Molecular marker for identifying celery verticillium wilt resistance and application thereof

Abstract

The invention belongs to the technical field of biology, and discloses a molecular marker for identifying celery verticillium wilt resistance and application of the molecular marker. Based on BSA-Seq analysis, the KASP molecular marker with significant linkage is developed for celery FOA-R2 resistance, and can be used for breeding celery verticillium wilt resistant varieties or strains, so that the breeding workload is reduced, the working efficiency is improved, the breeding cost is reduced, the breeding process is accelerated, and the KASP molecular marker has very high practical application value.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker for identifying resistance to Verticillium wilt in celery and its application. Technical Background

[0002] Celery (Apium graveolens L. var. dulce) is a biennial vegetable belonging to the genus Apium of the family Apiaceae. Rich in nutrients and possessing various pharmacological functions, it is renowned as a valuable vegetable and medicine, and is cultivated throughout my country. In the past two or three decades, celery has experienced rapid growth in my country, with its planting area and consumption continuously increasing, making it one of the country's most important vegetable crops. However, with the expansion of celery planting areas and the increase in cropping frequency, the damage caused by various pests and diseases due to continuous cropping has become increasingly severe. Among these, Verticillium wilt is one of the most serious fungal diseases, and its control through the application of fungicides is currently not very effective, often resulting in significant losses for celery production in various regions.

[0003] Celery Verticillium wilt is caused by *Fusarium oxysporum* f.sp.apii (FOA). Initially, it manifests as browning of the vascular tissue in the roots, followed by gradual necrosis of the roots and rhizomes. This prevents the above-ground leaves from obtaining sufficient nutrients from the roots, resulting in stunted growth, chlorosis, and ultimately, plant death. The disease was first discovered in the United States in 1909 (Ryke, 1935) and quickly became the most serious disease in major celery-producing areas of the United States, gradually spreading to other parts of the world (Correl et al., 1985). In my country, it was first discovered around 2005 in Zhuhai City, Guangdong Province (Chen Yuanfeng et al., 2008), and has now spread to most celery-producing areas, causing significant damage. Currently, four physiological races of FOA have been discovered around the world (Epstein et al., 2017; WO 2022 / 136652 A1), among which physiological race 2 (FOA-R2) is the most prevalent and is also the most important pathogen causing Verticillium wilt in celery in my country (Gao et al., 2026).

[0004] It has long been recognized that breeding disease-resistant varieties is the most economical, effective, and environmentally friendly technical approach to crop disease control. The United States began research on breeding varieties resistant to Verticillium wilt in celery in the 1970s (Quiros, 1993), while my country only started this research in recent years. Currently, a number of breeding materials resistant to FOA-R2 have been screened using traditional field inoculation methods for disease resistance identification. However, this method is time-consuming, labor-intensive, inefficient, and easily affected by environmental factors.

[0005] In the process of variety breeding, marker-assisted selection utilizes molecular markers closely linked to genes of the target trait. By detecting these markers, individuals with specific traits can be selected, thereby improving breeding efficiency and accuracy. Currently, DNA molecular markers have evolved to the third generation, namely single nucleotide polymorphism (SNP) molecular markers, a molecular marker technology based on DNA microarray technology. Compared to the previous two generations, SNP genotyping has advantages such as high distribution density and good genetic stability. KASP is a genotyping technique based on fluorescence detection after PCR amplification, enabling high-throughput, automated detection of SNP genotypes, and is flexible, inexpensive, and accurate. Currently, there is a lack of molecular markers closely linked to celery Verticillium wilt resistance that are suitable for large-scale breeding. Therefore, it is necessary to develop a new molecular marker with high stability and reproducibility. Based on BSA-Seq analysis, this invention developed a KASP molecular marker with significant linkage for celery FOA-R2 resistance. This marker can be used for the breeding of celery varieties or lines resistant to Verticillium wilt, thereby reducing the workload of breeding, improving efficiency, lowering breeding costs, and accelerating the breeding process. It has high practical application value. Summary of the Invention

[0006] One of the objectives of this invention is to provide a molecular marker for identifying resistance to Verticillium wilt in celery.

[0007] The second objective of this invention is to provide the application of the above-mentioned molecular markers for identifying resistance to Verticillium wilt in celery.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] The molecular marker disclosed in this invention for identifying resistance to Verticillium wilt in celery is a KASP molecular marker with significant linkage, developed specifically for FOA-R2 resistance in celery. The development of this molecular marker is based on a single nucleotide polymorphism (SNP) of cytosine (C) and thymine (T) at physical location 7110390 on celery chromosome 7, where C:C represents the susceptible genotype and T:T represents the resistant genotype.

[0010] Specifically, the nucleotide sequence of the molecular marker AgrCh07_7110390 is shown in SEQ ID NO.1, wherein a C / T base mutation exists at position 151 of the sequence shown in SEQ ID NO.1, and the sequence is as follows:

[0011] (As shown in SEQ ID NO.1, the bold and underlined areas represent the variant sites C / T).

[0012] Based on this mutation site, a primer set for the KASP marker was designed to amplify the primer set for the molecular marker used to identify resistance to Verticillium wilt in celery. The primer set sequence for the molecular marker is as follows:

[0013] Forward primer AgrCh07_7110390-1: tttgccgaaagagtacaagtgaaG (shown in SEQ ID NO.2);

[0014] Forward primer AgrCh07_7110390-2: tttgccgaaagagtacaagtgaaA (shown in SEQ ID NO.3);

[0015] Reverse primer AgrCh07_7110390-Common: tgtgaactgtgtggttgtgcc (shown in SEQ ID NO.4);

[0016] Two forward primers are used to connect to different fluorescent adapter sequences; the 5' end of forward primer AgrCh07_7110390-1 is connected to the FAM fluorescent adapter sequence, and the 5' end of forward primer AgrCh07_7110390-12 is connected to the HEX fluorescent adapter sequence; the FAM and HEX fluorescent adapter sequences are as follows:

[0017] FAM: GAAGGTGACCAAGTTCATGCT (shown in SEQ ID NO.5);

[0018] HEX: GAAGGTCGGAGTCAACGGATT (shown in SEQ ID NO. 6).

[0019] This invention also discloses the application of the aforementioned molecular marker primer set in marker-assisted breeding for identifying celery Verticillium wilt resistance. In other words, the molecular marker primer set of this invention can be used in future marker-assisted breeding, by extracting DNA from seedling leaves and detecting the presence of the molecular markers of this invention, thereby identifying celery Verticillium wilt resistance. The detection can be performed using quantitative real-time PCR, specifically using the aforementioned molecular marker primer set.

[0020] This invention also discloses a method for obtaining the AgrCh07_7110390 molecular marker, comprising the following steps:

[0021] 1) The disease-resistant celery material 07-11 was crossed with the susceptible material S336 to obtain the F1 generation, and then the F1 generation was self-crossed to obtain the F2 generation.

[0022] 2) Field inoculation identification of the F2 generation population was carried out, and 25-30 disease-resistant and disease-susceptible single plants were selected to construct mixed ponds. Leaf DNA was extracted from the parent, resistant mixed pond and disease-susceptible mixed pond materials, and whole genome resequencing was performed and low-quality reads were filtered out.

[0023] 3) Align the sequencing sequences to the reference genome (cv.Challenger) to obtain variations covering the entire genome;

[0024] 4) Calculate the Euclidean distance (ED value) of sequencing depth of all variant sites between anti / susceptible pools and the fixation index (FST) of variants between anti / susceptible materials, and screen for significantly associated variant sites;

[0025] 5) Design primers and perform Sanger validation on candidate sites;

[0026] 6) Population validation confirmed that SNP: AgrCh07_7110390 was statistically significantly associated with Verticillium wilt resistance (p<0.01).

[0027] Those skilled in the art can thus repeatedly obtain the molecular markers of the present invention.

[0028] This invention also discloses the application of the primer set of the above-mentioned molecular markers in identifying resistance to Verticillium wilt in celery. Specifically, the specific steps for identifying resistance to Verticillium wilt are as follows:

[0029] The DNA of the tested celery germplasm was used as a template for real-time PCR amplification, and real-time PCR amplification was performed using the primer set corresponding to the molecular marker AgrCh07_7110390. Quantitative real-time PCR (qPCR) amplification was performed using primer sets AgrCh07_7110390-1, AgrCh07_7110390-2, and AgrCh07_7110390-Common. If only the FAM fluorescence signal corresponding to primer AgrCh07_7110390-1 with the fluorescent adapter sequence was detected in the PCR product of the sample, the detection site was C:C genotype, and the sample was identified as a susceptible Verticillium wilt single plant. If only the HEX fluorescence signal corresponding to primer AgrCh07_7110390-2 with the fluorescent adapter sequence was detected in the PCR product of the sample, the detection site was T:T genotype, and the sample was identified as a resistant Verticillium wilt single plant. If both fluorescence signals corresponding to primers AgrCh07_7110390-1 and AgrCh07_7110390-2 with the fluorescent adapter sequence were detected simultaneously, the detection site was C:T genotype, and the sample was identified as a susceptible Verticillium wilt single plant.

[0030] In addition, this invention also protects a kit for identifying resistance to Verticillium wilt in celery, the kit containing primer sets AgrCh07_7110390-1, AgrCh07_7110390-2, and AgrCh07_7110390-Common. Other components of the kit are conventional reagents. Specifically, it also includes 2×PCR Mix and ROX supplementation solution. This invention imposes specific restrictions on the concentration of the primer sets; a concentration of 10 μM can be used. This invention does not impose specific restrictions on the source of the 2×PCR Mix and ROX supplementation solution; reagents for real-time quantitative PCR amplification well-known in the art can be used.

[0031] The kit of this invention can be used to rapidly identify celery Verticillium wilt resistance and celery Verticillium wilt resistance genotypes. The specific method follows the steps described above for identifying celery Verticillium wilt resistance.

[0032] The present invention has the following advantages:

[0033] 1. The KASP molecular marker developed in this invention is a genotyping technology based on fluorescence detection after PCR amplification. It can achieve high-throughput and automated detection of SNP genotypes and has the characteristics of flexibility, low cost, accuracy and safety.

[0034] 2. This invention can identify the resistance of celery to Verticillium wilt during the seedling stage. Compared with the traditional field planting method, it can save time, land, and labor costs, and the test results are not affected by the growth environment, resulting in higher accuracy.

[0035] 3. This invention can improve the efficiency of molecular marker-assisted breeding (MAS), help in the breeding of disease-resistant varieties, and improve agricultural yield and stability. Attached Figure Description

[0036] Figure 1 Euclidean distance (ED) for sequencing depth of variant sites between anti / susceptible pools;

[0037] Figure 2 The F-index for fixing variant sites between resistant / susceptible populations (F) ST );

[0038] Figure 3 The fluorescence results are for the AgrCh07_7110390 molecular marker amplification products. Blue represents the HEX fluorescent adapter (T:T), green represents the FAM fluorescent adapter (C:C), and red represents the HEX / FAM hybrid fluorescent adapter (C:T). Detailed Implementation

[0039] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0040] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0042] Example 1: Molecular Marker Development

[0043] (1) Plant materials and community construction

[0044] This study used the extremely resistant celery Verticillium wilt material “Afina” (sample code: '07-11') as the male parent and crossed it with the extremely susceptible female parent “American Emperor” (sample code: 'S336') to construct a genetically segregating population (F2). The F2 generation was artificially inoculated with Verticillium wilt pathogens, and based on the severity of disease symptoms, 30 extremely resistant plants and 30 extremely susceptible plants were selected from the F2 population. Finally, equal amounts of the extremely resistant plants were mixed to form a resistant pool, and equal amounts of the extremely susceptible plants were mixed to form a susceptible pool for subsequent BSA sequencing. Leaf DNA was extracted from the parents, resistant pools, and susceptible pools, and whole-genome resequencing was performed, with low-quality reads filtered out.

[0045] (2) Sequencing and differential analysis

[0046] The population was resequencing at 10× depth using Illumina NovaSeq. The sequenced sequences were aligned to a reference genome (cv. Challenger) to obtain genome-wide variants. BWA was used for alignment, and GATK was used for variant identification. Python scripts were written to use the ED method and F... ST The method analyzes and identifies associated loci, calculates the Euclidean distance (ED value) of sequencing depth of all variant loci between anti / susceptible pools, and the fixation index (F) of variants between anti / susceptible materials. ST ), screen for significantly associated variant sites ( Figure 1 , Figure 2Finally, a SNP (C / T) was identified at chromosome 7110390 that was significantly associated with celery resistance to Verticillium wilt.

[0047] (3) Primer design and Sanger validation for candidate sites.

[0048] The marker primers were designed according to general primer design rules, with primer lengths of 18–30 bp and amplified fragments less than 250 bp (including primers). Secondary structure changes and dimer stability were excluded when allele-specific primers were used with universal adapters. The upstream and downstream reference genome sequences for this variant are shown in SEQ ID NO.1, and the primer sequences are as follows:

[0049] Forward primer AgrCh07_7110390-1: tttgccgaaagagtacaagtgaaG (shown in SEQ ID NO.2);

[0050] Forward primer AgrCh07_7110390-2: tttgccgaaagagtacaagtgaaA (shown in SEQ ID NO.3);

[0051] Reverse primer AgrCh07_7110390-Common: tgtgaactgtgtggttgtgcc (shown in SEQ ID NO.4);

[0052] Two forward primers are used to connect to different fluorescent adapter sequences; the 5' end of forward primer AgrCh07_7110390-1 is connected to the FAM fluorescent adapter sequence, and the 5' end of forward primer AgrCh07_7110390-2 is connected to the HEX fluorescent adapter sequence; the FAM and HEX fluorescent adapter sequences are as follows:

[0053] FAM: GAAGGTGACCAAGTTCATGCT (shown in SEQ ID NO.5);

[0054] HEX: GAAGGTCGGAGTCAACGGATT (shown in SEQ ID NO. 6).

[0055] Using DNA from the tested celery germplasm as a template for quantitative real-time PCR (qPCR), qPCR amplification was performed using the primer set corresponding to the molecular marker AgrCh07_7110390. If the PCR product of the sample only detected the FAM fluorescence signal corresponding to primer AgrCh07_7110390-1 with a fluorescent adapter sequence, the detection site was C:C genotype, and the sample was identified as a susceptible Verticillium wilt single plant. If the PCR product only detected the HEX fluorescence signal corresponding to primer AgrCh07_7110390-2 with a fluorescent adapter sequence, the detection site was T:T genotype, and the sample was identified as a resistant Verticillium wilt single plant. If both fluorescence signals corresponding to primers AgrCh07_7110390-1 and AgrCh07_7110390-2 with fluorescent adapter sequences were detected simultaneously, the detection site was C:T genotype, and the sample was identified as a susceptible Verticillium wilt single plant.

[0056] Example 2: Accuracy verification of the molecular markers described in this invention

[0057] The molecular markers mentioned above were used to identify 171 celery samples. The specific Verticillium wilt resistance and the genotypes corresponding to the AgrCh07_7110390 locus of the celery materials used are shown in Table 1.

[0058] Table 1. Disease resistance identification results of 1171 celery samples and genotypes corresponding to the AgrCh07_7110390 locus.

[0059]

[0060]

[0061]

[0062]

[0063]

[0064] Using the genomic DNA of the celery to be identified as a template, the primer pair was used to perform real-time PCR amplification to obtain the real-time PCR product;

[0065] The PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-57℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 32 cycles.

[0066] Then, the fluorescence signal was read using a TECAN Infinite M1000 microplate reader, and the converted fluorescence signal was analyzed using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) to obtain a clear and intuitive genotyping diagram. Figure 3 The genotype results were output based on different colors. Subsequently, field inoculation was performed on 188 celery plants to obtain field resistance identification results. Finally, the genotype and resistance identification results were analyzed using a χ² test. 2 Chi-square test.

[0067] Table 2 Genotype × Disease Resistance Observation Values

[0068]

[0069] The results are shown in Table 2. Statistical analysis showed that χ²... 2 =159.11, degrees of freedom df=2, p-value=2.2×10 -16 The distribution of different genotypes showed highly significant differences in resistance / susceptibility, with the T:T genotype being the resistant genotype. Furthermore, the results were largely consistent with field identification, demonstrating high accuracy. Therefore, the KASP marker of this invention can effectively identify Verticillium wilt resistance in celery and can be used for the prediction and screening of Verticillium wilt-resistant celery materials.

[0070] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. A molecular marker for identifying resistance to Verticillium wilt in celery, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein there is a C / T base mutation at position 151 of the sequence shown in SEQ ID NO.

1. When the base at this position is C, celery is susceptible to Verticillium wilt, and when the base at this position is T, celery is resistant to Verticillium wilt.

2. The molecular marker for identifying resistance to Verticillium wilt in celery according to claim 1, characterized in that, The molecular marker is the KASP marker.

3. A primer set for detecting the molecular marker of claim 1, characterized in that, The primer set includes: Forward primer AgrCh07_7110390-1: tttgccgaaagagtacaagtgaaG; Forward primer AgrCh07_7110390-2: tttgccgaaagagtacaagtgaaA; Reverse primer AgrCh07_7110390-Common: tgtgaactgtgtggttgtgcc.

4. The primer set of molecular markers according to claim 3, characterized in that, Two forward primers are used to connect to different fluorescent adapter sequences; the 5' end of forward primer AgrCh07_7110390-1 is connected to the FAM fluorescent adapter sequence, and the 5' end of forward primer AgrCh07_7110390-2 is connected to the HEX fluorescent adapter sequence; the FAM and HEX fluorescent adapter sequences are as follows: FAM: GAAGGTGACCAAGTTCATGCT; HEX: GAAGGTCGGAGTCAACGGATT.

5. The application of the primer set of the molecular markers as described in claim 3 in the identification or auxiliary identification of celery Verticillium wilt resistance.

6. The application according to claim 5, characterized in that, The method for identifying celery resistance to Verticillium wilt includes the following steps: (1) Extract genomic DNA from the celery stalks to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform real-time PCR amplification using the primer set of the molecular markers described in claim 3, and analyze the results of real-time PCR amplification. (3) Make a judgment based on the result of step (2), and the specific criteria are as follows: Quantitative real-time PCR (qPCR) amplification was performed using primer sets AgrCh07_7110390-1, AgrCh07_7110390-2, and AgrCh07_7110390-Common. If only the FAM fluorescence signal corresponding to primer AgrCh07_7110390-1 with the fluorescent adapter sequence was detected in the PCR product of the sample, the detection site was C:C genotype, and the sample was identified as a susceptible Verticillium wilt single plant. If only the HEX fluorescence signal corresponding to primer AgrCh07_7110390-2 with the fluorescent adapter sequence was detected in the PCR product of the sample, the detection site was T:T genotype, and the sample was identified as a resistant Verticillium wilt single plant. If both fluorescence signals corresponding to primers AgrCh07_7110390-1 and AgrCh07_7110390-2 with the fluorescent adapter sequence were detected simultaneously, the detection site was C:T genotype, and the sample was identified as a susceptible Verticillium wilt single plant.

7. A kit for identifying resistance to Verticillium wilt in celery, characterized in that, A primer set comprising the molecular markers described in claim 3.

8. The use of the kit according to claim 7 in identifying resistance to Verticillium wilt in celery.

9. The application according to claim 8, characterized in that, The method for identifying resistance to Verticillium wilt in celery using the aforementioned kit is as follows: (1) Extract genomic DNA from the celery stalks to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform real-time PCR amplification using the primer set of molecular markers described in claim 3; (3) Analyze the results of quantitative real-time PCR amplification. If the sample PCR product only detects the FAM fluorescence signal corresponding to the primer AgrCh07_7110390-1 with the fluorescent adapter sequence, the detection site is C:C genotype, and it is determined to be a susceptible Verticillium wilt single plant. If the sample PCR product only detects the HEX fluorescence signal corresponding to the primer AgrCh07_7110390-2 with the fluorescent adapter sequence, the detection site is T:T genotype, and it is determined to be a resistant Verticillium wilt single plant. If both fluorescence signals corresponding to the primers AgrCh07_7110390-1 and AgrCh07_7110390-2 with the fluorescent adapter sequence are detected at the same time, the detection site is C:T genotype, and it is determined to be a susceptible Verticillium wilt single plant.

Images