nearly central, pale yellow, 0.8-3.2 cm long and 0.5-3.9 cm thick, solid internally, with radial fine striations on the surface, and without spores. Simultaneously, from... Figure 5 As can be seen from Figure A, the control group, *Pleurotus ostreatus*, did not produce fruiting fruit.
[0054] The results above show that, based on morphological, physiological, biochemical, and sequencing identification results, ZNS001 is a mononuclear Pleurotus ostreatus strain.
[0055] 5. Preservation
[0056] The strain ZNS001 was preserved using PDA slant test tubes. When the mycelium filled two-thirds of the test tube, it was stored in a refrigerator at 4°C. For ultra-low temperature preservation, mycelial blocks were cut and placed in cryovials containing 20% sterile glycerol and stored at -80°C.
[0057] The mononuclear Pleurotus citrinopileatus ZNS001 strain isolated and identified above was deposited on December 23, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42480, located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0058] Example 2
[0059] The mononuclear Pleurotus ostreatus strain ZNS001 and the binuclear Pleurotus ostreatus strain of the present invention were cultivated using the following cultivation method:
[0060] The strain was inoculated onto PDA solid medium. After two activation cycles, once the mycelium had fully colonized the plate, all the mycelium was transferred to 50ml of PDB liquid medium, homogenized, and incubated at room temperature for 1-2 days (1 day in this example). The inoculated mycelium was then transferred to cottonseed hull cultivation bags, with 10 replicates per strain. The inoculated bags were then transferred to an incubation room for mycelial growth, incubated at room temperature in the dark for 30-40 days (34 days in this example), with a relative humidity of 60%-70% (65% in this example). Frequent ventilation was maintained during mycelial growth to prevent the growth of contaminating bacteria. The time to full colony coverage was observed and recorded. Once the mycelium had fully colonized the bags, they were transferred to an intelligent fruiting box for alternating light and dark cultivation. During this period, the temperature in the incubator was 15-20℃, and the air moisture content was 90%-98% (18℃ and 95% in this example). After the primordia rise, open the cultivation bag lid to manage the fruiting process. Record and statistically analyze agronomic traits such as the time of primordia appearance and cap diameter at different stages: the primordia stage, the young mushroom stage, and the mature fruiting body stage.
[0061] PDB liquid culture medium preparation: 24g potato glucose broth powder, 1000mL deionized water; autoclave at 121℃ for 15min. PDA is based on PDB, with 15g agar added per liter for autoclaving.
[0062] The cultivation substrate for cottonseed hull cultivation bags is: 94% cottonseed hulls, 5% wheat bran, 1% lime, and a moisture content of about 65%. To make 1kg cultivation bags (about 400g of dry material), autoclave at 126℃ for 2 hours.
[0063] The time of primordia appearance and the time of mature fruiting body appearance were observed, and the average size of mature fruiting bodies were compared. The results are shown in Table 1 below.
[0064] Table 1. Phenotypic statistics of Pleurotus ostreatus fruiting
[0065]
[0066] The phenotypic data in Table 1 show that the primordia emergence time of strain ZNS001 is not significantly different from that of the dikaryotic strain. The average maturity time of the monokaryotic strain ZNS001 is 55 days, while that of the dikaryotic strain is 42 days. ZNS001 matures 13 days later than the dikaryotic strain, and its average cap diameter and stipe length are significantly smaller than those of the dikaryotic strain. It can be seen that strain ZNS001 of this invention successfully produced fruiting mushrooms and possesses unique characteristics compared to the dikaryotic strain *Pleurotus ostreatus*, with a very considerable yield. This is of great significance for screening monokaryotic mycelia with excellent traits for hybridization breeding and shortening the hybridization selection process.
[0067] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A mononuclear fruiting Pleurotus citrinopileatus strain, characterized in that, The preservation number of the *Pleurotus ostreatus* strain is CGMCC No. 42480.
2. The *Pleurotus ostreatus* strain as described in claim 1, characterized in that, The cap diameter of the *Pleurotus ostreatus* strain is 1.9-4.4 cm, the stipe length is 0.8-3.2 cm, and the stipe diameter is 0.5-3.9 cm.
3. A method for cultivating the *Pleurotus ostreatus* strain according to claim 1 or 2, characterized in that, Includes the following steps: After activating the Pleurotus ostreatus strain, the mycelium-free spawn blocks were inoculated into cultivation bags containing cottonseed hull substrate for mycelial growth. Once the mycelium had fully grown the bags, they were transferred to fruiting boxes for fruiting management. The components of the cottonseed hull cultivation substrate include cottonseed hulls, wheat bran, and lime.
4. The cultivation method as described in claim 3, characterized in that, The activation conditions are as follows: the *Pleurotus ostreatus* strain is inoculated into PDA medium and cultured in the dark at 28°C for 7 days.
5. The cultivation method as described in claim 3, characterized in that, The cottonseed hull cultivation substrate comprises the following components by weight percentage: 94% cottonseed hulls, 5% wheat bran, and 1% lime; the moisture content of the cottonseed hull cultivation substrate is 63%-65%.
6. The cultivation method as described in claim 3, characterized in that, The conditions for mycelial growth treatment are: room temperature incubation in the dark for 30-40 days, with a relative humidity of 60%-70%.
7. The cultivation method as described in claim 3, characterized in that, The conditions for mushroom cultivation management are: temperature of 15-20℃ and relative air moisture content of 90%-98%.
8. The application of the *Pleurotus ostreatus* strain as described in claim 1 or 2 in the cultivation and hybridization breeding of mononuclear *Pleurotus ostreatus*.
Citation Information
Patent Citations
Pleurotus citrinopileatus strain GX-WSW-ZP1422 and application thereof
CN117965319A
Pleurotus citrinopileatus strain and application thereof
CN120424781A
Process for preparing monokaryons by dedikaryotizing dikaryotic strains of Basidiomycetes
US4242832A