Method for preparing terephthalic acid by coupling electro-catalysis and microbial fermentation

Abstract

The invention discloses a method for preparing terephthalic acid by coupling electro-catalysis and microbial fermentation, and belongs to the technical fields of biomass value technology, catalyst material synthesis and bioengineering. According to the method, bio-based p-xylene is selectively converted into p-toluic acid through electrocatalytic oxidation, and then the p-toluic acid is further oxidized into terephthalic acid through corynebacterium glutamicum with exogenous genes introduced. The system realizes electrocatalytic high-selectivity generation of intermediates and efficient deep oxidation of microorganisms, avoids high-temperature and high-pressure conditions and metal catalyst pollution in the traditional chemical oxidation process, has remarkable advantages of greenization and energy efficiency, and provides an innovative technical scheme for green biological manufacturing of terephthalic acid.

Description

Technical Field

[0001] This invention relates to the fields of biomass value-added technology, catalyst material synthesis and bioengineering technology, and more specifically to the application of bio-based electrocatalytic oxidation of p-xylene and the production of terephthalic acid by coupling with recombinant Corynebacterium glutamicum. Background Technology

[0002] Terephthalic acid (TPA) is an important chemical raw material widely used in the manufacture of plastic materials such as polyethylene terephthalate (PET). Traditional terephthalic acid production methods mainly rely on petrochemical processes, generated through the oxidation of p-xylene (pX). This process is energy-intensive, highly corrosive, and causes severe environmental pollution. With the advancement of green chemistry and sustainable development concepts, more and more research is focusing on processes operating under milder conditions.

[0003] While electrocatalytic oxidation can drive organic molecule oxidation reactions under mild conditions using electrical energy, its selectivity in aromatic hydrocarbon oxidation is insufficient. For example, the electrocatalytic oxidation of p-xylene often stops at the p-methylbenzoic acid stage, making further oxidation to TPA difficult. On the other hand, the mineralization and decomposition of aromatic hydrocarbons by certain natural degrading bacteria (such as *Pseudomonas* and *Trichophyton*) involves complex metabolic networks and low yields of target products, making them difficult to directly apply to the efficient synthesis of TPA. Although some studies have attempted to construct transformation pathways in conventional model microorganisms (such as *Escherichia coli*), they often face common bottlenecks such as poor substrate / product tolerance, insufficient cofactor regeneration, and low pathway flux, resulting in low efficiency and limited yields for direct conversion of p-xylene. Therefore, neither electrocatalysis nor microbial fermentation alone can achieve efficient TPA preparation.

[0004] Therefore, providing a method for preparing terephthalic acid by coupling electrocatalysis and microbial fermentation is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a method for the preparation of terephthalic acid by coupling electrocatalysis and microbial fermentation. By combining the selective generation of bioavailable intermediates by electrocatalysis with the deep oxidation capacity of microorganisms, a novel electro-biological coupling process is proposed, realizing the green, low-energy, and highly selective synthesis of p-xylene to TPA.

[0006] This invention utilizes an electrocatalyst for the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid. By genetically engineering *Corynebacterium glutamicum*, it is enabled to effectively utilize p-methylbenzoic acid as a substrate, converting it to terephthalic acid through a specific metabolic pathway. This electrocatalytic coupling with microbial fermentation achieves the efficient oxidation of bio-based p-xylene to terephthalic acid, while avoiding the high-temperature, high-pressure conditions and low selectivity limitations of traditional thermocatalysis.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: An electrocatalyst for the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid, wherein the electrocatalyst is a copper oxide system electrocatalyst, a cerium hydroxide system electrocatalyst, or a layered bimetallic hydroxide system electrocatalyst; The preparation method of the copper oxide system electrocatalyst is as follows: (1) Preparation of precursors ① Prepare a solution containing 10-50 mM copper salt in 90 mL of deionized water; ② Slowly add 10 mL of 100-500 mM citric acid aqueous solution to the above solution, stirring vigorously until completely dissolved; ③ Adjust the pH value to 8-12 with 100 mM NH4·H2O; ④ Transfer the obtained solution to a hydrothermal reactor liner made of polytetrafluoroethylene, and place it in an oven to react at 180-240℃ for 24-48 hours; ⑤ After the reaction is completed, cool to room temperature, filter out the precipitate in the liner and wash it, wash it twice with deionized water, then wash it twice with anhydrous ethanol, and then wash it once with deionized water. Place the washed precipitate in a vacuum oven to dry at 60-80℃; (2) Sintering of copper oxide support ① Take out the dried precursor and weigh 100-500mg. Grind it thoroughly with an agate mortar. ② Spread the ground powder evenly in a corundum crucible and transfer it to a vacuum tube furnace. Calcine it in air at a heating rate of 2-10℃ / min from room temperature to 300-500℃ for 2-5 hours. ③ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol. Dry it in a vacuum oven. (3) Construction of surface oxygen vacancies ① Take out the dried copper oxide, weigh 100-500 mg, and disperse it in 20-100 mL of anhydrous ethanol; ② After sonicating the solution for two days, filter it, and transfer the filtered solid to a vacuum oven to dry; ③ Place the powder obtained after vacuum drying into a corundum crucible and spread it evenly, transfer it to a vacuum tube furnace, and calcine it at a heating rate of 2-10 °C / min from room temperature to 500-800 °C for 5-10 hours under a 5% H2 + 95% Ar atmosphere; ④ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol, and place it in a vacuum oven to dry; The preparation method of the cerium hydroxyl oxide system electrocatalyst is as follows: (I) Preparation of precursors ① Prepare a solution containing 10-50 mM cerium salt in 90 mL of deionized water; ② Slowly add 10 mL of 100-500 mM citric acid aqueous solution to the above solution, stirring vigorously until completely dissolved; ③ Adjust the pH to 8-12 with 100 mM NH4·H2O to obtain a clear, bluish-green solution; observe the change from a milky white opaque solution to a pink transparent solution and then to a clear, bluish-green solution; ④ Transfer the obtained clear, bluish-green solution to a hydrothermal reactor liner made of polytetrafluoroethylene and place it in an oven to react at 180-240℃ for 24-48 hours; ⑤ After the reaction, cool to room temperature, filter out the precipitate from the liner, wash it, wash it twice with deionized water, then twice with anhydrous ethanol, and then once with deionized water. Place the washed precipitate in a vacuum oven to dry at 60-80℃. (II) Sintering of cerium oxide support ① Take out the dried precursor and weigh 100-500mg. Grind it thoroughly with an agate mortar. ② Spread the ground powder evenly in a corundum crucible and transfer it to a vacuum tube furnace. Calcine it in air at a heating rate of 2-10℃ / min from room temperature to 300-500℃ for 2-5 hours. ③ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol. Dry it in a vacuum oven. (III) Sintering of cerium hydroxyoxide ① Take out the above-mentioned cerium oxide and weigh it to 100-500mg; ② Place the weighed powder into a corundum crucible and spread it evenly, transfer it to a vacuum tube furnace, and calcine it at a heating rate of 2-10℃ / min from room temperature to 600-900℃ for 5-10 hours under a 5% H2 + 95% Ar atmosphere; ③ After the reaction is completed, take out the product, wash it twice with deionized water and then wash it twice with anhydrous ethanol, and dry it in a vacuum oven. The preparation method of the layered bimetallic hydroxide system electrocatalyst is as follows: ① Take 30 mL of salt solution; the salt solution is a mixture of copper salt, cobalt salt and iron salt in a certain molar concentration ratio of x mmol / L: y mmol / L: y mmol / L, where x = 1%~3% of y and y = 10~100; ② Add 10~100 mg of ammonium fluoride and 300~600 mg of urea, and then stir at 0~5℃ under an argon atmosphere for 96~128 hours; ③ Adjust the pH of the above solution to 7~9 with potassium hydroxide, stir again for 24~48 hours, and filter to obtain a precursor containing Cu, Co and Fe hydroxides; ④ Transfer the filtered precursor to a vacuum tube furnace and age it at 200~450℃ under an argon atmosphere for 6~12 hours; ⑤ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol, and dry it in a vacuum oven.

[0008] Furthermore, the copper salt is copper nitrate, copper chloride, or copper acetate; The cerium salt is cerium nitrate, cerium chloride, or cerium sulfate; The cobalt salt is cobalt nitrate, cobalt chloride, or cobalt sulfate; The iron salt is ferric nitrate, ferric chloride, or ferric sulfate.

[0009] Furthermore, the electrocatalyst is used in the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid.

[0010] Furthermore, a recombinant expression vector, Exogenous expression of cytochrome p450 enzyme genes, p-carboxybenzyl alcohol dehydrogenase genes, and benzaldehyde dehydrogenase genes; The nucleotide sequence of the cytochrome p450 enzyme gene is shown in SEQ ID NO.1; The nucleotide sequence of the p-carboxybenzyl alcohol dehydrogenase gene is shown in SEQ ID NO.2; The nucleotide sequence of the benzaldehyde dehydrogenase gene is shown in SEQ ID NO.3.

[0011] Furthermore, a recombinant Corynebacterium glutamicum, The recombinant expression vector was transformed using Corynebacterium glutamicum ATCC 13032 as the starting strain.

[0012] A method for constructing a biosynthetic pathway from p-methylbenzoic acid to terephthalic acid in Corynebacterium glutamicum includes introducing a foreign gene into Corynebacterium glutamicum, said foreign gene encoding enzymes required for the biosynthetic pathway from p-methylbenzoic acid to terephthalic acid, including cytochrome p450 enzyme, p-carboxybenzyl alcohol dehydrogenase, and benzaldehyde dehydrogenase.

[0013] The biosynthetic pathway from p-methylbenzoic acid to terephthalic acid is as follows: p-Toluenebenzoic acid is converted to p-hydroxymethylbenzoic acid under the catalysis of cytochrome p450 enzyme; p-Hydroxymethylbenzoic acid is converted to 4-formylbenzoic acid under the catalysis of p-carboxybenzyl alcohol dehydrogenase; 4-Formylbenzoic acid is converted to terephthalic acid under the catalysis of benzaldehyde dehydrogenase.

[0014] The substrate in the reaction is bio-based p-xylene, the product is terephthalic acid, and the intermediate product is p-methylbenzoic acid.

[0015] Furthermore, the recombinant expression vector or the recombinant Corynebacterium glutamicum is used in the production of terephthalic acid.

[0016] Furthermore, a method for preparing terephthalic acid by coupling electrocatalysis and microbial fermentation includes the following steps: S1. Electrocatalytically oxidize bio-based p-xylene to p-methylbenzoic acid; S2. Using p-methylbenzoic acid as a substrate, the recombinant Corynebacterium glutamicum is used for fermentation culture to convert p-methylbenzoic acid into terephthalic acid.

[0017] Furthermore, the step of electrocatalytically oxidizing bio-based p-xylene to p-methylbenzoic acid described in step S1 is as follows: ① The electrocatalyst according to claim 1 is prepared into a dispersion at a ratio of 1 mg dispersed in 200 μL of isopropanol, and a slurry is prepared by adding 0.5 μL of Nafion 117 membrane solution to every 200 μL of dispersion. The slurry is then prepared at a ratio of 1 cm 2 ① An electrode is fabricated by spraying 200 μL of slurry onto a titanium fiber felt electrode; ② Bio-based p-xylene is dissolved in 1M KOH aqueous solution at a concentration of 1~50 g / L as the anolyte and the catholyte is 1M KOH aqueous solution; ③ Using a platinum sheet electrode as the counter electrode and a mercury oxide electrode as the reference electrode, and using the electrode fabricated in step ① as the working electrode, electrochemical tests are performed in an H-type electrolytic cell; ④ Constant potential electrolysis is performed at a potential of 0.8-1.2 V vs. RHE, and the electrolysis products are detected by nuclear magnetic resonance spectroscopy.

[0018] Furthermore, the fermentation culture conditions described in step S2 are: temperature 15-35 ℃, pH 6-9.

[0019] As can be seen from the above technical solution, compared with the prior art, the present invention discloses a method for preparing terephthalic acid by coupling electrocatalysis and microbial fermentation, which has the following beneficial effects: (1) Copper oxide system electrocatalyst: The abundant oxygen vacancies on the surface and the highly active copper sites work together to precisely activate the methyl CH bond in p-xylene, inhibit the excessive oxidation of the aromatic ring, and significantly improve the selectivity of p-methylbenzoic acid formation.

[0020] (2) Electrocatalyst for cerium hydroxyoxide system: Ce 3+ / Ce 4+ The dynamic regulation of redox pairs, combined with the adsorption of surface hydroxyl groups, accelerates electron transfer and directional activation of p-xylene, thereby improving electrocatalytic conversion efficiency and reaction stability.

[0021] (3) Layered bimetallic hydroxide system electrocatalyst: The synergistic effect of Cu, Co and Fe multimetal sites optimizes the electronic structure, reduces the reaction energy barrier of xylene oxidation to p-methylbenzoic acid, and at the same time the layered structure inhibits the aggregation of active components, ensuring long-term stable catalytic performance.

[0022] (4) Environmentally friendly: Electrocatalysis and microbial cell factories replace traditional chemical oxidation processes, avoiding the use of heavy metal catalysts and corrosive solvents, thus reducing environmental pollution.

[0023] (5) Utilization of renewable resources: Use renewable biomass resources as raw materials to reduce dependence on petroleum resources.

[0024] (6) High-efficiency production: Through the preparation of electrocatalytic catalysts and the systematic metabolic engineering modification of Corynebacterium glutamicum, the high-efficiency synthesis of terephthalic acid was achieved, and the yield was significantly increased. Detailed Implementation

[0025] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0026] Example 1 A method for synthesizing an electrocatalyst for the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid includes the following steps: 1) Preparation of electrocatalysts for copper oxide system (1) Preparation of precursors ① Prepare a solution containing 10 mM copper nitrate in 90 mL of deionized water; ② Slowly add 10 mL of 100 mM citric acid aqueous solution to the above solution, stirring vigorously until completely dissolved; ③ Adjust the pH to 8 with 100 mM NH4·H2O; ④ Transfer the obtained solution to a hydrothermal reactor liner made of polytetrafluoroethylene, and place it in an oven to react at 180℃ for 48 hours; ⑤ After the reaction is completed, cool to room temperature, filter out the precipitate in the liner and wash it, wash it twice with deionized water, then wash it twice with anhydrous ethanol, and then wash it once with deionized water. Place the washed precipitate in a vacuum oven to dry at 60℃.

[0027] (2) Sintering of copper oxide support ① Take out the dried precursor and weigh 100 mg. Grind it thoroughly in an agate mortar. ② Spread the ground powder evenly in a corundum crucible and transfer it to a vacuum tube furnace. Calcinate it in air at a heating rate of 2℃ / min from room temperature to 300℃ for 5 hours. ③ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol. Dry it in a vacuum oven.

[0028] (3) Construction of surface oxygen vacancies ① Take out the dried copper oxide, weigh 100 mg, and disperse it in 20 mL of anhydrous ethanol; ② After sonicating the solution for two days, filter it, and transfer the filtered solid to a vacuum oven to dry; ③ Place the powder obtained after vacuum drying into a corundum crucible and spread it evenly, transfer it to a vacuum tube furnace, and calcine it at a heating rate of 2℃ / min from room temperature to 500℃ for 10 hours under a 5% H2 + 95% Ar atmosphere; ④ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol, and place it in a vacuum oven to dry.

[0029] 2) Electrocatalytic bio-based p-xylene to p-methylbenzoic acid Electrochemical operation: ① Prepare a dispersion by dispersing the above electrocatalyst in 200 μL of isopropanol at a ratio of 1 mg / mL. Prepare a slurry by adding 0.5 μL of Nafion 117 membrane solution to every 200 μL of dispersion. Distribute the slurry in batches of 1 cm³. 2 ① An electrode was fabricated by spraying 200 μL of slurry onto a titanium fiber felt electrode; ② Bio-based p-xylene was dissolved in 1 M KOH aqueous solution at a concentration of 1 g / L as the anolyte and the catholyte was 1 M KOH aqueous solution; ③ Using a platinum sheet electrode as the counter electrode, a mercury oxide electrode as the reference electrode, and the electrode fabricated in step ① as the working electrode, electrochemical tests were performed in a commercial H-type electrolytic cell; ④ Potentially constant electrolysis was performed at a potential of 0.8-1.2 V (vs. RHE), and the electrolysis product (p-methylbenzoic acid) was detected by nuclear magnetic resonance spectroscopy.

[0030] Example 2 A method for synthesizing an electrocatalyst for the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid includes the following steps: 1) Preparation of electrocatalysts for copper oxide system (1) Preparation of precursors ① Prepare a solution containing 30 mM copper chloride in 90 mL of deionized water; ② Slowly add 10 mL of 300 mM citric acid aqueous solution to the above solution, stirring vigorously until completely dissolved; ③ Adjust the pH to 10 with 100 mM NH4·H2O; ④ Transfer the obtained solution to a hydrothermal reactor liner made of polytetrafluoroethylene, and place it in an oven to react at 210℃ for 36 hours; ⑤ After the reaction is completed, cool to room temperature, filter out the precipitate in the liner and wash it, wash it twice with deionized water, then wash it twice with anhydrous ethanol, and then wash it once with deionized water. Place the washed precipitate in a vacuum oven to dry at 70℃.

[0031] (2) Sintering of copper oxide support ① Take out the dried precursor and weigh 300 mg. Grind it thoroughly in an agate mortar. ② Spread the ground powder evenly in a corundum crucible and transfer it to a vacuum tube furnace. Calcinate it in air at a heating rate of 6℃ / min from room temperature to 400℃ for 3.5 hours. ③ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol. Dry it in a vacuum oven.

[0032] (3) Construction of surface oxygen vacancies ① Take out the dried copper oxide, weigh 300 mg, and disperse it in 60 mL of anhydrous ethanol; ② After sonicating the solution for two days, filter it, and transfer the filtered solid to a vacuum oven to dry; ③ Place the powder obtained after vacuum drying into a corundum crucible and spread it evenly, transfer it to a vacuum tube furnace, and calcine it at a heating rate of 6℃ / min from room temperature to 650℃ for 7.5 hours under a 5% H2 + 95% Ar atmosphere; ④ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol, and place it in a vacuum oven to dry.

[0033] 2) Electrocatalytic bio-based p-xylene to p-methylbenzoic acid Electrochemical operation: ① Prepare a dispersion by dispersing the above electrocatalyst in 200 μL of isopropanol at a ratio of 1 mg / mL. Prepare a slurry by adding 0.5 μL of Nafion 117 membrane solution to every 200 μL of dispersion. Distribute the slurry in batches of 1 cm³. 2 ① An electrode was fabricated by spraying 200 μL of slurry onto a titanium fiber felt electrode; ② Bio-based p-xylene was dissolved in 1 M KOH aqueous solution at a concentration of 25.5 g / L as the anolyte and the catholyte was 1 M KOH aqueous solution; ③ Using a platinum sheet electrode as the counter electrode, a mercury oxide electrode as the reference electrode, and the electrode fabricated in step ① as the working electrode, electrochemical tests were performed in a commercial H-type electrolytic cell; ④ Potentially constant electrolysis was performed at a potential of 0.8-1.2 V (vs. RHE), and the electrolysis product (p-methylbenzoic acid) was detected by nuclear magnetic resonance spectroscopy.

[0034] Example 3 A method for synthesizing an electrocatalyst for the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid includes the following steps: 1) Preparation of electrocatalysts for copper oxide system (1) Preparation of precursors ① Prepare a solution containing 50 mM copper acetate in 90 mL of deionized water; ② Slowly add 10 mL of 500 mM citric acid aqueous solution to the above solution, stirring vigorously until completely dissolved; ③ Adjust the pH to 12 with 100 mM NH4·H2O; ④ Transfer the obtained solution to a hydrothermal reactor liner made of polytetrafluoroethylene, and place it in an oven to react at 240℃ for 24 hours; ⑤ After the reaction is completed, cool to room temperature, filter out the precipitate in the liner and wash it, wash it twice with deionized water, then wash it twice with anhydrous ethanol, and then wash it once with deionized water. Place the washed precipitate in a vacuum oven to dry at 80℃.

[0035] (2) Sintering of copper oxide support ① Take out the dried precursor and weigh 500 mg. Grind it thoroughly in an agate mortar. ② Spread the ground powder evenly in a corundum crucible and transfer it to a vacuum tube furnace. Calcine it in air at a heating rate of 10℃ / min from room temperature to 500℃ for 2 hours. ③ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol. Dry it in a vacuum oven.

[0036] (3) Construction of surface oxygen vacancies ① Take out the dried copper oxide, weigh 500 mg, and disperse it in 100 mL of anhydrous ethanol; ② After sonicating the solution for two days, filter it and transfer the filtered solid to a vacuum oven to dry; ③ Place the powder obtained after vacuum drying into a corundum crucible and spread it evenly, transfer it to a vacuum tube furnace, and calcine it at a heating rate of 10℃ / min from room temperature to 800℃ for 5 hours under a 5% H2 + 95% Ar atmosphere; ④ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol, and place it in a vacuum oven to dry.

[0037] 2) Electrocatalytic bio-based p-xylene to p-methylbenzoic acid Electrochemical operation: ① Prepare a dispersion by dispersing the above electrocatalyst in 200 μL of isopropanol at a ratio of 1 mg / mL. Prepare a slurry by adding 0.5 μL of Nafion 117 membrane solution to every 200 μL of dispersion. Distribute the slurry in batches of 1 cm³. 2① An electrode was fabricated by spraying 200 μL of slurry onto a titanium fiber felt electrode; ② Bio-based p-xylene was dissolved in 1 M KOH aqueous solution at a concentration of 50 g / L as the anolyte, and the catholyte was a 1 M KOH aqueous solution; ③ Using a platinum sheet electrode as the counter electrode and a mercury oxide electrode as the reference electrode, the above-fabricated electrode was used as the working electrode for electrochemical testing in a commercial H-type electrolytic cell; ④ Potentially constant electrolysis was performed at a potential of 0.8-1.2 V (vs. RHE), and the electrolysis product (p-methylbenzoic acid) was detected by nuclear magnetic resonance spectroscopy.

[0038] Example 4 A method for synthesizing an electrocatalyst for the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid includes the following steps: 1) Preparation of cerium hydroxyl oxide system electrocatalyst (1) Preparation of precursors ① Prepare a solution containing 10 mM cerium nitrate in 90 mL of deionized water; ② Slowly add 10 mL of 100 mM citric acid aqueous solution to the above solution, stirring vigorously until completely dissolved; ③ Adjust the pH to 8 with 100 mM NH4·H2O, observing a change from a milky white opaque solution to a pink transparent solution, and then to a bluish-green transparent solution; ④ Transfer the resulting bluish-green transparent solution to a hydrothermal reactor liner made of polytetrafluoroethylene, and place it in an oven to react at 180℃ for 48 hours; ⑤ After the reaction is completed, cool to room temperature, filter out the precipitate from the liner, wash it, wash it twice with deionized water, then twice with anhydrous ethanol, and then once with deionized water. Place the washed precipitate in a vacuum oven to dry at 60℃.

[0039] (2) Sintering of cerium oxide support ① Take out the dried precursor and weigh 100mg. Grind it thoroughly with an agate mortar. ② Spread the ground powder evenly in a corundum crucible and transfer it to a vacuum tube furnace. Calcine it in air at a heating rate of 2℃ / min from room temperature to 300℃ for 5 hours. ③ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol. Dry it in a vacuum oven.

[0040] (3) Sintering of cerium hydroxyoxide ① Take out the above-mentioned cerium oxide and weigh 100mg; ② Place the weighed powder into a corundum crucible and spread it evenly, transfer it to a vacuum tube furnace, and calcine it from room temperature to 600℃ for 10 hours at a heating rate of 2℃ / min under a 5% H2 + 95% Ar atmosphere; ③ After the reaction is completed, take out the product, wash it twice with deionized water and then wash it twice with anhydrous ethanol, and dry it in a vacuum oven.

[0041] 2) Electrocatalytic bio-based p-xylene to p-methylbenzoic acid Electrochemical operation: ① Prepare a dispersion by dispersing the above electrocatalyst in 200 μL of isopropanol at a ratio of 1 mg / mL. Prepare a slurry by adding 0.5 μL of Nafion 117 membrane solution to every 200 μL of dispersion. Distribute the slurry in batches of 1 cm³. 2 ① An electrode was fabricated by spraying 200 μL of slurry onto a titanium fiber felt electrode; ② Bio-based p-xylene was dissolved in 1 M KOH aqueous solution at a concentration of 1 g / L as the anolyte, and the catholyte was a 1 M KOH aqueous solution; ③ Using a platinum sheet electrode as the counter electrode and a mercury oxide electrode as the reference electrode, the above-fabricated electrode was used as the working electrode for electrochemical testing in a commercial H-type electrolytic cell; ④ Potentially constant electrolysis was performed at a potential of 0.8-1.2 V (vs. RHE), and the electrolysis product (p-methylbenzoic acid) was detected by nuclear magnetic resonance spectroscopy.

[0042] Example 5 A method for synthesizing an electrocatalyst for the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid includes the following steps: 1) Preparation of cerium hydroxyl oxide system electrocatalyst (1) Preparation of precursors ① Prepare a solution containing 30 mM cerium chloride in 90 mL of deionized water; ② Slowly add 10 mL of 300 mM citric acid aqueous solution to the above solution, stirring vigorously until completely dissolved; ③ Adjust the pH to 10 with 100 mM NH4·H2O, observing a change from a milky white opaque solution to a pink transparent solution, and then to a bluish-green transparent solution; ④ Transfer the resulting bluish-green transparent solution to a hydrothermal reactor liner made of polytetrafluoroethylene, and place it in an oven to react at 210℃ for 36 hours; ⑤ After the reaction is complete, cool to room temperature, filter out the precipitate from the liner, wash it, wash it twice with deionized water, then twice with anhydrous ethanol, and then once with deionized water. Place the washed precipitate in a vacuum oven to dry at 70℃.

[0043] (2) Sintering of cerium oxide support ① Take out the dried precursor and weigh 300 mg. Grind it thoroughly in an agate mortar. ② Spread the ground powder evenly in a corundum crucible and transfer it to a vacuum tube furnace. Calcine it in air at a heating rate of 6 °C / min from room temperature to 400 °C for 3.5 hours. ③ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol. Dry it in a vacuum oven.

[0044] (3) Sintering of cerium hydroxyoxide ① Take out the above-mentioned cerium oxide and weigh 300mg; ② Place the weighed powder into a corundum crucible and spread it evenly, transfer it to a vacuum tube furnace, and calcine it at a heating rate of 6℃ / min from room temperature to 750℃ for 7.5 hours under a 5% H2 + 95% Ar atmosphere; ③ After the reaction is completed, take out the product, wash it twice with deionized water and then wash it twice with anhydrous ethanol, and dry it in a vacuum oven.

[0045] 2) Electrocatalytic bio-based p-xylene to p-methylbenzoic acid Electrochemical operation: ① Prepare a dispersion by dispersing the above electrocatalyst in 200 μL of isopropanol at a ratio of 1 mg / mL. Prepare a slurry by adding 0.5 μL of Nafion 117 membrane solution to every 200 μL of dispersion. Distribute the slurry in batches of 1 cm³. 2 ① An electrode was fabricated by spraying 200 μL of slurry onto a titanium fiber felt electrode; ② Bio-based p-xylene was dissolved in 1 M KOH aqueous solution at a concentration of 25.5 g / L as the anolyte and the catholyte was a 1 M KOH aqueous solution; ③ Using a platinum sheet electrode as the counter electrode and a mercury oxide electrode as the reference electrode, the above-fabricated electrode was used as the working electrode for electrochemical testing in a commercial H-type electrolytic cell; ④ Potentially constant electrolysis was performed at a potential of 0.8-1.2 V (vs. RHE), and the electrolysis product (p-methylbenzoic acid) was detected by nuclear magnetic resonance spectroscopy.

[0046] Example 6 A method for synthesizing an electrocatalyst for the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid includes the following steps: 1) Preparation of cerium hydroxyl oxide system electrocatalyst (1) Preparation of precursors ① Prepare a solution containing 50 mM cerium sulfate in 90 mL of deionized water; ② Slowly add 10 mL of 500 mM citric acid aqueous solution to the above solution, stirring vigorously until completely dissolved; ③ Adjust the pH to 12 with 100 mM NH4·H2O, observing a change from a milky white opaque solution to a pink transparent solution, and then to a bluish-green transparent solution; ④ Transfer the resulting bluish-green transparent solution to a hydrothermal reactor liner made of polytetrafluoroethylene, and place it in an oven to react at 240℃ for 24 hours; ⑤ After the reaction, cool to room temperature, filter out the precipitate from the liner, wash it, wash it twice with deionized water, then wash it twice with anhydrous ethanol, and then wash it once with deionized water. Place the washed precipitate in a vacuum oven to dry at 80℃.

[0047] (2) Sintering of cerium oxide support ① Take out the dried precursor and weigh 500 mg. Grind it thoroughly in an agate mortar. ② Spread the ground powder evenly in a corundum crucible and transfer it to a vacuum tube furnace. Calcine it in air at a heating rate of 10 °C / min from room temperature to 500 °C for 2 hours. ③ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol. Dry it in a vacuum oven.

[0048] (3) Sintering of cerium hydroxyoxide ① Take out the above-mentioned cerium oxide and weigh 500mg; ② Place the weighed powder into a corundum crucible and spread it out, transfer it to a vacuum tube furnace, and calcine it at a heating rate of 10℃ / min from room temperature to 900℃ for 5 hours under a 5% H2 + 95% Ar atmosphere; ③ After the reaction is completed, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol, and dry it in a vacuum oven.

[0049] 2) Electrocatalytic bio-based p-xylene to p-methylbenzoic acid Electrochemical operation: ① Prepare a dispersion by dispersing the above electrocatalyst in 200 μL of isopropanol at a ratio of 1 mg / mL. Prepare a slurry by adding 0.5 μL of Nafion 117 membrane solution to every 200 μL of dispersion. Distribute the slurry in batches of 1 cm³. 2 ① An electrode was fabricated by spraying 200 μL of slurry onto a titanium fiber felt electrode; ② Bio-based p-xylene was dissolved in 1 M KOH aqueous solution at a concentration of 50 g / L as the anolyte, and the catholyte was a 1 M KOH aqueous solution; ③ Using a platinum sheet electrode as the counter electrode and a mercury oxide electrode as the reference electrode, the above-fabricated electrode was used as the working electrode for electrochemical testing in a commercial H-type electrolytic cell; ④ Potentially constant electrolysis was performed at a potential of 0.8-1.2 V (vs. RHE), and the electrolysis product (p-methylbenzoic acid) was detected by nuclear magnetic resonance spectroscopy.

[0050] Example 7 A method for synthesizing an electrocatalyst for the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid includes the following steps: 1) Preparation of layered bimetallic hydroxide system electrocatalysts ① Take 30 mL of salt solution; the salt solution is a mixture of copper nitrate, cobalt nitrate, and ferric nitrate in a molar ratio of 0.1 mmol / L: 10 mmol / L: 10 mmol / L (x=1% y, y=10); ② Add 10 mg of ammonium fluoride and 300 mg of urea, and then stir at 0 °C under an argon atmosphere for 96 hours; ③ Adjust the pH of the above solution to 7 with potassium hydroxide and stir again for 24 hours. After filtration, a precursor containing Cu, Co, and Fe hydroxides is obtained; ④ Transfer the filtered precursor to a vacuum tube furnace and age it at 200 °C under an argon atmosphere for 12 hours; ⑤ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol, and dry it in a vacuum oven.

[0051] 2) Electrocatalytic bio-based p-xylene to p-methylbenzoic acid Electrochemical operation: ① Prepare a dispersion by dispersing the above electrocatalyst in 200 μL of isopropanol at a ratio of 1 mg / mL. Prepare a slurry by adding 0.5 μL of Nafion 117 membrane solution to every 200 μL of dispersion. Distribute the slurry in batches of 1 cm³. 2 ① An electrode was fabricated by spraying 200 μL of slurry onto a titanium fiber felt electrode; ② Bio-based p-xylene was dissolved in 1 M KOH aqueous solution at a concentration of 1 g / L as the anolyte, and the catholyte was a 1 M KOH aqueous solution; ③ Using a platinum sheet electrode as the counter electrode and a mercury oxide electrode as the reference electrode, the above-fabricated electrode was used as the working electrode for electrochemical testing in a commercial H-type electrolytic cell; ④ Potentially constant electrolysis was performed at a potential of 0.8-1.2 V (vs. RHE), and the electrolysis product (p-methylbenzoic acid) was detected by nuclear magnetic resonance spectroscopy.

[0052] Example 8 A method for synthesizing an electrocatalyst for the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid includes the following steps: 1) Preparation of layered bimetallic hydroxide system electrocatalysts ① Take 30 mL of salt solution; the salt solution is a mixture of copper chloride, cobalt chloride, and ferric chloride in a molar ratio of 1.1 mmol / L: 55 mmol / L: 55 mmol / L (x=2% y, y=55); ② Add 55 mg ammonium fluoride and 450 mg urea, and then stir at 2.5 °C under an argon atmosphere for 112 hours; ③ Adjust the pH of the above solution to 8 with potassium hydroxide and stir again for 36 hours. After filtration, a precursor containing Cu, Co, and Fe hydroxides is obtained; ④ Transfer the filtered precursor to a vacuum tube furnace and age it at 325 °C under an argon atmosphere for 9 hours; ⑤ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol, and dry it in a vacuum oven.

[0053] 2) Electrocatalytic bio-based p-xylene to p-methylbenzoic acid Electrochemical operation: ① Prepare a dispersion by dispersing the above electrocatalyst in 200 μL of isopropanol at a ratio of 1 mg / mL. Prepare a slurry by adding 0.5 μL of Nafion 117 membrane solution to every 200 μL of dispersion. Distribute the slurry in batches of 1 cm³. 2 ① An electrode was fabricated by spraying 200 μL of slurry onto a titanium fiber felt electrode; ② Bio-based p-xylene was dissolved in 1 M KOH aqueous solution at a concentration of 25.5 g / L as the anolyte and the catholyte was a 1 M KOH aqueous solution; ③ Using a platinum sheet electrode as the counter electrode and a mercury oxide electrode as the reference electrode, the above-fabricated electrode was used as the working electrode for electrochemical testing in a commercial H-type electrolytic cell; ④ Potentially constant electrolysis was performed at a potential of 0.8-1.2 V (vs. RHE), and the electrolysis product (p-methylbenzoic acid) was detected by nuclear magnetic resonance spectroscopy.

[0054] Example 9 A method for synthesizing an electrocatalyst for the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid includes the following steps: 1) Preparation of layered bimetallic hydroxide system electrocatalysts ① Take 30 mL of salt solution; the salt solution is a mixture of copper acetate, cobalt sulfate, and ferric sulfate in a molar ratio of 3 mmol / L: 100 mmol / L: 100 mmol / L (x=3% y, y=100); ② Add 100 mg ammonium fluoride and 600 mg urea, and then stir at 5 °C under an argon atmosphere for 128 hours; ③ Adjust the pH of the above solution to 9 with potassium hydroxide and stir again for 48 hours. After filtration, a precursor containing Cu, Co, and Fe hydroxides is obtained; ④ Transfer the filtered precursor to a vacuum tube furnace and age it at 450 °C under an argon atmosphere for 6 hours; ⑤ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol, and dry it in a vacuum oven.

[0055] 2) Electrocatalytic bio-based p-xylene to p-methylbenzoic acid Electrochemical operation: ① Prepare a dispersion by dispersing the above electrocatalyst in 200 μL of isopropanol at a ratio of 1 mg / mL. Prepare a slurry by adding 0.5 μL of Nafion 117 membrane solution to every 200 μL of dispersion. Distribute the slurry in batches of 1 cm³. 2① An electrode was fabricated by spraying 200 μL of slurry onto a titanium fiber felt electrode; ② Bio-based p-xylene was dissolved in 1 M KOH aqueous solution at a concentration of 50 g / L as the anolyte, and the catholyte was a 1 M KOH aqueous solution; ③ Using a platinum sheet electrode as the counter electrode and a mercury oxide electrode as the reference electrode, the above-fabricated electrode was used as the working electrode for electrochemical testing in a commercial H-type electrolytic cell; ④ Potentially constant electrolysis was performed at a potential of 0.8-1.2 V (vs. RHE), and the electrolysis product (p-methylbenzoic acid) was detected by nuclear magnetic resonance spectroscopy.

[0056] The Faraday efficiency and yield of the electrolysis products (p-methylbenzoic acid) obtained in Examples 1-9 were determined, and the results are shown in Tables 1 and 2.

[0057] Yield = Amount of product substance / Amount of substrate substance = (Mass of p-methylbenzoic acid / Relative molecular mass of p-methylbenzoic acid) / (Mass of p-xylene / Relative molecular mass of p-xylene).

[0058] Table 1 Electrocatalytic Results of Examples 1-5

[0059] Table 2 Electrocatalytic Results of Examples 6-9

[0060] The results in Tables 1 and 2 show that Example 6 is the optimal solution, producing 64 g / L p-methylbenzoic acid from 50 g / L p-xylene at a potential of 0.8V, with a Faraday efficiency FE=97.6% and a yield Yield=99.8%.

[0061] The solid p-methylbenzoic acid precipitated from the electrolyte obtained in Example 6 was used as the substrate for fermentation culture and fed-batch fermentation was carried out, eventually producing 52.6 g / L of terephthalic acid.

[0062] Example 10: Fed-batch fermentation using p-methylbenzoic acid as a substrate LB solid medium: Yeast extract 5 g / L, Tryptone 10 g / L, NaCl 10 g / L, agar 15 g / L.

[0063] LBHIS solid medium: Yeast extract 2.5 g / L, Tryptone 5 g / L, NaCl 5 g / L, BrainHeart Infusion 18.5 g / L, Sorbitol 91 g / L, Agar 15 g / L. LBHIS liquid medium does not contain agar.

[0064] LBG medium: Yeast extract 5 g / L, Tryptone 10 g / L, NaCl 10 g / L, glucose 20 g / L.

[0065] Fermentation medium: glucose 65 g / L, urea 5 g / L, corn steep liquor 8 g / L, K₂HPO₄ 1 g / L, KH₂PO₄ 1 g / L, biotin 4 × 10⁻⁶ -4 g / L, VB1 4×10 -4 g / L, trace element solution 2×10 -3 g / L.

[0066] Trace element solution: FeSO4·7H2O 10 g / L, MnSO4·H2O 10 g / L, ZnSO4·7H2O 1 g / L, CuSO4 2 g / L, NiCl·6H2O 0.02 g / L, concentrated hydrochloric acid 1 ml.

[0067] 1) A method for constructing recombinant Corynebacterium glutamicum (introducing a biosynthetic pathway from p-methylbenzoic acid to terephthalic acid), the steps of which are as follows: (1) Construction of the biosynthetic pathway from p-methylbenzoic acid to terephthalic acid Enzyme genes suitable for the biosynthetic pathway of p-methylbenzoic acid to terephthalic acid were screened from multiple microbial sources. Cytochrome p450 enzymes were selected from the CYP53A15 gene of *Cochliobolus lunatus* (GenBank accession number: EU597483.1) and the CPR1 gene (GenBank accession number: EU111681.1). p-Carboxybenzyl alcohol dehydrogenase was selected from the TsaC gene of *Comamonas testosteroni* T-2 (GenBank accession number: AH010657.3). Benzaldehyde dehydrogenase was selected from the mdlD gene of *Pseudomonas putida* (GenBank accession number: AY143338.1).

[0068] Codon optimization was performed on the CYP53A15 CPR1 gene (CYP53A15 and CPR1 genes were synthesized simultaneously), the TsaC gene, and the mdlD gene to adapt to the codon preference of Corynebacterium glutamicum, and the optimized nucleotide sequences were synthesized by BGI Genomics Co., Ltd. The optimized nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.

[0069] The optimized CYP53A15 CPR1 gene sequence is shown in SEQ ID NO.1.

[0070] ATGTTCCTGACCTCCCTGCTG GTACCAGGAAGATGTGTGGTCCTAA ; SEQ ID NO.1.

[0071] In SEQ ID NO.1, 1 - 1506 bp is the CYP53A15 sequence, 1507 - 1521 bp is the RBS sequence, and 1522 - 3612 bp is the CPR1 sequence.

[0072] The optimized TsaC gene sequence is shown as SEQ ID NO.2.

[0073] ATGAACCTGAACAAGCAGGTGG CAATCGTGACCGGCGGCGCATCTGGTTTTGGTGCAGCAATTGCACGCCGCCTGTCCCAGGCAGGTGCAGCAGTGTTAGTGGCAGATCTGAATGCAGAAGGCGCACAGCGCATGGCAACTGAACTGAACGCAGCAGGCGGCCGCGCATTGGGTATGGCATGTGATGTTTCTAAGGAAGCAGATTACCGCGCAGTGGTGGATGCAGCAATCGCACAGCTGGGCGGTTTGCATATTGTGGTGAACAACGCAGGTACCACCCACCGCAATAAACCAGCACTGGCAGTGACCGAAGATGAATTCGATCGCGTGTACCGCGTGAACCTGAAGTCCGTGTATTGGTCCGCACAGTGCGCACTGCCACATTTCGCACAGCAGGGCCATGGTGTGATGGTGAACGTGGCATCCACTACCGGCGTGCGCCCAGGTCCAGGTCTGACTTGGTACTCTGGTTCTAAAGCAGCAATGATCAACCTGACCAAGGGCCTGGCACTGGAATTCGCACGCTCTGGCGTGCGTATTAACGCAGTGAATCCAATGATCGGCGAAACCCCAATGATGGCAGATTTCATGGGCATGGAAGATACCCCAGCAAACCGCGAACGCTTCCTGTCCCGTATTCCACTGGGCCGCTTTACCCGCCCAGATGATGTGGCATCTGCAGTGGCATTCCTGGCATCCGATGATGCATCCTTCCTGACCGGCGTGTGCCTG GATGTGGATGGCGGTCGTAA TATCTAA ; SEQ ID NO.2.

[0074] The optimized mdlD gene sequence is shown in SEQ ID NO.3.

[0075] ATGAACTACCTGTCCCCAGCAAAG CGTGCGCATCGTGCCATAA ; SEQ ID NO.3.

[0076] (2) Construction of expression carrier The exogenous gene was introduced into Corynebacterium glutamicum via the expression vector pEC-XK99E and expressed under the control of a strong promoter (Ptac). The final recombinant expression vector was named pEC-XK99E-pTA-TPA.

[0077] The plasmid construction method is as follows: ① Using the codon-optimized CYP53A15 CPR1, TsaC, and mdlD gene sequences synthesized by BGI as templates, PCR amplification was performed using the corresponding primers for CYP53A15 CPR1-F / R, TsaC-F / R, and mdlD-F / R to obtain the target DNA fragments: CYP53A15 CPR1 gene fragment, TsaC gene fragment, and mdlD gene fragment.

[0078] Using pEC-XK99E plasmid as a template, PCR amplification was performed using primers pEC-F / R to obtain a linear vector.

[0079] The primer sequences used are as follows: CYP53A15 CPR1-F: 5'-gaattcgagctcAAGGAGGATATACAT ATGTTCCTGACCTCCCTGCTG -3';SEQ ID NO.4.

[0080] CYP53A15 CPR1-R: 5'-CAGGTTCATATGTATATCCTCCTT TTAGGACCACACATCTTCCTGGTAC -3';SEQ ID NO.5.

[0081] TsaC-F: 5'-GTGGTCCTAAAAGGAGGATATACAT ATGAACCTGAACAAGCAGGTGG -3';SEQ IDNO.6.

[0082] TsaC-R: 5'-GGTAGTTCATATGTATATCCTCCTT TTAGATATTACGACCGCCATCCACATC -3';SEQID NO.7。

[0083] mdlD-F: 5'-GTAATATCTAAAAGGAGGATATACAT ATGAACTACCTGTCCCCAGCAAAG -3';SEQID NO.8。

[0084] mdlD-R: 5'-cgactctaga TTATGGCACGATGCGCACG -3';SEQ ID NO.9.

[0085] pEC-F: 5'- CGTGCCATAA tctagagtcgacctgcaggc-3'; SEQ ID NO. 10.

[0086] pEC-R: 5'-GTCAGGAACATATGTATATCCTCCTTgagctcgaattcttctgtttcctgtg-3'; SEQ ID NO. 11.

[0087] PCR amplification reaction system: PrimerSTAR MAX 25 µL, upstream primer 2 µL, downstream primer 2 µL, template 1 µL, ddH2O 20 µL.

[0088] PCR amplification reaction program: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 57℃ annealing for 5 s, 68℃ extension for 10 s / 1kb, 34 cycles; 68℃ final extension for 5 min; store at 4℃.

[0089] ② The amplified target DNA fragment and linear vector were analyzed by agarose gel electrophoresis to verify the size of the amplified fragment, and the correct bands were excised and recovered from the gel. Gel recovery was performed according to the Novizan kit instructions. Next, these fragments were ligated using Gibson homologous recombination.

[0090] The total Gibson system is 10 µL, i.e., a+b+c+x+5=10; at the same time, the molar ratio of vector to gene is 1:3; that is, vector:gene1:gene2:gene3=1:3:3:3.

[0091] ③ After resuscitation, the ligation system was transferred to E. coli Trans10 and plated on LB agar plates. After 12 hours of incubation at 37°C, 10 single colonies were selected for colony PCR verification using primers JP-F / R. Following colony PCR, the PCR products were analyzed by agarose gel electrophoresis. If a clear band was observed at the expected location, it indicated that the plasmid carried by the colony had been successfully ligated. Three colonies with clear bands were selected and inoculated into tubes containing LB liquid medium with 50 mg / L kanamycin resistance, and incubated at 37°C for 12-14 hours. After incubation, the plasmid was extracted and sequenced. The sequencing results confirmed correctness. The corresponding bacterial cultures were stored in tubes containing 30% glycerol for subsequent experiments.

[0092] The primer JP-F / R sequence is as follows: JP-F: 5'-cacaggaaacagaagaattcgagctc-3'; SEQ ID NO. 12.

[0093] JP-R: 5'-caaaacagccaagcttgcatgc-3'; SEQ ID NO. 13.

[0094] (3) Transformation of Corynebacterium glutamicum The recombinant expression vector pEC-XK99E-pTA-TPA was introduced into *Corynebacterium glutamicum* ATCC13032 cells using electroporation. The steps were as follows: competent *Corynebacterium glutamicum* cells were prepared, mixed with the recombinant plasmid DNA, and electroporated at 1.8 kV. After recovery, the cells were plated on LBHIS solid medium plates containing 50 mg / L kanamycin, and positive transformants were screened.

[0095] 2) Bioreactor Experiment In the batch fermentation process in a 5 L bioreactor, the seed culture was first cultured: a single clone from an LBHIS solid medium plate was picked and cultured in 20 mL of LBHIS liquid medium at 30°C and 200 rpm for 12 hours. The 20 mL pre-culture solution was then inoculated into a 500 mL Erlenmeyer flask containing 180 mL of LBG medium and cultured at 30°C and 200 rpm for 16 hours. 200 mL of the seed culture was then inoculated into a 5 L bioreactor containing 1.8 L of fermentation medium, with the pH maintained at 6-8 and the temperature at 25-45°C. The product of the electrocatalytic bio-based p-xylene from Example 6 (0.8V), p-methylbenzoic acid, was used as the substrate for fermentation and was added to the bioreactor in batches (64 g of acidified electrolyte-p-methylbenzoic acid solid was added initially, i.e., when the seed culture was added, and another 64 g was added after 36 hours). To prevent excessive glucose consumption from affecting the fermentation process, a glucose solution of 800 g / L was added to the reactor as a feedstock. The addition rate was adjusted flexibly based on the remaining glucose concentration in the fermentation medium to maintain the glucose concentration at approximately 30 g / L. Throughout the fermentation process, biomass, glucose concentration, and the yield of disodium terephthalate were monitored regularly to ensure efficient and stable fermentation. Disodium terephthalate and glucose were detected by high-performance liquid chromatography (HPLC). The results are shown in Table 3.

[0096] Table 3. Bioreactor Experiment of Electrolyte Products at 0.8V in Example 6

[0097] Terephthalic acid is obtained by acidification of disodium terephthalate.

[0098] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. An electrocatalyst for the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid, characterized in that, The electrocatalyst is a copper oxide system electrocatalyst, a cerium hydroxide system electrocatalyst, or a layered bimetallic hydroxide system electrocatalyst. The preparation method of the copper oxide system electrocatalyst is as follows: (1) Preparation of precursors ① Prepare a solution containing 10-50 mM copper salt in 90 mL of deionized water; ② Slowly add 10 mL of 100-500 mM citric acid aqueous solution to the above solution, stirring vigorously until completely dissolved; ③ Adjust the pH value to 8-12 with 100 mM NH4·H2O; ④ Transfer the obtained solution to a hydrothermal reactor liner made of polytetrafluoroethylene, and place it in an oven to react at 180-240℃ for 24-48 hours; ⑤ After the reaction is completed, cool to room temperature, filter out the precipitate in the liner and wash it, wash it twice with deionized water, then wash it twice with anhydrous ethanol, and then wash it once with deionized water. Place the washed precipitate in a vacuum oven to dry at 60-80℃; (2) Sintering of copper oxide support ① Take out the dried precursor and weigh 100-500mg. Grind it thoroughly with an agate mortar. ② Spread the ground powder evenly in a corundum crucible and transfer it to a vacuum tube furnace. Calcine it in air at a heating rate of 2-10℃ / min from room temperature to 300-500℃ for 2-5 hours. ③ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol. Dry it in a vacuum oven. (3) Construction of surface oxygen vacancies ① Take out the dried copper oxide, weigh 100-500 mg, and disperse it in 20-100 mL of anhydrous ethanol; ② After sonicating the solution for two days, filter it, and transfer the filtered solid to a vacuum oven to dry; ③ Place the powder obtained after vacuum drying into a corundum crucible and spread it evenly, transfer it to a vacuum tube furnace, and calcine it at a heating rate of 2-10 °C / min from room temperature to 500-800 °C for 5-10 hours under a 5% H2 + 95% Ar atmosphere; ④ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol, and place it in a vacuum oven to dry; The preparation method of the cerium hydroxyl oxide system electrocatalyst is as follows: (I) Preparation of precursors ① Prepare a solution containing 10-50 mM cerium salt in 90 mL of deionized water; ② Slowly add 10 mL of 100-500 mM citric acid aqueous solution to the above solution, stirring vigorously until completely dissolved; ③ Adjust the pH to 8-12 with 100 mM NH4·H2O to obtain a bluish-green transparent solution; ④ Transfer the obtained bluish-green transparent solution to a hydrothermal reactor liner made of polytetrafluoroethylene, and place it in an oven to react at 180-240℃ for 24-48 hours; ⑤ After the reaction is completed, cool to room temperature, filter out the precipitate in the liner, wash it, wash it twice with deionized water, then wash it twice with anhydrous ethanol, and then wash it once with deionized water. Place the washed precipitate in a vacuum oven to dry at 60-80℃; (II) Sintering of cerium oxide support ① Take out the dried precursor and weigh 100-500mg. Grind it thoroughly with an agate mortar. ② Spread the ground powder evenly in a corundum crucible and transfer it to a vacuum tube furnace. Calcine it in air at a heating rate of 2-10℃ / min from room temperature to 300-500℃ for 2-5 hours. ③ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol. Dry it in a vacuum oven. (III) Sintering of cerium hydroxyoxide ① Take out the above-mentioned cerium oxide and weigh it to 100-500mg; ② Place the weighed powder into a corundum crucible and spread it evenly, transfer it to a vacuum tube furnace, and calcine it at a heating rate of 2-10℃ / min from room temperature to 600-900℃ for 5-10 hours under a 5% H2 + 95% Ar atmosphere; ③ After the reaction is completed, take out the product, wash it twice with deionized water and then wash it twice with anhydrous ethanol, and dry it in a vacuum oven. The preparation method of the layered bimetallic hydroxide system electrocatalyst is as follows: ① Take 30 mL of salt solution; the salt solution is a mixture of copper salt, cobalt salt and iron salt in a certain molar concentration ratio of x mmol / L: y mmol / L: y mmol / L, where x = 1%~3% of y and y = 10~100; ② Add 10~100 mg of ammonium fluoride and 300~600 mg of urea, and then stir at 0~5℃ under an argon atmosphere for 96~128 hours; ③ Adjust the pH of the above solution to 7~9 with potassium hydroxide, stir again for 24~48 hours, and filter to obtain a precursor containing Cu, Co and Fe hydroxides; ④ Transfer the filtered precursor to a vacuum tube furnace and age it at 200~450℃ under an argon atmosphere for 6~12 hours; ⑤ After the reaction is complete, take out the product, wash it twice with deionized water and then twice with anhydrous ethanol, and dry it in a vacuum oven.

2. The electrocatalyst for the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid according to claim 1, characterized in that, The copper salt is copper nitrate, copper chloride, or copper acetate; The cerium salt is cerium nitrate, cerium chloride, or cerium sulfate; The cobalt salt is cobalt nitrate, cobalt chloride, or cobalt sulfate; The iron salt is ferric nitrate, ferric chloride, or ferric sulfate.

3. The use of the electrocatalyst according to claim 1 or 2 in the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid.

4. A recombinant expression vector, characterized in that, Exogenous expression of cytochrome p450 enzyme genes, p-carboxybenzyl alcohol dehydrogenase genes, and benzaldehyde dehydrogenase genes; The nucleotide sequence of the cytochrome p450 enzyme gene is shown in SEQ ID NO.1; The nucleotide sequence of the p-carboxybenzyl alcohol dehydrogenase gene is shown in SEQ ID NO.2; The nucleotide sequence of the benzaldehyde dehydrogenase gene is shown in SEQ ID NO.

3.

5. A recombinant Corynebacterium glutamicum, characterized in that, Using Corynebacterium glutamicum ATCC 13032 as the starting strain, the recombinant expression vector described in claim 4 was transformed.

6. The use of the recombinant expression vector of claim 4 or the recombinant Corynebacterium glutamicum of claim 5 in the production of terephthalic acid.

7. A method for preparing terephthalic acid by coupling electrocatalysis and microbial fermentation, characterized in that, Includes the following steps: S1. Electrocatalytically oxidize bio-based p-xylene to p-methylbenzoic acid; S2. Using p-methylbenzoic acid as a substrate, the recombinant glutamate rod-shaped bacteria described in claim 5 is used for fermentation culture to convert p-methylbenzoic acid into terephthalic acid.

8. The method for preparing terephthalic acid by coupling electrocatalysis and microbial fermentation according to claim 7, characterized in that, The step S1, which involves the electrocatalytic oxidation of bio-based p-xylene to p-methylbenzoic acid, is as follows: ① The electrocatalyst according to claim 1 is prepared into a dispersion at a ratio of 1 mg dispersed in 200 μL of isopropanol, and a slurry is prepared by adding 0.5 μL of Nafion 117 membrane solution to every 200 μL of dispersion. The slurry is then prepared at a ratio of 1 cm 2 ① An electrode is fabricated by spraying 200 μL of slurry onto a titanium fiber felt electrode; ② Bio-based p-xylene is dissolved in 1M KOH aqueous solution at a concentration of 1~50 g / L as the anolyte and the catholyte is 1M KOH aqueous solution; ③ Using a platinum sheet electrode as the counter electrode and a mercury oxide electrode as the reference electrode, and using the electrode fabricated in step ① as the working electrode, electrochemical tests are performed in an H-type electrolytic cell; ④ Constant potential electrolysis is performed at a potential of 0.8-1.2 V vs. RHE, and the electrolysis products are detected by nuclear magnetic resonance spectroscopy.

9. The method for preparing terephthalic acid by coupling electrocatalysis and microbial fermentation according to claim 7, characterized in that, The fermentation culture conditions described in step S2 are: temperature 15-35 ℃, pH 6-9.

Images