Application of nog9 protein and its coding gene in regulating yield of rice

Abstract

The application discloses application of NOG9 protein and a coding gene thereof in yield regulation of rice, and relates to the technical field of biology. The application provides application of NOG9 protein in yield regulation of rice, wherein the amino acid sequence of the NOG9 protein is shown as SEQ ID No. 1, NOG9 The nucleotide sequence of the gene is shown as SEQ ID No. 2, NOG9 The coding sequence of the gene is shown as SEQ ID No. 3. The application improves the yield of rice by inhibiting or reducing or down-regulating the activity of the protein NOG9 or the expression amount of the coding gene thereof in the rice, and provides a basis for crop high-yield breeding.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of the NOG9 protein and its encoding gene in regulating rice yield. Background Technology

[0002] Discovering superior rice yield-regulating genes, elucidating the molecular mechanisms of rice yield regulation, and identifying a batch of new genes to apply in rice breeding are important measures to broaden the genetic background of existing materials, break the shackles of high-yield rice breeding, and cultivate new high-yield rice varieties to ensure food security. Summary of the Invention

[0003] To address the aforementioned shortcomings in the existing technology, this invention provides the application of NOG9 protein and its encoding gene in regulating rice yield. This invention increases rice yield by inhibiting, reducing, or downregulating the activity of the NOG9 protein or the expression level of its encoding gene in the target rice, thus providing a foundation for high-yield crop breeding.

[0004] To achieve the above objectives, the technical solution adopted by the present invention to solve its technical problem is: the application of NOG9 protein in at least one of the following (1)-(5):

[0005] (1) Application in regulating rice yield;

[0006] (2) Application in the preparation of products that regulate rice yield;

[0007] (3) Application in cultivating rice with altered yield;

[0008] (4) Application in the preparation of products using rice with altered yields;

[0009] (5) Application in rice breeding

[0010] The amino acid sequence of the NOG9 protein is shown in SEQ ID No. 1.

[0011] Furthermore, the NOG9 protein is derived from rice.

[0012] Furthermore, the rice is the rice infiltration line TIL103, a Teqing indica rice variety.

[0013] Furthermore, the NOG9 protein negatively regulates rice yield.

[0014] The gene encoding the above NOG9 protein is used in at least one of the following (1)-(5):

[0015] (1) Application in regulating rice yield;

[0016] (2) Application in the preparation of products that regulate rice yield;

[0017] (3) Application in cultivating rice with altered yield;

[0018] (4) Application in the preparation of products using rice with altered yields;

[0019] (5) Application in rice breeding.

[0020] Furthermore, the nucleotide sequence of the above-mentioned gene is shown in SEQ ID No. 2, and the coding sequence of the gene is shown in SEQ ID No. 3.

[0021] The above-mentioned NOG9 protein-related biomaterials are used in at least one of the following (1)-(5):

[0022] (1) Application in regulating rice yield;

[0023] (2) Application in the preparation of products that regulate rice yield;

[0024] (3) Application in cultivating rice with altered yield;

[0025] (4) Application in the preparation of products using rice with altered yields;

[0026] (5) Application in rice breeding.

[0027] Furthermore, the biomaterial is at least one of the following (1)-(12):

[0028] (1) An expression cassette containing a gene encoding the NOG9 protein;

[0029] (2) A recombinant expression vector containing a gene encoding the NOG9 protein;

[0030] (3) A recombinant expression vector containing the expression cassette described in (1);

[0031] (4) Recombinant microorganisms containing genes encoding the NOG9 protein;

[0032] (5) Recombinant microorganisms containing the expression cassette described in (1);

[0033] (6) Recombinant microorganisms containing the recombinant expression vector described in (2) or (3);

[0034] (7) Transgenic plant cell lines containing genes encoding NOG9 protein;

[0035] (8) A transgenic plant cell line containing the expression cassette described in (1);

[0036] (9) Transgenic plant tissue containing a gene encoding the NOG9 protein;

[0037] (10) Transgenic plant tissue containing the expression cassette described in (1);

[0038] (11) Transgenic plant organs containing a gene encoding the NOG9 protein;

[0039] (12) Transgenic plant organs containing the expression cassette described in (1).

[0040] Furthermore, in the recombinant microorganism, the competent cells used were Agrobacterium EHA105.

[0041] The NOG9 protein described above can be replaced with any of the following proteins:

[0042] (1) A protein having the same function by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 1;

[0043] (2) Proteins that have more than 80% identity with NOG9 protein or the amino acid sequence defined in (1) and have the same function;

[0044] (3) A fusion protein obtained by attaching a tag to the end of the NOG9 protein and any of the proteins defined in (1)-(2).

[0045] The nucleic acid molecules encoding the NOG9 protein described above include any of the following DNA molecules:

[0046] (1) The nucleotide sequence is the DNA molecule shown in SEQ ID No. 2;

[0047] (2) The coding region sequence is the DNA molecule shown in SEQ ID No. 3 in the sequence listing;

[0048] (3) A DNA molecule that has 90% or more identity with the nucleotide sequence defined in (1) or (2) and encodes the protein described above;

[0049] (4) A DNA molecule that hybridizes under strict conditions to the nucleotide sequence defined in (1) or (2) and encodes the protein described above.

[0050] Furthermore, the aforementioned nucleic acid molecules are DNA or RNA, the aforementioned DNA is cDNA, genomic DNA or recombinant DNA, and the aforementioned RNA is gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0051] Furthermore, vectors include plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cos plasmids), Ti plasmids, and viral vectors.

[0052] Furthermore, the vector is pCAMBIA1300, pTCK303, or pCAMBIA1301.

[0053] Recombinant expression vectors containing the NOG9 gene were constructed using existing plant expression vectors, including binary Agrobacterium vectors and vectors that can be used for plant micro-bombardment.

[0054] Furthermore, plant expression vectors may also contain the 3' untranslated region of the exogenous gene, which includes the polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression.

[0055] Furthermore, polyadenylation signaling can guide polyadenylation to be added to the 3' end of mRNA precursors. For example, the untranslated regions transcribed at the 3' end of Agrobacterium crown gall tumor-inducing (Ti) plasmid genes (such as the Nos gene for lipase synthase) and plant genes (such as the soybean storage protein gene) have similar functions.

[0056] When constructing recombinant plant expression vectors using the NOG9 gene, any enhancing or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0057] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0058] A method for altering rice yield includes the following steps: increasing rice yield by inhibiting, reducing, or silencing the activity and / or content of NOG9 protein in rice, and / or inhibiting, reducing, or downregulating the expression of the gene encoding NOG9 protein.

[0059] Furthermore, to increase rice yield, it is necessary to increase the number of grains per panicle, with the number of grains per panicle being the number of grains per main stem panicle.

[0060] Furthermore, reducing the expression level of the NOG9 protein-coding gene in rice involves using gene mutation, gene knockout, gene editing, or gene knockdown techniques to decrease or inactivate the NOG9 protein-coding gene in the rice genome.

[0061] A method for breeding high-yield rice includes obtaining high-yield rice by inhibiting, reducing or downregulating the expression level of the gene encoding NOG9 protein in rice, and / or the activity and / or content of NOG9 protein.

[0062] Furthermore, the expression of the gene encoding the NOG9 protein in rice can be inhibited, reduced, or silenced by methods including: introducing the above-mentioned expression cassette or recombinant expression vector into rice to obtain high-yielding rice.

[0063] In summary, the present invention has the following beneficial effects:

[0064] 1. This invention clones a yield-related gene from wild rice species *Oryza sativa*. NOG9 Encoding TCP family transcription factors. Through construction NOG9 Genomic complementation vector (recombinant vector CTP-) NOG9 Transgenic plants were introduced into the indica rice variety Teqing. After obtaining T0 generation transgenic plants, they were self-crossed for two generations to obtain T2 generation transgenic plants. The positive transgenic plants in the T2 generation showed reduced yield compared to the control Teqing. A gene overexpression vector (recombinant vector OE-) was constructed. NOG9 The transgenic plants were transferred into the indica rice variety Teqing. After obtaining T0 generation transgenic plants, they were self-crossed twice to obtain T2 generation transgenic plants. The positive transgenic plants in the T2 generation showed reduced yields compared to the control Teqing. [The text then abruptly shifts to a different topic:] ...constructing... NOG9 Gene expression interference vector (recombinant vector RNAi-) NOG9 The transgenic plants were transferred into the introgression line TIL103. After obtaining T0 generation transgenic plants, they were self-crossed for two generations to obtain T2 generation transgenic plants. The positive transgenic plants in the T2 generation had increased yields compared with the control introgression line TIL103.

[0065] 2. The NOG9 protein and its encoding gene of this invention regulate rice yield, which is of great significance in the study of the molecular mechanism of high yield in plants and in the breeding of high-yield crops. Attached Figure Description

[0066] Figure 1 A comparison diagram of the plant types of Teqing and TIL103;

[0067] Figure 2 Comparison of main stem and spike morphology between Teqing and TIL103;

[0068] Figure 3 Statistical analysis chart of plant height, number of effective panicles, number of grains per panicle on main stem and yield data for Teqing and TIL103;

[0069] Figure 4 A comparison diagram of the plant types of Teqing and Teqing CTP;

[0070] Figure 5 A comparison diagram of the main stem and panicle morphology of Teqing and Teqing CTP;

[0071] Figure 6 Statistical analysis charts of plant height, number of effective panicles, number of grains per panicle on the main stem, and yield data for Teqing and Teqing CTP varieties;

[0072] Figure 7 A comparison diagram of the plant types of Teqing and Teqing OE;

[0073] Figure 8 A comparison diagram of the main stem and spike morphology of Teqing and Teqing OE;

[0074] Figure 9 Statistical analysis charts of plant height, number of effective panicles, number of grains per panicle on the main stem, and yield data for Teqing and Teqing OE varieties;

[0075] Figure 10 For the penetration system TIL103 and TIL103 RNAi Plant type comparison chart;

[0076] Figure 11 For the penetration system TIL103 and TIL103 RNAi Comparison of main stem and spike morphology;

[0077] Figure 12 For the penetration system TIL103 and TIL103 RNAi Statistical analysis chart of plant height, number of effective panicles, number of grains per panicle on main stem and yield data; Detailed Implementation

[0078] The principles and features of this invention are described below. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, specific conditions in the examples are performed under conventional conditions or conditions recommended by the manufacturer. Reagents or instruments used, unless otherwise specified, are all commercially available products.

[0079] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0080] The biomaterials involved in the following embodiments:

[0081] The rice variety “Teqing” is described in the following literature: Jiang LY, Ma X., Zhao SS, Tang Y.Y., Liu FX, Gu P., Fu YC, Zhu ZF, Cai HW, Sun CQ and Tan LB (2019) The APETALA2-like transcription factor SUPERNUMERARY BRACT controls rice seed shattering and seed size. Plant cell, 31: 17–36.

[0082] The Nivara wild rice introgression line TIL103 in the following examples has been documented in: Guo Daokuan, Rice panicle grain number gene. NOG9 Cloning and functional studies, doctoral dissertation, 2024. The biological material is available to the public from the applicant and is intended solely for the purpose of replicating the experiments of this invention and may not be used for any other purpose.

[0083] The plant expression vector pCAMBIA1300 used in the following examples has been described by: Yang Q, Chen ZZ, Zhou XF, Yin HB, Li X, Xin XF, Hong XH, Zhu JK and Gong ZZ. Overexpression of SOS (Salt Overly Sensitive) Genes Increases Salt Tolerance inTransgenic Arabidopsis Molecular Plant, 2009, 2: 22–31. The biological material is available to the public from the applicant and is intended solely for the purpose of replicating the experiments of this invention and may not be used for any other purpose.

[0084] The plant expression vectors pCAMBIA1301 and pTCK303 have been described in: Jiang L, Ma X, Zhao S, Tang Y, Liu F, Gu P, Fu Y, Zhu Z, Cai H, Sun C, Tan L. The APETALA2-like transcription factor SUPERNUMERARY BRACT controls rice seed shattering and seed size. Plant Cell, 2019, 31(1): 17–36. The biological materials are available to the public from the applicant and are intended solely for the purpose of replicating the experiments of this invention and shall not be used for any other purpose.

[0085] The following examples use R (version v4.4.0) statistical software to process the data. Experimental results are expressed as mean ± standard deviation. t -test method, P <0.05 (*) indicates a statistically significant difference. P <0.01 (**) indicates a statistically significant difference. P <0.001 (***) indicates that the difference is statistically significant.

[0086] Example 1 Rice Yield Gene NOG9 Cloning

[0087] This experiment utilized the *Nivara* wild rice (described in: Ma X., Fu YC, Zhao XH, Jiang L.Y., Zhu ZF, Gu P., Xu WY, Su Z., Sun CQ and Tan LB (2016)) Genomic structure analysis of a set of OryzanivaraUsing the introgression lines and identification of yield-associated QTLs using whole-genome resequencing. SciRep, 6:27425.) as the male parent, and the widely cultivated indica rice variety "Teqing" bred by the Guangdong Academy of Agricultural Sciences as the recurrent parent, hybrid combinations were constructed. After three consecutive backcrosses and three self-pollinations, a Niwara wild rice introgression line with Teqing as the background was established. The yield-decreasing introgression line TIL103 was successfully screened (the construction method of Niwara wild rice introgression lines and the screening of important agronomic traits have been recorded in: Zhao Jing, Construction of annual wild rice introgression lines with Teqing as the background and preliminary location of important agronomic trait QTLs, Doctoral Dissertation, 2011). The results are as follows: Figures 1-3 As shown. Among them, Figure 1 A comparison diagram of the plant types of Teqing and TIL103; Figure 2 Comparison of main stem and spike morphology between Teqing and TIL103; Figure 3 In the figure, a and b represent statistical analysis data on plant height, effective panicle number, grain number per panicle on the main stem, and yield of Teqing and TIL103, respectively. Subsequently, an F-type model was constructed using the introgression line TIL103 and the indica rice variety Teqing. 2:3 A population cloned a yield-regulating gene on chromosome 9 and named it. NOG 9. Its genome sequence is shown in SEQ ID No. 2. Its coding sequence (CDS) is shown in SEQ ID No. 3, and the amino acid sequence encoding the protein is shown in SEQ ID No. 1. It is named NOG9 protein.

[0088] Example 2 CTP- NOG 9. Obtaining the recombinant vector

[0089] 1. CTP- NOG 9. Construction of complementary carriers

[0090] Primers were designed based on the NOG9 genome sequence (SEQ ID No. 2), and restriction endonucleases were introduced at both ends of the primers. Kpn I, Xba I. Identify the recognition site and the vector homologous recombination fragment, and design the primer sequences as follows:

[0091] CTPF: 5'- ATGATTACGAATTCGAGCTCGGTACC AGATATATACTGTGTCTC-3' (SEQ ID No. 4, underlined bases are homologous recombination fragments with the vector and restriction endonuclease) Kpn I. Identification site);

[0092] CTPR: 5'- GCCTGCAGGTCGACTCTAGAGGATCCCCCAGAGTCTGAACAATGAAG-3' (SEQ ID No. 5, the underlined base is a homologous recombination fragment with the vector and a restriction endonuclease) Bam HI recognition site).

[0093] DNA was extracted from the leaves of the introgression line TIL103 using the CTAB method. Using this as a template, the DNA was amplified using primers CTPF and CTPR to obtain SEQ ID No.2 (fragment length 3923 bp).

[0094] use Kpn I, Bam The empty vector pCAMBIA1300 was digested with HI enzyme, and the amplified fragment and the digested pCAMBIA1300 linear vector fragment were recovered by gel extraction. The recovered products were then ligated using a homologous recombinase and sequenced. This yielded a product containing rice... NOG A 9-gene fragment genome complementation vector was named CTP- NOG9 .

[0095] Recombinant vector CTP- NOG9 It is a restriction endonuclease of the pCAMBIA1300 vector. Kpn I enzyme recognition site and Bam The recombinant vector was obtained by replacing the small fragment between the HI enzyme recognition sites with SEQ ID No. 2, while keeping the other sequences of the pCAMBIA1300 vector unchanged.

[0096] The recombinant vector CTP- NOG9 Transfected with Agrobacterium EHA105, the product containing the recombinant vector CTP- was obtained. NOG9 Agrobacterium EHA105, abbreviated as Agrobacterium EHA105 / CTP- NOG9 .

[0097] 2. NOG9 Construction of gene overexpression vectors

[0098] according to NOG9 Primers were designed based on the full-length cDNA sequence of the gene, and restriction endonucleases were introduced at both ends of the primers. Bam HI and Sac I. Identification site and vector homologous recombination fragment, primer sequences are as follows:

[0099] OEF: 5'- TTCTGCAGGTCGACTCTAGAGGATCC ATGCAGCAGCAGCTGGATCAG-3' (SEQ ID No. 6, the underlined base is a restriction endonuclease) Bam HI recognition site and homologous recombination fragment with vector);

[0100] OER: 5'- GAGCGGCCGCCACCGCGGTGGAGCTC CTAATATTGCATACCGTCCAAG-3' (SEQ ID No. 7, the underlined base is a restriction endonuclease) Sac I. Identification site and homologous recombination fragment with vector).

[0101] Total RNA was extracted from leaves of the introgression line TIL103 using TRIZOL reagent. Using this RNA as a template, cDNA was obtained by reverse transcription using SuperScript II reverse transcriptase (Invitrogen, Cat no. 18064-014). This cDNA was then amplified using primers OEF and OER to amplify rice... NOG9 The coding sequence of the gene (SEQ ID No. 3, fragment length 729 bp). The above 729 bp DNA fragment was cloned into the multiple cloning site of the plant expression vector pCAMBIA1301. Bam HI and Sac Between the I restriction sites, rice was obtained NOG9 The gene overexpression vector is named OE- NOG9 (Also known as recombinant vector OE-) NOG9 The specific method is as follows;

[0102] Use the carrier pCAMBIA1301 Bam HI and Sac Double digestion with enzyme I yielded the digested vector. The amplified fragment (SEQ ID No. 3) and the digested linear vector fragment were recovered from the gel. The recovered products were then ligated using a homologous recombinase. The ligation product was transformed into *E. coli* DH5α (Qingke Biotechnology Co., Ltd., catalog number TSC-C01) for screening and sequencing. The correctly sequenced recombinant vector was named OE- NOG9 .

[0103] Recombinant vector OE- NOG9 It is the restriction enzyme digestion of the pCAMBIA1301 vector. Bam HI enzyme recognition sites and Sac The small fragment between the I enzyme recognition sites is replaced by a nucleotide sequence that is the DNA molecule of SEQ ID No. 3. NOG9 The recombinant vector was obtained by extracting the encoding gene and keeping the rest of the pCAMBIA1301 vector unchanged.

[0104] Recombinant vector OE- NOG9 Transfected with Agrobacterium EHA105, it yielded a product containing the recombinant vector OE- NOG9 Agrobacterium EHA105, also known as Agrobacterium EHA105 / OE- NOG9 .

[0105] 3. NOG9 Construction of gene expression interference vector

[0106] according to NOG9 Primers were designed based on the CDS sequence, and the primer sequences are as follows:

[0107] RNAi-1F: TTCTGCAGGTCGACTCTAGAGGATCC CTTCTCCTCCGGTGTTGTTG-3' (SEQ ID No. 8, the underlined base is a restriction endonuclease) Bam HI recognition site and homologous recombination fragment with vector);

[0108] RNAi-1R: GCAGATCTGTCGACCTCGAGGGTACC CGGATCAGGGAAAGGAGAC-3' (SEQ ID No. 9, the underlined base is a restriction endonuclease) Bam HI recognition site and homologous recombination fragment with vector);

[0109] RNAi-2F: TTTCGAGATTTTCAATCGATACTAGT CGGATCAGGGAAAGGAGAC-3' (SEQ ID No. 10, the underlined base is a restriction endonuclease) Bam HI recognition site and homologous recombination fragment with vector);

[0110] RNAi-2R: TTGAACGATCGGGGAAATTCGAGC TCCTTCTCCTCCGGTGTTGTTG-3' (SEQ ID No. 11, the underlined base is a restriction endonuclease) Bam HI recognition site and homologous recombination fragments with vector).

[0111] Total RNA was extracted from leaves of the introgression line TIL103 using TRIZOL reagent. Using this RNA as a template, cDNA was obtained by reverse transcription using SuperScript II reverse transcriptase (Invitrogen, Cat no. 18064-014). Using this cDNA as a template, the cDNA was amplified using primers RNAi-1F and RNAi-1R to obtain fragment 1 (SEQ ID No. 12, fragment length 164bp). The cDNA was then amplified using primers RNAi-2F and RNAi-2R to obtain fragment 2 (SEQ ID No. 13, fragment length 164bp).

[0112] Interference vector pTCK303 with restriction enzyme Spe I and SacThe linearized vector digested with restriction enzyme 1 underwent homologous recombination with fragment 2. The ligation product was transformed into *E. coli* DH5α (Qingke Biotechnology Co., Ltd., catalog number TSC-C01) for screening and sequencing. Plasmids were extracted from bacterial cultures where fragment 2 was successfully ligated and then processed using restriction enzymes. Bam HI and Kpn The linearized vector digested with enzyme I underwent homologous recombination with fragment 2. The ligation product was transformed into E. coli DH5α (Qingke Biotechnology Co., Ltd., catalog number TSC-C01) for screening and sequencing.

[0113] Recombinant vector RNAi- NOG9 It is to use the interfering vector pTCK303 restriction enzyme Spe I and Sac The sequence between the I recognition sites is replaced with fragment 1 (as shown in SEQ ID No. 12, the fragment is 164 bp long), which will replace the restriction enzyme. Bam HI and Kpn The sequence between the I recognition sites was replaced with fragment 2 (as shown in SEQ ID No. 13, fragment length 164 bp), and the rest of the pTCK303 vector sequence remained unchanged to obtain the recombinant vector, which was named recombinant vector RNAi- NOG9 .

[0114] Recombinant vector RNAi- NOG9 Transfected into Agrobacterium EHA105, it yielded RNAi containing the recombinant vector. NOG9 Agrobacterium EHA105, also known as Agrobacterium EHA105 / RNAi-NOG9.

[0115] Example 3 NOG9 Acquisition and identification of genetically modified rice

[0116] 1. Preparation of callus tissue from the indica rice variety Teqing

[0117] (1) The seeds of the indica rice variety Teqing were placed in a 45℃ oven for 7 days to break dormancy.

[0118] (2) After removing the seed coat with the silage machine, place it in a 100 mL Erlenmeyer flask.

[0119] (3) After disinfecting with 75% alcohol for 3 min, replace with 20% sodium hypochlorite solution and disinfect with shaking on a shaker at 37℃ for 20 min.

[0120] (4) Rinse the seeds several times with sterile water in a laminar flow hood until the sodium hypochlorite residue on the seed surface is washed away, and then air dry them in a petri dish lined with sterile filter paper.

[0121] (5) Spread about 30-50 dried seeds evenly on the surface of NB basic culture medium.

[0122] (6) After one week of dark culture at 28°C, the callus tissue that grows from the embryo is peeled off onto a new NB basic culture medium and cultured for another 2 days before infection.

[0123] NB culture medium formula:

[0124] NB medium: 4.1 g NB powder, 0.3 g hydrolyzed casein, 0.5 g glutamine, 0.6 g proline, 30 g sucrose, 2 mg 2,4-D, 4.5 g plant gel. Adjust pH to 5.9, bring volume to 1 L with ddH2O, and autoclave at 121℃ for 20 min.

[0125] 2. Agrobacterium infection

[0126] Agrobacterium EHA105 / CTP- obtained in Example 1 were used respectively. NOG9 EHA105 / OE- NOG9 and EHA105 / RNAi- NOG9 The prepared indica rice variety Teqing was infected with callus tissue alone. Hygromycin 20 mg / L was added to the culture medium to screen for resistant callus tissue. The resistant callus (dense, hard, large granular or blocky callus tissue) was transferred to differentiation medium and cultured for about one month. The differentiated seedlings were then transferred to rooting medium and cultured for two weeks before being transplanted to the field for continued growth. One leaf was taken from each seedling in the field, and DNA was extracted using the CTAB method. This DNA was then used as a template for PCR amplification using hygromycin primers HYGF: GATGTTGGCGACCTCGTATT (SEQ ID No. 14) and HYGR: CTCGATGAGCTGATGCTTTG (SEQ ID No. 15). Seedlings showing a band of approximately 200 bp after electrophoresis were identified as positive transgenic seedlings. CTP- was obtained through this method. NOG9 OE- NOG9 and RNAi- NOG9 The transgenic positive plants of each vector were named Teqing CTP, Teqing OE, and TIL103, respectively. RNAi .

[0127] 3. Yield identification of transgenic rice plants

[0128] The above-obtained Special Youth CTP, Special Youth OE and TIL103 RNAi T2 generation seeds from T0 generation positive transgenic families were self-pollinated twice and planted in standardized experimental fields in Beijing or Hainan, with a row spacing of 25 cm and a plant spacing of 16 cm. After maturity, each of the following transgenic lines (T0, T0, T0, T2, T103, T2 ... RNAiTwo replicates were used for each measurement, with at least 10 individual plants in each replicate. The measured phenotypes included plant height, number of effective panicles, number of grains per panicle on the main stem, and yield per plant. The results of the comparison of agronomic traits between Teqing CTP and the indica rice variety Teqing are as follows: Figures 4-6 As shown, where, Figure 4 This is a comparison chart of the plant types of Teqing and Teqing CTP. Figure 5 This is a comparison diagram of the main stem and panicle morphology of Teqing and Teqing CTP. Figure 6 In the figure, a and b represent statistical analysis data on plant height, effective panicle number, grain number per panicle on the main stem, and yield of Teqing and Teqing CTP varieties, respectively. The comparison results of agronomic traits between Teqing OE and the indica rice variety Teqing are shown below. Figures 7-9 As shown, where, Figure 7 This is a comparison chart of the plant types of Teqing and Teqing OE. Figure 8 This is a comparison chart of the main stem and spike morphology of Teqing and Teqing OE varieties. Figure 9 In the figure, ad represents a statistical analysis of plant height, number of effective panicles, number of grains per panicle on the main stem, and yield data for both Special Green and Special Green OE varieties. (TIL103) RNAi The results of the comparison of agronomic traits between the indica rice variety and the Teqing variety are as follows: Figures 10-12 As shown, where, Figure 10 For the penetration system TIL103 and TIL103 RNAii Plant type comparison chart Figure 11 For the penetration system TIL103 and TIL103 RNAi Comparison of main stem and spike morphology diagrams Figure 12 In the diagram, ad represents the penetration systems TIL103 and TIL103, respectively. RNAi Statistical analysis chart of plant height, number of effective panicles, number of grains per panicle on main stem, and yield data.

[0129] Depend on Figures 4-6 It can be seen that, compared with the control Teqing, the complementary transgenic family Teqing CTP showed no difference in plant height and effective panicle number, but the number of grains per panicle on the main stem and the yield per plant were reduced.

[0130] Depend on Figures 7-9 It can be seen that, compared with the control Teqing, the plant height of the overexpressing transgenic family Teqing OE was not different, the number of effective panicles increased, but the number of grains per panicle on the main stem and the yield per plant decreased.

[0131] Depend on Figures 10-12 It can be seen that, compared with the control introgression line TIL103, the interference transgenic family TIL103... RNAi There was no difference in plant height and effective panicle number, but the number of grains per panicle on the main stem and the yield per plant increased.

[0132] The results in summary indicate that: 1) CTP- NOG9 1) When transferred to the Teqing variety, the T2 generation homozygous transgenic positive plants had lower yields compared to the Teqing variety; 2) OE- NOG9When the overexpression vector was transferred into Teqing, the T2 generation homozygous overexpression transgenic positive plants had lower yields compared to Teqing; 3) RNAi- NOG9 When the gene expression interference vector was transferred into TIL103, the T2 generation knockout homozygous transgenic positive plants showed increased yields compared to TIL103.

[0133] NOG9 Genes negatively regulate rice yield, downregulating NOG9 Gene expression levels can increase rice yield.

[0134] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The use of NOG9 protein in at least one of the following (1)-(4): (1) Application in regulating rice yield; (2) Application in the preparation of products that regulate rice yield; (3) Application in cultivating rice with altered yield; (4) Application in the preparation of products using rice with altered yields; The amino acid sequence of the NOG9 protein is shown in SEQ ID No.

1.

2. The application as described in claim 1, characterized in that, The NOG9 protein is derived from rice.

3. The application as described in claim 1, characterized in that, The NOG9 protein negatively regulates rice yield.

4. The use of the gene encoding the NOG9 protein of claim 1 in at least one of the following (1)-(4): (1) Application in regulating rice yield; (2) Application in the preparation of products that regulate rice yield; (3) Application in cultivating rice with altered yield; (4) Application in the preparation of products using rice with altered yields; The nucleotide sequence of the gene is shown in SEQ ID No. 2, and the coding sequence of the gene is shown in SEQ ID No.

3.

5. The use of biomaterials in at least one of the following (1)-(4): (1) Application in regulating rice yield; (2) Application in the preparation of products that regulate rice yield; (3) Application in cultivating rice with altered yield; (4) Application in the preparation of products using rice with altered yields; The biomaterial is at least one of the following (1)-(12): (1) An expression cassette containing a gene encoding the NOG9 protein; (2) A recombinant expression vector containing a gene encoding the NOG9 protein; (3) A recombinant expression vector containing the expression cassette described in (1); (4) Recombinant microorganisms containing genes encoding the NOG9 protein; (5) Recombinant microorganisms containing the expression cassette described in (1); (6) Recombinant microorganisms containing the recombinant expression vector described in (2) or (3); (7) Transgenic plant cell lines containing genes encoding NOG9 protein; (8) A transgenic plant cell line containing the expression cassette described in (1); (9) Transgenic plant tissue containing a gene encoding the NOG9 protein; (10) Transgenic plant tissue containing the expression cassette described in (1); (11) Transgenic plant organs containing a gene encoding the NOG9 protein; (12) Transgenic plant organs containing the expression cassette described in (1); The NOG9 protein is the NOG9 protein described in claim 1.

6. A method for altering rice yield, characterized in that, Includes the following steps: Rice yield can be increased by inhibiting or reducing the activity of NOG9 protein in rice, or by reducing or downregulating the expression level of the gene encoding NOG9 protein, wherein the amino acid sequence of the NOG9 protein is shown in SEQ ID No.

1.

7. The method for changing rice yield as described in claim 6, characterized in that, The expression level of the gene encoding NOG9 protein in rice can be reduced by RNA interference technology, which can decrease or inactivate the gene encoding NOG9 protein in the rice genome.

8. A method for cultivating high-yield rice, characterized in that, This includes reducing or downregulating the expression level of the gene encoding the NOG9 protein in rice, thereby inhibiting or reducing the activity of the NOG9 protein to obtain high-yielding rice. The amino acid sequence of the NOG9 protein is shown in SEQ ID No. 1.

Images