Engineering strain of animal bifidobacterium-derived breast milk oligosaccharide metabolism gene 1577 and application

Abstract

The invention discloses an animal bifidobacterium-derived breast milk oligosaccharide metabolism gene 1577 engineering strain and application, the breast milk oligosaccharide metabolism gene 1577 is derived from a breast milk oligosaccharide metabolism related gene of bifidobacterium, and the animal bifidobacterium-derived breast milk oligosaccharide metabolism gene 1577 engineering strain is constructed. And the engineering strain is utilized to realize efficient utilization of the HMOs, so that the application of the bifidobacterium in infant formula food and prebiotic products added with the HMOs in the future is promoted.

Description

Technical Field

[0001] This invention relates to the fields of metabolic engineering and synthetic biology, specifically to an engineered strain of animal Bifidobacterium derived from the human milk oligosaccharide metabolism gene 1577 and its applications. Background Technology

[0002] Human milk oligosaccharides (HMOs) are the third largest solid component in breast milk after lactose and fat, with a concentration of 20-23 g / L in colostrum and 12-14 g / L in mature milk. More than 200 different HMOs with varying structures have been identified; they are mainly composed of monosaccharides such as glucose, galactose, N-acetylglucosamine, fucose, and sialic acid. HMOs have a variety of important physiological functions, including promoting the growth of beneficial bacteria such as Bifidobacteria, inhibiting pathogen adhesion, regulating immune system development, protecting the intestinal barrier function, and promoting brain development.

[0003] Due to the significant functional value of HMOs, their addition to infant formula has become an industry trend. In 2015, the US FDA first approved 2'-fucosyllactose (2'-FL) for use in infant formula; in October 2024, the National Health Commission of China approved 2'-FL and lactose-N-neotetrasaccharide (LNnT) as new food fortifiers, marking the official launch of the Chinese HMO market.

[0004] Currently, the main methods for producing HMOs include chemical synthesis, enzymatic synthesis, and microbial fermentation. Among these, microbial fermentation has become the mainstream industrialization route due to its cost-effectiveness, sustainability, and accurate product structure. Existing technologies primarily use *Escherichia coli* as a host, synthesizing HMOs by introducing glycosyltransferase genes from pathogenic bacteria (such as *Helicobacter pylori* and *Neisseria meningitidis*).

[0005] Bifidobacteria, as important probiotics in the human gut, are natural consumers of HMOs, including Bifidobacterium longum subsp. infantis (Bifidobacterium infantis). Bifidobacterium longum Bifidobacterial subsp. *Infanis* possesses a complete HMO utilization gene cluster (containing 43 related genes). Bifidobacterial sugar-metabolizing enzymes exhibit unique substrate specificity and catalytic efficiency, giving them a natural advantage in HMO degradation and utilization. However, currently, no methods have been found to utilize Bifidobacterium... Bifidobacterium animalis A patented technology report describes the heterologous expression of HMO metabolism-related enzymes derived from F1-7 in Escherichia coli, thereby enabling efficient utilization of HMOs.

[0006] Heterologous expression of Bifidobacterium genes in Escherichia coli presents technical challenges: the high GC content of the Bifidobacterium genome (55-67%) differs significantly from that of E. coli (approximately 50%), leading to different codon usage preferences and potentially causing problems such as low translation efficiency and insufficient expression levels. Furthermore, the activity and stability of certain Bifidobacterium enzymes may be affected in heterologous hosts.

[0007] Currently, HMOs are expensive to produce, making it essential to develop a recombinant Escherichia coli strain to improve the utilization efficiency of HMOs. Summary of the Invention

[0008] The purpose of this invention is to overcome the shortcomings of the prior art and provide an engineered strain of human milk oligosaccharide metabolism gene 1577 derived from Bifidobacterium animalis and its application. The human milk oligosaccharide metabolism gene 1577 of this invention is derived from the human milk oligosaccharide metabolism-related genes of Bifidobacterium animalis, and an engineered strain of human milk oligosaccharide metabolism gene 1577 derived from Bifidobacterium animalis is constructed. The engineered strain is then used to achieve the efficient utilization of HMOs or their precursors, as well as the application of beneficial Bifidobacterium that can effectively utilize HMOs in infant formula and prebiotic products, which has important technical value and commercial significance.

[0009] To achieve the above objectives, the technical solution designed by the present invention is as follows: This invention provides a human milk oligosaccharide metabolism gene 1577 derived from Bifidobacterium animalis, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0010] The aforementioned gene 1577 encodes an enzyme with glucose metabolism activity.

[0011] The present invention also provides a recombinant expression vector pIJ23119-1577, wherein the recombinant expression vector pIJ23119-1577 is an expression vector containing gene 1577 as described in claim 1.

[0012] Furthermore, the expression vector is the pIJ23119 plasmid. The present invention also provides an engineered strain of human milk oligosaccharide metabolism gene 1577 derived from Bifidobacterium animalis, wherein the engineered strain contains the above-mentioned recombinant expression vector pIJ23119-1577.

[0013] This invention also provides a method for constructing the above-mentioned engineered strain of human milk oligosaccharide metabolism gene 1577 derived from Bifidobacterium animalis, comprising the following steps: 1) Using the genome of Bifidobacterium animalis as a template, PCR amplification was performed, and the amplified fragment 1577-23119 was recovered; 2) PCR amplification was performed using pIJ23119 plasmid as a template, and the amplified fragment 23119-1577 was recovered. 3) The 1577-23119 fragment and the 23119-1577 fragment were seamlessly cloned and ligated to obtain the recombinant expression vector pIJ23119-1577; 4) The recombinant expression vector pIJ23119-1577 was electroporated into MG1655 competent cells to obtain the 1577 engineered strain of human milk oligosaccharide metabolism gene derived from Bifidobacterium animalis.

[0014] Further, in step 1), the primer pair 1577-23119-F / R for PCR amplification is: 1577-23119-F: ACACAGGAAACAGCTATGATCAGCATGGCTGGTAAGGCAA, as shown in SEQ ID NO:2; 1577-23119-R: GTGGTGGTGGTGGTGGTGCGCATCAACCTCCTTGGAAGTG, as shown in SEQ ID NO:3.

[0015] Furthermore, in step 2), the PCR amplified 23119-1577-F / R is: 23119-1577-F: CACCACCACCACCACTGATAGAATTCACTGGCCGTCGTTTTAC, as shown in SEQ ID NO:4; 23119-1577-R: CAGCCATGCTGATCATAGCTGTTTCCTGTGTGAAAACTAG, as shown in SEQ ID NO:5.

[0016] The present invention also provides the application of the above-mentioned Bifidobacterium animalis-derived human milk oligosaccharide metabolism gene 1577 engineered strain in the utilization of human milk oligosaccharides or their precursors.

[0017] The present invention also provides a method for utilizing human milk oligosaccharides or their precursors, comprising the following steps: 1) Activate the above-mentioned Bifidobacterium animalis-derived human milk oligosaccharide metabolism gene 1577 engineered strain; 2) The activated engineered strain was inoculated into LB liquid medium for fermentation; the fermentation broth was collected. 3) The fermentation broth was centrifuged, filtered, and purified, and then metabolites were detected.

[0018] The present invention also provides the above-mentioned application in infant formula or prebiotic products containing human milk oligosaccharides or their precursors.

[0019] The beneficial effects of this invention are: 1. This invention, for the first time, utilizes the human milk oligosaccharide metabolism gene 1577 derived from Bifidobacterium animalis to construct an engineered strain in Escherichia coli, filling a technological gap. Bifidobacterial enzymes possess unique substrate specificity and catalytic efficiency, distinguishing them from existing pathogenic bacterial enzyme technologies.

[0020] 2. The strong constitutive promoter of the pIJ23119 plasmid of this invention enables continuous and efficient expression without the need for an inducer, simplifying the process and increasing the expression efficiency by 2-3 times; the microbial fermentation method uses a renewable carbon source, which is green and environmentally friendly and meets the requirements of sustainable development.

[0021] 3. The product obtained by this invention has multiple health benefits, such as promoting the growth of its own or other beneficial bacteria, anti-infection, immune regulation, intestinal protection, and promoting brain development, making formula-fed infants closer to the effect of breastfeeding, which is of great social significance. Attached Figure Description

[0022] Figure 1 Image showing the 1% agarose gel electrophoresis detection of the amplified fragment; In the image, from left to right, segments 23119-1577 and 1577-23119 are respectively. Figure 2 PCR identification of colonies of the recombinant expression vector pIJ23119-1577; Figure 3 The map of the recombinant expression vector pIJ23119-1577; Figure 4 Colony identification diagram of MG1655-1577-pIJ23119, an engineered strain of human milk oligosaccharide metabolism gene 1577 derived from Bifidobacterium animalis. Detailed Implementation The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0023] Example 1: Recombinant expression vector pIJ23119-1577 1. Using the genome of *Bifidobacterium animalis* as a template, PCR amplification was performed, and the amplified fragment 1577-23119 was recovered; the primer pair 1577-23119-F / R was: 1577-23119-F: ACACAGGAAACAGCTATGATCAGCATGGCTGGTAAGGCAA, 1577-23119-R: GTGGTGGTGGTGGTGGTGCGCATCAACCTCCTTGGAAGTG.

[0024] Amplification system: Amplification conditions: 94℃ for 5 min, 30 cycle (94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 40 sec), 10℃ holdon. 2. Using pIJ23119 plasmid as a template, PCR amplification was performed under the above amplification conditions, and the amplified fragment 23119-1577 was recovered; wherein, 23119-1577-F / R is: 23119-1577-F: CACCACCACCACCACTGATAGAATTCACTGGCCGTCGTTTTAC, 23119-1577-R: CAGCCATGCTGATCATAGCTGTTTCCTGTGTGAAAACTAG.

[0025] 3. Seamless cloning connection The amplified 1577-23119 and 23119-1577 fragments were seamlessly cloned and ligated according to the following procedure. After mixing, the fragments were placed on ice for 30 min, transformed into Ecoli DH5alphA competent cells, plated on Amp plates, and cultured at 37°C. Single clones were then picked for identification.

[0026] 4. Colony PCR identification Identification primers: M13-F:CCCAGTCACGACGTTGTTAAAACG 23119-JD-F2: AGTTAGCTCACTCATTAGGCACC Identifying positive clone 996bp ( Figures 2-3 ).

[0027] System: Pick a single clone and mix it into 10 μl of sterile water. Take 0.5 μl as a template and follow the system as follows: Amplification conditions: 94℃ 5min 30Cycle (94℃ 30sec, 55℃ 30sec, 72℃ 1min) 10℃ holdon.

[0028] Example 2: Construction of an engineered strain of human milk oligosaccharide metabolism gene 1577 derived from Bifidobacterium animalis The method for constructing the 1577 engineered strain of human milk oligosaccharide metabolism gene derived from Bifidobacterium animalis includes the following steps: 1.) Activate and culture Escherichia coli MG1655 at 37℃ 2.) Inoculate a single clone into 5 ml of LB liquid culture medium. 3) The next day, 1% was transferred to 50ml of LB liquid medium. After the OD reached approximately 0.8, the cells were collected by centrifugation. 3) Wash the bacterial cells three times with 10% glycerol, and finally resuspend the bacterial cells in 2 ml of 10% glycerol to obtain the prepared competent cells. 4) Electroconversion The recombinant expression vector pIJ23119-1577 was added to the prepared electroporation competent cells, placed on ice for 5 min, electroporated at 2500V, and then incubated in 1 ml of LB medium at 37℃ for 1 h. The cells were then plated on Amp plates to screen for overexpression strains, and the resulting clones were identified by colony PCR. 5) Colony identification Identification primers: 23119-JD-F:TGAAATACCGCACAGATGCGTAA 23119-JD-R:CAGCGAGTCAGTGAGCGAGGAAG like Figure 4 As shown: A positive clone of 1308 bp was identified, and an engineered strain MG1655-1577-pIJ23119 with the human milk oligosaccharide metabolism gene 1577 from Bifidobacterium animalis was obtained.

[0029] Example 3 A method for efficiently utilizing human milk oligosaccharides or their precursors includes the following steps: 1) Activate the above-mentioned Bifidobacterium animalis-derived human milk oligosaccharide metabolism gene 1577 engineered strain; 2) The activated engineered strain was inoculated into LB liquid medium for fermentation; the fermentation broth was collected. 3) The fermentation broth was centrifuged, filtered, and purified, and then metabolites were detected.

[0030] The target products obtained above have applications in multiple fields such as infant formula, prebiotics, functional foods, and pharmaceuticals and health care, and have huge market potential.

[0031] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A human milk oligosaccharide metabolism gene 1577 derived from Bifidobacterium animalis, characterized in that: The nucleotide sequence of gene 1577 is shown in SEQ ID NO:

1.

2. A recombinant expression vector pIJ23119-1577, characterized in that: The recombinant expression vector pIJ23119-1577 is an expression vector containing gene 1577 as described in claim 1.

3. The recombinant expression vector pIJ23119-1577 according to claim 2, characterized in that: The expression vector is the pIJ23119 plasmid.

4. An engineered strain of *Bifidobacterium animalis* containing the human milk oligosaccharide metabolism gene 1577, characterized in that: The engineered strain contains the recombinant expression vector pIJ23119-1577 as described in claim 2.

5. A method for constructing an engineered strain of *Bifidobacterium animalis* derived from the human milk oligosaccharide metabolism gene 1577 as described in claim 4, characterized in that: Includes the following steps: 1) Using the genome of Bifidobacterium animalis as a template, PCR amplification was performed, and the amplified fragment 1577-23119 was recovered; 2) PCR amplification was performed using pIJ23119 plasmid as a template, and the amplified fragment 23119-1577 was recovered. 3) The 1577-23119 fragment and the 23119-1577 fragment were seamlessly cloned and ligated to obtain the recombinant expression vector pIJ23119-1577; 4) The recombinant expression vector pIJ23119-1577 was electroporated into MG1655 competent cells to obtain the 1577 engineered strain of human milk oligosaccharide metabolism gene derived from Bifidobacterium animalis.

6. The construction method according to claim 5, characterized in that: In step 1), the primer pair 1577-23119-F / R for PCR amplification is: 1577-23119-F： ACACAGGAAACAGCTATGATCAGCATGGCTGGTAAGGCAA, 1577-23119-R： GTGGTGGTGGTGGTGGTGCGCATCAACCTCCTTGGAAGTG.

7. The construction method according to claim 5, characterized in that: In step 2), the PCR amplified 23119-1577-F / R is: 23119-1577-F： CACCACCACCACCACTGATAGAATTCACTGGCCGTCGTTTTAC, 23119-1577-R： CAGCCATGCTGATCATAGCTGTTTCCTGTGTGAAAACTAG.

8. The use of the Bifidobacterium animalis strain 1577, which is derived from the human milk oligosaccharide metabolism gene, as described in claim 4, in the utilization of human milk oligosaccharides or their precursors.

9. A method for utilizing human milk oligosaccharides or their precursors, characterized in that: Includes the following steps: 1) Activate the 1577 engineered strain of animal Bifidobacterium sourced from human milk oligosaccharide metabolism as described in claim 4; 2) The activated engineered strain was inoculated into LB liquid medium for fermentation culture; The fermentation broth was collected; 3) The fermentation broth was centrifuged, filtered, and purified to obtain the target product, and metabolites were detected.

10. The use of the product described in claim 9 in infant formula or prebiotic products containing human milk oligosaccharides or their precursors.

Images