Molecular marker related to saline-alkaline resistance of brassica napus and application of molecular marker

Abstract

The invention discloses a molecular marker related to saline-alkaline resistance of brassica napus and application of the molecular marker, and belongs to the technical field of molecular marker-assisted breeding. Based on whole genome association analysis, a major QTL qSAT.A04 remarkably related to saline-alkaline tolerance is positioned on a brassica napus A04 chromosome, a key gene BnaA04.SOS2 is identified from the major QTL qSAT.A04, analysis finds that the gene has two haplotypes HapA and HapB, the HapA is remarkably related to high saline-alkaline tolerance, and further, based on key sequence difference between the two haplotypes, the gene BnaA04.SOS2 can be used for identifying the saline-alkaline tolerance of the brassica napus. An allele specific PCR molecular marker is designed and developed, and comprises specific forward primers SEQ ID NO.3 and SEQ ID NO.4 and a public reverse primer SEQ ID NO.5. By means of the marker and the primers, the saline-alkaline tolerant haplotype of the brassica napus can be rapidly and accurately identified, and early selection in the seedling stage is achieved.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding technology, specifically relating to a molecular marker related to salt and alkali tolerance in Brassica napus and its application. Background Technology

[0002] Rapeseed (Brassica napus L.) is one of my country's most important oilseed crops. Its seeds have high oil content and strong adaptability, making it strategically important for ensuring edible oil supply security and promoting green agricultural development. However, salt-alkali stress severely restricts the planting area and yield potential of rapeseed. Salt-alkali stress causes damage through ion poisoning (such as sodium hydroxide). + / K + Multiple mechanisms, including imbalance, osmotic stress, reactive oxygen species (ROS) damage, and nutrient imbalance, inhibit the germination, growth, photosynthesis, and reproductive development of rapeseed, ultimately leading to a significant decline in yield and quality.

[0003] The plant SOS signaling pathway is a core pathway in response to salt stress, with SOS2 protein kinase being a key activator. Previous studies have shown that the BnaA04.SOS2 gene may play an important role in salt-alkali tolerance in Brassica napus. Using association analysis, we located a major quantitative trait locus (QTL) qSAT.A04 on chromosome A04, which regulates the salt-alkali tolerance coefficient of aboveground dry weight at maturity. The BnaA04.SOS2 gene is located within this locus. However, the lack of efficient and accurate molecular markers for this gene currently greatly limits its application in marker-assisted selection breeding. Therefore, developing molecular markers closely linked to the BnaA04.SOS2 gene and capable of effectively distinguishing salt-alkali tolerant haplotypes is urgently needed and of great value for accelerating the breeding process of salt-alkali tolerant new varieties of Brassica napus. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a molecular marker, its specific primers, detection kit, and identification method directly related to the salt and alkali tolerance of Brassica napus. This marker can rapidly and accurately distinguish between haplotypes of the BnaA04.SOS2 gene associated with high or low salt and alkali tolerance, thus providing key technical support for achieving efficient assisted selection breeding of Brassica napus.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a molecular marker associated with salt and alkali tolerance in Brassica napus, wherein the molecular marker is closely linked to the BnaA04.SOS2 gene on chromosome A04 of Brassica napus, and its nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.2; wherein the molecular marker shown in SEQ ID NO.1 is associated with high salt and alkali tolerance in Brassica napus, and the molecular marker shown in SEQ ID NO.2 is associated with low salt and alkali tolerance in Brassica napus.

[0006] Secondly, the present invention provides a primer combination for detecting the above-mentioned molecular markers, comprising at least one of the following primer pairs: (a) A primer pair consisting of a forward primer with the sequence shown in SEQ ID NO.3 and a reverse primer with the sequence shown in SEQ ID NO.5; (b) A primer pair consisting of a forward primer with a sequence as shown in SEQ ID NO.4 and a reverse primer with a sequence as shown in SEQ ID NO.5.

[0007] Thirdly, the present invention provides a kit for distinguishing haplotypes related to salt and alkali tolerance in Brassica napus, the kit comprising the above-mentioned primer combination.

[0008] Fourthly, the present invention provides a method for identifying the salt and alkali tolerance of Brassica napus, comprising the following steps: (1) Extract genomic DNA from the rapeseed plants to be tested; (2) Using the genomic DNA obtained in step (1) as a template, PCR amplification was performed using the primer pair (a) and primer pair (b) mentioned above, respectively; (3) Detection of amplification products: If the target band can be amplified using only primer pair (a), the plant is determined to carry a low salt tolerance-related haplotype (HapB); if the target band can be amplified using only primer pair (b), the plant is determined to carry a high salt tolerance-related haplotype (HapA).

[0009] Fifthly, the present invention provides the application of the above-mentioned molecular markers, primer combinations or kits in salt-alkali assisted selection breeding of Brassica napus or in the breeding of salt-alkali tolerant Brassica napus varieties.

[0010] Results determination: If a band of approximately 250 bp is amplified using primers shown in SEQ ID NO. 3 and 5, but no band is amplified using primers shown in SEQ ID NO. 4 and 5, then the rapeseed variety is identified as having low salt and alkali tolerance; if a band of approximately 250 bp is amplified using primers shown in SEQ ID NO. 4 and 5, but no band is amplified using primers shown in SEQ ID NO. 3 and 5, then the rapeseed variety is identified as having high salt and alkali tolerance.

[0011] The beneficial effects of this invention are: High specificity: The molecular markers developed in this invention are directly based on the key sequence differences between the functional haplotypes (HapA and HapB) of the BnaA04.SOS2 gene. The allele-specific primers designed can achieve accurate identification and are highly consistent with the phenotype.

[0012] Accurate and efficient: The detection can be completed using conventional PCR and agarose gel electrophoresis. The operation is simple, quick, and inexpensive, making it easy to promote and apply in ordinary laboratories and breeding units.

[0013] High breeding value: This marker enables early and non-destructive screening of a large number of breeding materials during the seedling stage, significantly improving selection efficiency and shortening the breeding cycle, providing a powerful tool for the targeted breeding of salt-tolerant new varieties of Brassica napus. Attached Figure Description

[0014] Figure 1 Manhattan plot of genome-wide association analysis based on the salt tolerance coefficient phenotype of 505 Brassica napus accessions at maturity aboveground dry weight and 7,671,951 SNP markers. The horizontal axis represents the 19 chromosomes (A01-C09) of Brassica napus, and the vertical axis represents the negative logarithm (-log) value of the association significance. 10 (P)), the horizontal dashed line in the figure represents the significance threshold at the genome level. A peak significantly above the threshold was observed on chromosome A04, and this region was identified as a major QTL site (qSAT.A04) controlling salt tolerance. The arrow points to the lead SNP location of this QTL.

[0015] Figure 2 Phenotypic differences in salt and alkali tolerance coefficients at maturity between two haplotypes (HapA and HapB) of BnaA04.SOS2 in a Brassica napus-type population. The figure clearly shows that the average salt and alkali tolerance coefficient of haplotype HapA is significantly higher than that of haplotype HapB, proving that this haplotype is significantly associated with salt and alkali tolerance.

[0016] Figure 3 Gel electrophoresis images of molecular markers from different rapeseed varieties. HapB represents 9 rapeseed germplasms with low salt and alkali tolerance (numbered 1-9); HapA represents 9 rapeseed germplasms with high salt and alkali tolerance (numbered 10-18). Detailed Implementation

[0017] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and the reagents used are all commercially available products.

[0018] Example 1: Molecular marker development of BnaA04.SOS2, the major gene for salt and alkali tolerance in rapeseed. 1. Genome-wide association analysis and candidate gene localization Fifty-five genetically diverse associated populations of Brassica napus were collected. Phenotypic identification was performed under salt-alkali stress and normal conditions, and the salt-alkali tolerance coefficient of the aboveground dry weight at maturity was calculated for each material. Simultaneously, whole-genome resequencing was performed on the populations, and after alignment and filtering, a total of 7,671,951 high-quality SNP markers were obtained. Genome-wide association analysis (GWAS) was conducted using a linear mixture model in FaST-LMM software, combining phenotypic data and SNP genotype data.

[0019] like Figure 1 As shown in the Manhattan plot, a major peak significantly associated with salt tolerance was detected on chromosome A04. This locus was defined as a major-effect QTL and named qSAT.A04. Regions approximately 100 kb upstream and downstream of the most significant lead SNP at this locus were delineated as candidate QTL regions. By reviewing genome annotations and combining them with existing rapeseed stress transcriptome data from our laboratory, we found that the BnaA04.SOS2 gene located within this region was significantly upregulated under salt stress, thus identifying it as a key candidate gene.

[0020] 2. Candidate gene haplotype analysis and phenotypic association validation In related groups BnaA04.SOS2 Analysis of the promoter, 3'-UTR, and coding region sequences identified two haplotypes (HapA and HapB). Haplotype A had an average salt-alkali tolerance coefficient of 64.77% ± 0.18% for the aboveground dry weight at maturity, while haplotype B had an average salt-alkali tolerance coefficient of 56.00% ± 0.63% for the aboveground dry weight at maturity. Figure 2 As shown, the phenotypic difference between the two haplotypes reached a highly significant level (P<0.01), proving that HapA is the dominant haplotype that is significantly associated with high salt and alkali tolerance.

[0021] 3. Design of allele-specific PCR molecular markers Based on the key sequence differences in specific regions between the HapA and HapB haplotypes, allele-specific PCR markers were designed. A common reverse primer (R) and two forward primers specifically matched for the HapA and HapB haplotypes, respectively, were designed. The primer nucleotide sequences of the molecular markers are as follows: HapA: CTGTTAAATGTTGTATGGCTCTC TTTTTAATTTTTTTCTTGTCCAGATCAAAAGAGAGATATCTATAATGAAGATTGTACGACACCCTAACATAGTCAGGTTGTATGAGGTATGTCTATGTTTCCTTGCATCTGCCAAGTTTGTCTCCTTTTGCATGATGATGATGATGTTGCTTCGGATGTAGGTCTTGGCGAGTCCTTCTAAAATATATATCGTTTTGGAGTT TGTGACTGGAGGAGAGCTCT (SEQ ID NO.1) HapB: GTATGGTGCTTGAAGCTCTCT TTCTAATTTTTTCATGTCCAGATCAAAAGAGAGATATCTATAATGAAGATTGTACGACACCCTAACATAGTCAGGTTGTATGAGGTATGTCTATGTTTCCTTGCATCTGCCAAGTTTGTCTCCTTTTGCATGATGATGATGATGTTGCTTCGGATGTAGGTCTTGGCGAGTCCTTCTAAAATATATATCGTTTTGGAGTT TGTGACTGGAGGAGAGCTCT (SEQ ID NO.2) Note: Underlined items are molecular marker primers designed and developed.

[0022] The primer pair in SEQ ID NO.1 can be used to specifically amplify the HapA haplotype, and the primer pair in SEQ ID NO.2 can be used to specifically amplify the HapB haplotype. The expected amplification product length is approximately 250 bp.

[0023] Example 2: Genotyping of Brassica napus plants using molecular markers 1. DNA was extracted from rapeseed leaves using the CTAB method. a. Take 1cm of young leaves from each plant. 2 Place the mixture into a 2 mL centrifuge tube, add steel balls, add 250 μL of 2% CTAB, grind on a grinder for 5 min, and then add 500 μL of CTAB into the centrifuge tube. b. Place in a 65℃ water bath for 60 minutes, shaking once every 15 minutes; c. After the homogenate is cooled to room temperature, add a chloroform:isoamyl alcohol mixture with a volume ratio of 24:1 to the centrifuge tube, gently invert and mix for 15 min, and then centrifuge at 12000 rpm for 10 min. d. Place the centrifuged centrifuge tubes in order on the operating board, and transfer the supernatant into a new 1.5 mL centrifuge tube, with a volume of 500 μL. e. Add 50 μL of KAc solution to the supernatant, then add 500 μL of ice-cold ethanol, cap the centrifuge tube, shake gently a few times to mix the ice-cold ethanol with the supernatant, and then place it in a -20°C freezer for 20-30 minutes to allow genomic DNA to precipitate. f. After standing, centrifuge the centrifuge tube at 12000 rpm for 6 min, discard the supernatant, add 500 μL of 75% ethanol, let it stand for another 5 min, discard the supernatant, repeat once, and the precipitate is the genomic DNA. g. Place the centrifuge tubes containing DNA in a fume hood to dry, and you will get the genomic DNA of each plant. h. Add 200 μL ddH2O to a dried centrifuge tube containing DNA to dissolve the DNA. After dissolution, store at -20°C.

[0024] 2. PCR amplification Using the aforementioned molecular markers as primers and the genomic DNA of the rapeseed plants extracted using the CTAB method as templates, PCR amplification was performed. The PCR amplification was carried out in 10 μL reaction systems, specifically including: 5 μL Vazyme 2×Taq Plus Master Mix; 2 μL DNA template; 0.25 μL forward primer (10 μM); 0.25 μL reverse primer (10 μM); and 2.5 μL ultrapure water.

[0025] Forward primer for HapB identification: GTATGGTGCTTGAAGCTCTCT (SEQ ID NO.3) Forward primer for HapA identification: CTGTTAAATGTTGTATGGCTCTC (SEQ ID NO.4) Reverse primer: AGAGCTCTCCTCCAGTCACA (SEQ ID NO.5) The PCR reaction program was as follows: 94℃ pre-denaturation for 3 min, 1 cycle; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 20 s, 34 cycles in total; 72℃ extension for 5 min, 1 cycle; and finally storage at 4℃.

[0026] 3. Amplification products and electrophoretic analysis The amplification products of all tested Brassica napus plants were electrophoresed on a 1.5% agarose gel, stained with ethidium bromide, and then imaged under ultraviolet light to obtain the genotype information of the tested samples. Figure 3 As shown, nine germplasms with known low salt and alkali tolerance (numbered 1-9) only amplified a clear band of approximately 250 bp (HapB type) when using primer pair SEQ ID NO. 3 / 5; while nine germplasms with known high salt and alkali tolerance (numbered 10-18) only amplified a clear band of approximately 250 bp (HapA type) when using primer pair SEQ ID NO. 4 / 5. The electrophoresis results were completely consistent with the known phenotypes and haplotypes, demonstrating the accuracy and reliability of the developed molecular markers.

[0027] The molecular markers and their detection methods provided by this invention are simple to operate and produce stable and reliable results. They can be widely used in various stages such as salt and alkali tolerance identification of rapeseed germplasm resources, early selection of hybrid offspring, aggregation breeding, and molecular marker-assisted backcross breeding. They have important practical application value for breeding new rapeseed varieties adapted to saline-alkali land.

[0028] Finally, the above embodiments are preferred implementations of the present invention, and the present invention is not limited to the specific details in the above embodiments. Any modifications, equivalent substitutions, improvements, etc., made under the functional and structural principles of the present invention should be included within the protection scope of the present invention.

[0029] Appendix: Explanation of Key Technical Terms 1. Salt-alkali tolerance coefficient: An indicator used to quantify a plant's ability to grow or maintain yield under salt-alkali stress. In this invention, it specifically refers to the "salt-alkali tolerance coefficient of aboveground dry weight at maturity". The calculation formula is: (aboveground dry weight under salt-alkali stress treatment / aboveground dry weight of the control under normal conditions) × 100%. The higher this coefficient, the less the plant's biomass accumulation is affected under salt-alkali stress, i.e., the stronger its salt-alkali tolerance. It is the core phenotypic data in the association analysis of this invention.

[0030] 2. Quantitative trait loci: These are chromosomal regions in the genome associated with variations in quantitative traits (such as yield, plant height, stress resistance, and other measurable, continuously varying traits). A single QTL typically contains one or more genes controlling that trait. In this invention, through genome-wide association analysis, a major-effect QTL significantly associated with salt tolerance was identified on chromosome A04 of Brassica napus, named qSAT.A04. This indicates that this chromosomal region contains key genetic factors regulating salt tolerance.

[0031] 3. Haplotype: A haplotype refers to a set of closely linked alleles (or single nucleotide polymorphisms) located on a chromosome or within a gene region and inherited together. In this invention, two main haplotype combinations were identified in the promoter, coding region, and 3'-UTR region of the candidate gene BnaA04.SOS2: HapA (high salt tolerance associated) and HapB (low salt tolerance associated). The development of molecular markers is based on these two haplotypes.

[0032] 4. Genome-wide association analysis (GWAS): A research method that uses statistical association analysis of genome-wide genetic variations (such as SNPs) and phenotypic traits in a large number of individuals in a natural population to discover genetic loci (such as QTLs or genes) that influence complex traits. In this invention, resequencing SNP data (7,671,951 SNPs) and salt tolerance coefficient phenotypes from 505 rapeseed associated populations were used to perform GWAS using a linear mixture model, thereby locating the major-effect QTL qSAT.A04.

[0033] 5. Allele-Specific PCR: A PCR-based molecular marker technique. Its core principle is the design of specific primers whose 3' terminal bases perfectly match the specific single nucleotide polymorphism (SNP) site of the target allele (or haplotype). Under strict PCR conditions, the primers can only effectively extend and produce amplification products if the template DNA contains the specific allele. In this invention, specific forward primers (SEQ ID NO. 4 and SEQ ID NO. 3) were designed for the key differential sites between the HapA and HapB haplotypes of the BnaA04.SOS2 gene, and paired with a common reverse primer (SEQ ID NO. 5). Through a single PCR reaction, the haplotype of the sample can be determined based on the presence of an amplified band and the corresponding primer combination.

[0034] 6. Lead SNP: Within a correlation signal peak (i.e., a QTL interval), the single nucleotide polymorphism site that is most significantly associated with the target trait (usually having the lowest P-value) represents the core correlation signal of that QTL region. In this invention, the Lead SNP identified in the A04 chromosome correlation signal peak is the benchmark for delineating the QTL interval (extending approximately 100 kb before and after its location).

[0035] 7. Tight linkage: This refers to two or more genes or genetic markers located very close to each other on a chromosome, such that the probability of recombination during meiosis is extremely low, and therefore they tend to be jointly inherited by offspring. In this invention, the molecular marker is "tightly linked to the BnaA04.SOS2 gene on chromosome A04 of Brassica napus," meaning that the detection result of this molecular marker can reliably predict the haplotype (HapA or HapB) of this gene, and thus be used for salt-alkali tolerance-assisted selection.

Claims

1. A molecular marker associated with salt and alkali tolerance in Brassica napus, characterized in that, The molecular marker is closely linked to the BnaA04.SOS2 gene on chromosome A04 of Brassica napus, and its nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.2; wherein, the molecular marker shown in SEQ ID NO.1 is associated with high salt and alkali tolerance of Brassica napus, and the molecular marker shown in SEQ ID NO.2 is associated with low salt and alkali tolerance of Brassica napus.

2. A primer combination for detecting the molecular marker of claim 1, characterized in that, Includes at least one of the following primer pairs: (a) A primer pair consisting of a forward primer with the sequence shown in SEQ ID NO.3 and a reverse primer with the sequence shown in SEQ ID NO.5; (b) A primer pair consisting of a forward primer with a sequence as shown in SEQ ID NO.4 and a reverse primer with a sequence as shown in SEQ ID NO.

5.

3. A reagent kit for distinguishing haplotypes related to salt and alkali tolerance in Brassica napus, characterized in that, It includes the primer combination as described in claim 2.

4. A method for identifying the salt and alkali tolerance of Brassica napus, characterized in that, Includes the following steps: (1) Extract genomic DNA from the rapeseed plants to be tested; (2) Using the genomic DNA obtained in step (1) as a template, perform PCR amplification using the primer pair (a) and primer pair (b) described in claim 2 respectively; (3) Detect the amplification products. If the target band can be amplified using only primer pair (a), then the plant is determined to carry a haplotype associated with low salt and alkali tolerance. If the target band can be amplified using primer pair (b) alone, then the plant is determined to carry a haplotype associated with high salt and alkali tolerance.

5. The method according to claim 4, characterized in that, The PCR amplification reaction program in step (2) is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 20 s, 34 cycles; 72℃ extension for 5 min.

6. The application of the molecular marker of claim 1, the primer combination of claim 2, or the kit of claim 3 in salt-alkali assisted selection breeding of Brassica napus.

Images