Application of ZmNIPP1 gene in regulation and control of plant cold resistance

By identifying and creating mutants and overexpression lines of the maize ZmNIPP1 gene, the problem of maize's adaptation to low-temperature stress was solved. The mutants showed enhanced cold resistance, and the overexpression lines showed enhanced cold sensitivity, providing new breeding theories and materials.

CN121610499APending Publication Date: 2026-03-06LANZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610147087.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-02
Publication Date
2026-03-06

AI Technical Summary

Technical Problem

In the current technology, the response and adaptation mechanisms of maize to low temperature stress are not fully understood, which leads to limited growth of maize under low temperature conditions, affecting yield and quality.

Method used

By identifying and creating mutants and overexpression lines of the maize ZmNIPP1 gene, gene editing technology was used to change the expression level of the ZmNIPP1 gene, and mutants and overexpression lines were constructed to verify their response to low temperature stress.

Benefits of technology

The mutants exhibited stronger cold resistance at low temperatures and reduced cell membrane damage, while the overexpression lines showed enhanced cold sensitivity. This provides a new theory for elucidating the cold resistance mechanism of maize and offers target genes and materials for targeted breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121610499A_ABST
    Figure CN121610499A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to application of a corn gene ZmNIPP1 in regulation and control of cold resistance of plants. The ZmNIPP1 gene has a nucleotide sequence as shown in SEQ ID NO. 1 and SEQ ID NO. 2, and the ZmNIPP1 gene has a nucleotide sequence as shown in SEQ ID NO. According to the invention, a mutant Zmnipp1 of the gene is obtained through a gene editing technology, and an overexpression strain ZmNIPP1-OE of the gene is constructed through genetic transformation. Phenotype identification finds that after low-temperature stress, leaf damage of a mutant plant is obviously lighter than that of a wild type plant, and leaf damage of an overexpression plant is more serious. The ion leakage rate determination further proves that the cell membrane damage degree of the mutant is obviously lower than that of the wild type, and the overexpression strain is obviously higher than that of the wild type. The result shows that the ZmNIPP1 is a gene for negatively regulating and controlling the cold resistance of the corn. The invention provides an important candidate gene and a theoretical basis for cultivating a new corn variety with enhanced cold resistance by utilizing a genetic engineering technology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of maize stress resistance gene mining, specifically involving the application of the maize gene ZmNIPP1 in maize cold resistance. Background Technology

[0002] Low temperature stress is a major environmental stress that threatens agricultural production and limits the distribution of many important crops. The adverse effects of low temperature stress on plants involve many physiological and biochemical aspects, including photosynthesis, respiration, enzymatic reactions, carbon-nitrogen (C / N) balance, secondary metabolism, and nutrient uptake. Therefore, exposure to lower temperatures may lead to poor germination, slow seedling growth, and even tissue or whole plant death, thereby reducing crop quality, delaying harvest, and even causing crop failure.

[0003] Maize (Zea mays L.) is a staple food resource for a large portion of the world's population. As a tropical crop, maize is susceptible to the effects of low temperatures. Cold stress is an environmental factor that adversely affects maize growth and development, limits its geographical distribution, and thus reduces global crop yields. Therefore, identifying genes regulating cold resistance and discovering the response and adaptation mechanisms of maize to cold stress will be beneficial for breeding cold-resistant maize varieties. Inactivating endogenous stress-sensitive genes in plants through gene knockout or silencing techniques, thereby enabling offspring to exhibit stable heritable stress resistance, is crucial for elucidating the mechanisms of cold tolerance. Although some research has been reported on cold-resistant genes in maize, developing genes with superior cold-resistance functions remains important for obtaining maize varieties with excellent cold-resistant phenotypes. Summary of the Invention

[0004] The key technical problem this invention aims to solve lies in the application of ZmNIPP1 with cold-resistant properties. To solve the above technical problem, this invention adopts the following technical solution:

[0005] 1. The maize ZmNIPP1 gene, wherein the ZmNIPP1 gene has two transcripts. Transcript one, as shown in SEQ ID No. 1, has a full length of 2209 bp, of which the CDS region from 624 bp to 1901 bp is a sequence of 1278 bp. Transcript two, as shown in SEQ ID No. 2, has a full length of 1731 bp, of which the CDS region from 146 bp to 1323 bp is a sequence of 1278 bp. The CDS sequences of the two transcripts are identical.

[0006] 2. Identification of the maize mutant Zmnipp1

[0007] We ordered maize mutants from https: / / maizeems.qlnu.edu.cn / and verified that the mutant had a G-to-A mutation in the first base of the first intron, which prevented the intron from being cleaved out. The large insertion of this intron led to impaired protein function.

[0008] 3. Construction of ZmNIPP1 overexpression lines.

[0009] NIPP1 and YFP were amplified using primers IF-BamH1-ZmNIPP1-F / ZmNIPP1-YFP-lianjie-R and ZmNIPP1-YFP-lianjie-F / IF-Spe1-YFP-R, respectively, spliced, and recovered via gel electrophoresis. The WMV012--BAR--ubi+GFP vector was double-digested with BamHI and SpeI to obtain a linear vector. This linear vector, along with the purified PCR product, was incubated with infusion enzyme at 37°C for 30 min to recombinant the target gene into WMV012--BAR--ubi+GFP. The ligation product was transformed into competent E. coli DH5α cells. Plaques were picked and amplified by PCR using primers IF-BamH1-ZmNIPP1-F / IF-Spe1-YFP-R, and the results were verified. Plaques with correct sequencing were cultured in LB broth containing kanamycin, and plasmids were extracted. The overexpression vector was transferred into KN5585 via pollen transformation. The progeny were identified using primers IF-BamH1-ZmNIPP1-F / IF-Spe1-YFP-R to determine positive plants. The primer sequences are as follows:

[0010] IF-BamH1-ZmNIPP1-F: gactctagaggatccATGTACCGTGGGGCCTTGA;

[0011] IF-Spe1-YFP-R: tcgagctcgctgttactagtTCACTTGTACAGCTCGTCCA;

[0012] ZmNIPP1-YFP-lianjie-F: TTGTTCGGTGACACGATGGTGAGCAAGGGC;

[0013] ZmNIPP1-YFP-lianjie-R: GCCCTTGCTCACCATCGTGTCACCGAACAA.

[0014] 4. Phenotypic identification.

[0015] The growth of plants after low-temperature treatment and recovery from B73 group (obtained from the National Crop Germplasm Resource Bank), KN5585 group (obtained from Weimi Biotechnology Co., Ltd.), gene knockout line Zmnipp1, and gene overexpression line ZmNIPP1-OE is as follows: Figure 2 As shown (the left image is the control group without low-temperature treatment, and the right image is the experimental group after low-temperature treatment and recovery). The results showed that the wild-type leaves were severely wilted, dried out, and even unable to stand upright, while the mutant lines only had slight damage to the leaf tips and remained upright, showing a low-temperature resistant phenotype.

[0016] 5. Statistics on ion leakage rate.

[0017] The relative conductivity of the leaves was measured as L = (S1-S0) / (S2-S0)*100%. After low-temperature treatment, an entire corn plant was placed in a 15ml centrifuge tube containing 10mL of distilled water and shaken at room temperature for 1 hour. The initial conductivity (S1) was then measured. The sample was then placed in a boiling water bath for 30 minutes, removed, and shaken for 1 hour. The conductivity was measured again and recorded as S2. S0 was the conductivity of the blank control distilled water. The method is referenced (Zeng et al., 2021). Ion leakage rate reflects cell membrane integrity; the test results are as follows... Figure 3 As shown in Table 1, compared with the B73 group, the ion leakage rates of the mutant lines Zmnipp1 9# and Zmnipp1 11# were reduced by 4.4% and 4.7% respectively (the average difference between the ion leakage rates of wild-type plants and knockout lines in three trials), reaching a statistically significant difference (p < 0.05). This indicates that the degree of cell damage was significantly lower in the Zmnipp1 group than in the B73 group, and that knocking out maize Zmnipp1 enhances its cold tolerance. This further demonstrates that the mutant line Zmnipp1 possesses a certain degree of cold tolerance. However, the ion permeability of the overexpressing lines ZmNIPP1-OE 53# and ZmNIPP1-OE 54# increased by 24.8% and 24.5% respectively compared with KN5585 (the average difference of ion permeability between wild-type plants and knockout lines in three trials), reaching a significant difference (p < 0.01). This indicates that the degree of cell damage was significantly higher in the ZmNIPP1 overexpression group than in the KN5585 group. Overexpression of the ZmNIPP1 gene can enhance maize's cold sensitivity and reduce its cold resistance.

[0018] Beneficial Effects: This invention is the first to clearly identify the maize ZmNIPP1 gene as a key cold-sensitive gene, and its expression level is negatively correlated with cold tolerance. Through positive and negative verification using mutants and overexpression lines, it was found that mutants with the gene knocked out only suffered slight damage to the leaf tips at low temperatures, and the plants remained upright, while the wild type suffered severe wilting; the overexpression lines showed exacerbated cold damage. Ion leakage rate measurements further quantitatively confirmed that cell membrane damage was significantly reduced in mutants, while damage was significantly aggravated in overexpression lines. This research provides a new theory for elucidating the cold resistance mechanism of maize and provides a clear target gene and key technical materials for the targeted breeding of new cold-resistant maize varieties through gene editing or molecular breeding. Attached Figure Description

[0019] Figure 1 The edited form of the mutant Zmnipp1 involves a G-to-A mutation in the first base of the first intron of the ZmNIPP1 genome, resulting in intron retention and altering the structure and function of the translated protein. This may cause the protein to lose its normal function or acquire new non-functional properties.

[0020] Figure 2 This is a schematic diagram of the growth of wild-type maize plants, mutant line Zmnipp1, and overexpression line ZmNIPP1-OE after low-temperature treatment recovery provided in Example 2 of the present invention; wherein B73 and KN5585 represent wild-type maize plants.

[0021] Figure 3 This is a statistical chart of the ion leakage rate results of the mutant line Zmnipp1 and the overexpression line ZmNIPP1-OE provided in Example 2 of the present invention; where B73 and KN5585 represent wild-type maize plants.

[0022] Figure 4 This is a schematic diagram of the ear growth of the overexpression strain provided in Embodiment 2 of the present invention. This strain was obtained by pollen transformation.

[0023] Figure 5 It is the nucleotide sequence shown in SEQ ID NO. 1.

[0024] Figure 6 It is the nucleotide sequence shown in SEQ ID NO. 2. Detailed Implementation

[0025] Unless otherwise specified, the methods and apparatus used in the following embodiments of this invention are conventional methods and apparatus; the equipment and reagents used are all conventional equipment and reagents purchased from reagent companies. To make the objectives, technical solutions, and advantages of this invention clearer, the specific implementation methods of this invention are described in detail below with reference to specific embodiments. Examples of these preferred embodiments are illustrated in the specific embodiments. It should also be noted that, in order to avoid obscuring the technical solution of this invention due to unnecessary details, only technical solutions and / or processing steps closely related to the solution according to this invention are shown in the embodiments, while other details that are not closely related are omitted.

[0026] Example 1

[0027] The maize gene ZmNIPP1 has two transcripts, as shown in SEQ ID NO. 1, with a full length of 2209 bp, of which 624 bp-1901 bp is the CDS region, totaling 1278 bp; and the transcripts shown in SEQ ID NO. 2, with a full length of 1731 bp, of which 146 bp-1323 bp is the CDS region, totaling 1278 bp.

[0028] Example 2

[0029] The identification method for the maize mutant Zmnipp1 includes the following steps: order the maize mutant from https: / / maizeems.qlnu.edu.cn / . After verification, it was found that the first base of the first intron of the mutant was changed from G to A. The intron could not be cleaved out. The large fragment insertion caused the protein to lose its normal function or acquire new non-functional properties.

[0030] NIPP1, as the regulatory subunit of the protein phosphatase PP1, regulates multiple aspects of cell division by modulating PP1 function. We then identified its homolog, ZmNIPP1, in maize through protein sequence alignment. Obtaining the CDS sequence of the target gene from the NCBI website, we designed primers to clone the maize ZmNIPP1 gene: IF-BamH1-ZmNIPP1-F: gactctagaggatccATGTACCGTGGGGGCCTTGA, ZmNIPP1-YFP-lianjie-R: GCCCTTGCTCACCATCGTGTCACCGAACAA.

[0031] Using IF-BamH1-ZmNIPP1-F / ZmNIPP1-YFP-lianjie-R as upstream and downstream primers, respectively, and maize B73 seedling leaf cDNA as a template, PCR amplification was performed to obtain the target gene. The PCR amplification reaction was conducted in a BIO-RAD S1000 ThermalCycler PCR instrument with the following program: 95℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 5 min; and storage at 15℃. The PCR products were verified by agarose gel electrophoresis.

[0032] Example 3

[0033] This embodiment provides a method for constructing a ZmNIPP1 overexpression line, including the following steps:

[0034] (1) Vector construction: NIPP1 and YFP were amplified using primers IF-BamH1-ZmNIPP1-F / ZmNIPP1-YFP-lianjie-R and ZmNIPP1-YFP-lianjie-F / IF-Spe1-YFP-R, respectively, spliced, and recovered by gel electrophoresis. The WMV012--BAR--ubi+GFP vector was obtained by double digestion with BamHI and SpeI. The target gene was recombined into WMV012--BAR--ubi+GFP by infusion enzyme reaction in a 37℃ water bath for 30 min with the purified PCR product. The ligation product was transformed into competent E. coli DH5α cells. Plaques were picked and PCR amplified using primers IF-BamH1-ZmNIPP1-F / IF-Spe1-YFP-R. The amplified plaques were then sent for verification. Plaques with correct sequencing were cultured in LB suspension containing kanamycin and plasmids were extracted.

[0035] (2) Magnetic bead transformation of maize: a. Based on the flowering status of the inbred line and the transformation requirements of the vector, estimate the transformation experiments to be performed on the same day and perform magnetic bead-DNA binding. Take 200 μL into a PCR tube, write the transformation number on the tube cap, add 160 μL of 200 ng / μL DNA and 8 μL of 1 μg / μL magnetic nanobeads, gently pipette and mix well, and let it stand at room temperature for 30 min to bind. b. Collect fresh pollen from the maize inbred line during its peak flowering period and pass it through a 100-mesh sieve. Weigh about 2 g of the sieved pollen and transfer it to a 15 mL round-bottom centrifuge tube (label the tube wall with the transformation number), then add 8 mL of pre-cooled maize pollen culture medium at 4-8℃, cap and gently invert to mix well, and let it stand at 4-8℃ with the well open for 10 min. c. Add the combined magnetic bead-DNA mixture (168 μL) to a pollen centrifuge tube with openings at 4-8℃, cover, gently invert to mix, and place the tube flat on a magnetic plate for 20 minutes at 4-8℃. d. Place a 20cm square piece of 300-mesh nylon cloth on five layers of 18cm diameter round filter paper. Carefully remove 7mL of supernatant from the magnetically converted pollen. Gently mix the remaining pollen suspension and pour it onto one half of the nylon cloth. Cover the pollen with the other half of the nylon cloth, fold the filter paper in half, and gently press to absorb excess moisture. e. Unfold the nylon cloth on the 18cm diameter filter paper, and evenly sprinkle 3g of cornstarch on the pollen. Use a clean toothbrush to brush the pollen and cornstarch evenly and disperse them into a fine powder. f. Transfer the magnetically converted pollen particles into a sealed paper bag and pollinate 10 flowering female ears as soon as possible, following the method described in (Wang et al., 2022).

[0036] (3) Screening of positive plants.

[0037] The obtained progeny were identified using primers IF-BamH1-ZmNIPP1-F / IF-Spe1-YFP-R to confirm positive plants.

[0038] Example 4

[0039] The phenotypic identification method includes the following steps: First, seeds of groups B73, KN5585 (wild-type maize), and Zmnipp1 and ZmNIPP1-OE were sown in small pots (10cm long, 10cm wide, and 10cm high) containing black soil, imported soil, and vermiculite (mass ratio 1:1:1). Four seeds were placed in each line, and then covered with 2cm of soil. The pots were placed on a tray and watered until the soil was completely moist. The pots were then placed in a 23℃ incubation room with 16 hours of light and 8 hours of darkness. After 14 days of growth, the plants were treated with a 4℃ low-temperature treatment for 5 days until the second leaf wrinkled and wilted. After that, the plants were removed and placed in a 23℃ incubation room for two days to recover. The results showed that the wild-type leaves were severely wilted, dried out, and even unable to stand upright, while the mutant lines only had slight damage to the leaf tips and remained upright, showing a phenotype of resistance to low temperatures.

[0040] Example 5

[0041] The statistical method for ion leakage rate includes the following steps: The relative conductivity of the leaves is measured as L = (S1-S0) / (S2-S0)*100%. After low-temperature treatment, an entire corn plant is placed in a 15ml centrifuge tube containing 10ml of distilled water and shaken at room temperature for 1 hour. The initial conductivity is then measured as S1. The sample is then placed in a boiling water bath for 30 minutes, removed, and shaken for 1 hour. The conductivity is measured again and recorded as S2. S0 is the conductivity of the blank control distilled water. Ion leakage rate reflects cell membrane integrity; the test results are as follows... Figure 3 As shown in Table 1, compared with the B73 group, the ion leakage rates of the mutant lines Zmnipp19# and Zmnipp11# were reduced by 4.4% and 4.7% respectively (the average difference in ion leakage rates between the wild-type plants and the knockout lines in three trials), reaching a statistically significant difference (p < 0.05). This indicates that the degree of cell damage was significantly lower in the B73 group, and knocking out the maize ZmNIPP1 gene can enhance its cold tolerance. This further illustrates that the mutant line Zmnipp1 has a certain degree of cold tolerance. However, the ion permeability of the overexpressing lines ZmNIPP1-OE 53# and ZmNIPP1-OE 54# increased by 24.8% and 24.5% respectively compared with KN5585 (the average difference of ion permeability between wild-type plants and knockout lines in three trials), reaching a significant difference (p < 0.01), indicating that the degree of cell damage was significantly higher than that of the KN5585 group, and that overexpression of the ZmNIPP1 gene can enhance the cold sensitivity of maize.

[0042] Table 1. Ion leakage rate values ​​(%) from three independent experiments

[0043] B73 zmnipp1 9# zmnipp1 11# KN5585 ZmnNIPP1-OE 53# ZmnNIPP1-OE 54# 20.2 13.0 15.3 13.6 35.7 39.7 18.5 14.3 14.6 6.2 29.5 35.8 17.2 15.4 11.8 14.7 31.6 32.6

[0044] The above description is only a specific embodiment of this application. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of this application, and these improvements and modifications should also be considered within the scope of protection of this application. References:

[0045] Zuo-Ping Wang, Zhong-Bao Zhang, Deng-Yu Zheng, Tong-Tong Zhang,Xiang-Long Li, Chun Zhang, Rong Yu, Jian-Hua Wei, Zhong-Yi Wu, 2022.Efficient and genotype independent maize transformation using pollentransfected by DNA-coated magnetic nanoparticles. Journal of IntegrativePlant Biology, 64(6):1145-1156. DOI: 10.1111 / jipb.13263.

[0046] Zeng R., Li Z., Shi Y., Fu D., Yin P., Cheng J., Jiang C., Yang S,2021. Natural variation in a type-A response regulator confers maize chillingtolerance. Nat Commun 12 , 4713 .

Claims

1. A maize ZmNIPP1 gene characterized in that The ZmNIPP1 gene has two transcripts, the first transcript is shown as SEQ ID No. 1, wherein 624 bp-1901 bp is the CDS region; the second transcript is shown as SEQ ID No. 2, wherein 146 bp-1323 bp is the CDS region; the CDS sequences of the two transcripts are consistent.

2. Use of the maize ZmNIPP1 gene in regulating cold tolerance of plants, characterized in that The nucleotide sequence of the gene is shown as positions 624-1901 in SEQ ID NO: 1, or positions 146-1323 in SEQ ID NO: 2; the expression or activity of the gene is reduced or inhibited for improving the cold tolerance of plants.

3. A maize mutant plant characterized by The mutant plant has a functional loss of the ZmNIPP1 gene in the genome, and the nucleotide sequence of the ZmNIPP1 gene is shown as positions 624-1901 in SEQ ID NO: 1; preferably, the functional loss is caused by the mutation of the first base of the first intron of the gene from G to A, resulting in the failure of the intron to be spliced.

4. A recombinant expression vector for improving cold tolerance of corn, characterized by The construct unit for inhibiting or knocking out the expression of the ZmNIPP1 gene of corn, and the nucleotide sequence of the ZmNIPP1 gene is shown as positions 624-1901 in SEQ ID NO: 1, or positions 146-1323 in SEQ ID NO:

2.

5. The recombinant expression vector of claim 3, wherein, The construct unit is a CRISPR / Cas9 gene editing element or an RNA interference expression element for the ZmNIPP1 gene.

6. A method for cultivating maize plants with improved cold tolerance, characterized in that... The method comprises the following steps: Reducing or inhibiting the expression or activity of the ZmNIPP1 gene having the nucleotide sequence shown as positions 624-1901 in SEQ ID NO: 1 or positions 146-1323 in SEQ ID NO: 2 in a corn plant.

7. A method of identifying or aiding in the identification of cold tolerance in maize, characterized by The method comprises detecting the expression level or protein activity of the ZmNIPP1 gene in a corn sample, wherein the expression level or protein activity of the gene is negatively correlated with the cold tolerance; and the nucleotide sequence of the ZmNIPP1 gene is shown as positions 624-1901 in SEQ ID NO: 1.