Method for breeding cyst nematode-resistant No.4 physiological race soybean variety

Abstract

The invention belongs to the technical field of molecular marker-assisted selective breeding, and particularly relates to a method for breeding an anti-cyst nematode No.4 physiological race soybean variety. The invention provides a PCR (Polymerase Chain Reaction) primer combination for screening an anti-cyst nematode No.4 physiological race soybean variety, wherein the PCR primer combination comprises a first PCR primer group, a second PCR primer group and a third PCR primer group; the first PCR primer group consists of primers with nucleotide sequences as shown in SEQ ID NO: 1-3; the second PCR primer group consists of primers with nucleotide sequences as shown in SEQ ID NO: 4-6; and the third PCR primer group consists of primers with nucleotide sequences as shown in SEQ ID NO: 7-9. The invention further provides a method for breeding the cyst nematode-resistant No.4 physiological race soybean variety. When the method is used for marker-assisted selection, the efficiency and accuracy of soybean cyst nematode-resistant breeding can be greatly improved.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted selection breeding technology, specifically relating to a method for breeding soybean varieties resistant to cyst nematode race 4. Background Technology

[0002] Soybean cyst nematode (SCN) is a global soybean disease, widely distributed in major soybean-producing countries such as China, the United States, Brazil, and Argentina, posing a serious threat to soybean production. This nematode invades the vascular tissue of soybean roots, establishing permanent feeding sites and interfering with water and nutrient transport, leading to poor root development, yellowing leaves, stunted plants, and in severe cases, plant death. It causes economic losses exceeding one billion US dollars annually worldwide.

[0003] Breeding and promoting disease-resistant varieties is the most economical and effective measure for controlling this disease. Several SCN resistance genes have been identified, including two major genes: GmSNAP18 (encoding a soluble N-ethylmaleimide-sensitive factor attachment protein) and GmSHMT08 (encoding a serine hydroxymethyltransferase), and one minor gene, GmSNAP11 (homologous to GmSNAP18, also encoding a soluble N-ethylmaleimide-sensitive factor attachment protein). Although these genes have been cloned, their resistance mechanisms and genetic effects on different physiological races (especially race 4) are not fully understood. Furthermore, existing marker-assisted selection techniques lack a stable and efficient multi-gene aggregation selection system, limiting the efficiency and accuracy of disease-resistant breeding. Therefore, it is necessary to develop new molecular markers to efficiently screen soybean varieties resistant to soybean cyst nematode disease. Summary of the Invention

[0004] The purpose of this invention is to provide primer combinations and methods for screening soybean varieties resistant to cyst nematode race 4.

[0005] In a first aspect, the present invention provides a PCR primer set for screening soybean varieties resistant to cyst nematode race 4, comprising a first PCR primer set, a second PCR primer set, and a third PCR primer set.

[0006] The first PCR primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO:1-3, which are used to amplify the SNP site with physical location Chr18:1705688 and alleles G / T. At this site, GG is the disease-resistant genotype and TT is the disease-susceptible genotype.

[0007] The second PCR primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO:4-6, used to amplify the SNP site with physical location Chr08:8451018 and alleles G / C. At this site, GG represents the disease-resistant genotype and CC represents the disease-susceptible genotype.

[0008] The third PCR primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO:7-9, used to amplify the SNP site with physical location Chr11:38918778 and alleles A / C. At this site, AA represents the disease-resistant genotype and CC represents the disease-susceptible genotype.

[0009] The physical location was determined based on the whole genome sequence of soybean genome version Gmax_ZH13_v2.0.

[0010] Secondly, the present invention provides a kit comprising the PCR primer combination described above for screening soybean varieties resistant to cyst nematode race 4.

[0011] Thirdly, the present invention provides a KASP primer set for screening soybean varieties resistant to cyst nematode race 4, comprising a first KASP primer set, a second KASP primer set, and a third KASP primer set;

[0012] The first KASP primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:3, which are used to amplify the SNP site with physical location Chr18:1705688 and alleles G / T. At this site, GG is the disease-resistant genotype and TT is the disease-susceptible genotype.

[0013] The second KASP primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO:12, SEQ ID NO:13 and SEQ ID NO:6, which are used to amplify the SNP site with physical location Chr08:8451018 and alleles G / C. At this site, GG is the disease-resistant genotype and CC is the disease-susceptible genotype.

[0014] The third KASP primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO:14, SEQ ID NO:15 and SEQ ID NO:9, and is used to amplify the SNP site with physical location Chr11:38918778 and alleles A / C. At this site, AA is the disease-resistant genotype and CC is the disease-susceptible genotype.

[0015] The physical location was determined based on the whole genome sequence of soybean genome version Gmax_ZH13_v2.0.

[0016] Fourthly, the present invention provides a kit comprising the KASP primer combination described above for screening soybean varieties resistant to cyst nematode race 4.

[0017] In some embodiments, the kit further includes a KASP premix; the KASP premix comprises a first fluorescent probe, a first quenching probe, a second fluorescent probe, and a second quenching probe.

[0018] The nucleotide sequence of the first fluorescent probe is shown in SEQ ID NO:16, with a first fluorescent group attached to its 5' end; the nucleotide sequence of the first quencher probe is inversely complementary to the nucleotide sequence of the first fluorescent probe, with a quencher group attached to its 3' end.

[0019] The nucleotide sequence of the second fluorescent probe is shown in SEQ ID NO:17, with a second fluorescent group attached to its 5' end; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second fluorescent probe, with a quencher group attached to its 3' end.

[0020] In some embodiments, the first fluorescent group is FAM and the second fluorescent group is HEX.

[0021] Fifthly, the present invention seeks protection for the use of the PCR primer combination described in the first aspect, the kit described in the second aspect, the KASP primer combination described in the third aspect, or the kit described in the fourth aspect in the selection of soybean varieties resistant to cyst nematode race 4.

[0022] Sixthly, the present invention provides a method for breeding soybean varieties resistant to cyst nematode race 4, comprising the following steps:

[0023] a) Extracting genomic DNA from soybean materials;

[0024] b) Using the genomic DNA as a template, perform PCR using the first PCR primer set, the second PCR primer set, and the third PCR primer set, respectively;

[0025] c) Detect the PCR products to determine the genotype of the SNP loci amplified by each PCR primer set of the soybean material, and screen for the first soybean variety with disease-resistant genotypes at all three SNP loci.

[0026] In a seventh aspect, the present invention provides another method for breeding soybean varieties resistant to cyst nematode race 4, comprising the following steps:

[0027] a) Extracting genomic DNA from soybean materials;

[0028] b) Add KASP premix to the genomic DNA and perform KASP amplification using the first KASP primer set, the second KASP primer set, and the third KASP primer set, respectively;

[0029] The KASP premix contains a first fluorescent probe, a first quenching probe, a second fluorescent probe, and a second quenching probe.

[0030] The nucleotide sequence of the first fluorescent probe is shown in SEQ ID NO:16, with a first fluorescent group attached to its 5' end; the nucleotide sequence of the first quencher probe is inversely complementary to the nucleotide sequence of the first fluorescent probe, with a quencher group attached to its 3' end.

[0031] The nucleotide sequence of the second fluorescent probe is shown in SEQ ID NO:17, with a second fluorescent group attached to its 5' end; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second fluorescent probe, with a quencher group attached to its 3' end.

[0032] c) Detect fluorescence signals to determine the genotype of the SNP loci amplified by each KASP primer set in the soybean material, and screen for the first soybean variety with disease-resistant genotypes at all three SNP loci.

[0033] In some embodiments, any method further includes the step of crossing a first soybean variety with superior traits with a second soybean variety to obtain a third soybean variety with resistance to cyst nematode race 4 and superior traits.

[0034] This invention screened three SNP loci closely linked to the soybean cyst nematode resistance genes GmSNAP18, GmSHMT08, and GmSNAP11, and developed KASP markers (SCN-R01, SCN-R02, and SCN-R03) based on these loci. Using these three KASP markers in the offspring populations of crosses between resistant and susceptible parents, multi-marker joint screening can efficiently breed new soybean varieties resistant to cyst nematode race 4. In a population of 142 recombinant inbred lines (RILs) obtained by crossing the soybean variety “Huipizhiheidou” (resistant to cyst nematode race 4) with the susceptible soybean variety “Jindou 23”, genotyping was performed using SCN-R01, SCN-R02, and SCN-R03 simultaneously. The results showed that the average number of cysts in lines with all three markers as resistant genotypes (23.94) was significantly lower than the average number of cysts in lines with all three markers as susceptible genotypes (75.15). The accuracy rate of the combined screening using resistant markers was 63.2%, while the accuracy rate of the combined screening using susceptible markers was 100%. In a screening of 1025 soybean germplasm resources, 84 accessions had all three markers as resistant genotypes. Resistance identification confirmed that 61 of these accessions showed resistance to cyst nematode race 4, with a resistance selection accuracy rate of 72.6%. This indicates that the combined screening using these three markers can be used for highly efficient auxiliary selection of soybean cyst nematode resistance. In the hybrid population of the susceptible high-yielding and high-quality variety "Zhonghuang 13" and the disease-resistant germplasm "R37", selection was carried out using the three KASP markers in both the lower generation (F2) and the higher generation (F7). Fourteen high-generation lines with excellent agronomic traits and all three markers representing disease-resistant genotypes were ultimately selected. Resistance was assessed by inoculation with cyst nematode race 4, and nine lines showed resistance, validating the effectiveness of the method described in this invention in practical breeding.

[0035] This invention significantly improves the accuracy of predicting soybean cyst nematode resistance by jointly detecting three SNP sites closely linked to the GmSNAP18, GmSHMT08, and GmSNAP11 genes. Using the primer combinations and methods provided in this invention, marker-assisted selection can be performed continuously in low generations (e.g., F2) and high generations (e.g., F7), enabling early elimination of susceptible plants while maintaining rich population genetic diversity. This significantly reduces the size of the offspring population, alleviates the pressure of line inoculation and identification, and thus greatly improves the efficiency and accuracy of soybean cyst nematode resistance breeding. Attached Figure Description

[0036] Figure 1 Genotyping results of KASP markers (SCN-R01, SCN-R02 and SCN-R03) linked to the cyst nematode resistance gene in a population of 142 soybean recombinant inbred lines.

[0037] Figure 2The effects of different genotype combinations of three KASP markers on cyst nematode resistance in soybean plants from a population of 142 soybean recombinant inbred lines. SCN-R01-R indicates a resistant genotype at Gm18 (GG), and SCN-R01-S indicates a susceptible genotype at Gm18 (TT). SCN-R02-R indicates a resistant genotype at Gm08 (GG), and SCN-R02-S indicates a susceptible genotype at Gm08 (CC). SCN-R03-R indicates a resistant genotype at Gm11 (AA), and SCN-R03-S indicates a susceptible genotype at Gm11 (CC). *P<0.05.

[0038] Figure 3 A flowchart of assisted selection breeding using KASP markers linked to the cyst nematode gene. Detailed Implementation

[0039] The present invention is further described below with reference to embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the reagents used in the following embodiments are conventional reagents in the art, commercially available or prepared according to conventional methods in the art. Unless otherwise specified, the experimental methods and conditions used in the following embodiments are conventional experimental methods and conditions in the art, and can be found in relevant experimental manuals, public literature, or manufacturer's instructions. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0040] SNP, short for Single Nucleotide Polymorphism, refers to a common form of genetic variation in the chromosomal DNA sequence caused by a single base transition (such as C / T, A / G), transversion (such as C / G, A / T), or small insertion / deletion. These variations occur in at least 1% of a specific population (to distinguish them from rare "mutations") and are an important basis for the genetic diversity of individual organisms.

[0041] KASP, short for Kompetitive Allele-Specific PCR, is a molecular marker detection technique based on fluorescent PCR. It uses a pair of allele-specific primers designed for the target site to competitively amplify the genotype and then uses a universal fluorescent reporter system for detection. This enables rapid, accurate, and high-throughput genotyping of single nucleotide polymorphisms (SNPs) and small insertion / deletion (InDel) sites in biological samples.

[0042] KASP markers are molecular markers developed based on competitive allele-specific PCR (KASP) technology, mainly used for precise typing of single nucleotide polymorphisms (SNPs) and insertions / deletions (InDels) in the genome.

[0043] KASP premix is ​​a ready-to-use, core reagent mixture for competitive allele-specific PCR genotyping. It contains all the universal enzymes and chemical components required for the KASP reaction, including DNA polymerase, dNTPs, reaction buffer, and a universal FRET cassette. The universal FRET cassette contains two oligonucleotide probes (fluorescent probes) with different fluorescent groups at their 5' ends, and oligonucleotide probes (quencher probes) with quencher groups at their 3' ends, which are inversely complementary to the nucleotide sequences of the two fluorescent probes. To use, simply add the DNA template and specific primers designed for the target SNP site to the KASP premix to perform the KASP reaction and genotyping.

[0044] The soybean genetic population used in the following examples:

[0045] A population of 142 soybean recombinant inbred lines (RILs) was derived through hybridization, using the soybean variety “Grey Skin Black Soybean” (germplasm number: ZDD2315), which is resistant to cyst nematode No. 4, as the female parent and the susceptible variety “Jindou 23” (national approval number: national approval soybean 2001011) as the male parent.

[0046] The progeny population constructed by crossing the susceptible but high-yielding high-quality soybean variety “Zhonghuang 13” (national approval number: Guoshendou 2001008) with the disease-resistant soybean germplasm “R37” (which carries the disease-resistant genotypes GmSNAP18, GmSHMT08 and GmSNAP11) was used for the breeding of new disease-resistant lines. “R37” is one of the high-generation lines derived by the Soybean Genetic Resources Research Group of the Institute of Crop Science, Chinese Academy of Agricultural Sciences, through the cross between “Zhongpin 03-5373” and “Zhonghuang 13”. Its breeding process is recorded in the literature “Liu Bo, Li Yinghui, Yu Baishuang, Wang Jiajun, Liu Yulin, Chang Ruzhen, Qiu Lijuan. Genetic analysis of immune resistance of Zhongpin 03-5373 to physiological race 3 of soybean cyst nematode [J]. Acta Agronomica Sinica, 2015, 41(01): 15-21”.

[0047] Table 1 lists the germplasm names and numbers of some of the 1025 soybean germplasm resources from different ecological regions.

[0048]

[0049] The soybean genetic populations described above are from the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and the National Crop Germplasm Bank. The germplasm numbers listed in this article are the numbers of the soybean germplasm in the National Crop Germplasm Bank. The public can obtain these soybean genetic populations from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0050] The pathogens used in the following examples:

[0051] The physiological race 4 of soybean cyst nematode was provided by the Institute of Economic Crops, Shanxi Agricultural University. This race is described in the article “Liu Hanqi, Shang Shaogang, Zhen Hongjie, Huo Hong, Wu Heli, Yao Zhenchun, Li Xiulan. (1985). Preliminary report on the physiological races of soybean cyst nematode. Soybean Science 4, 131-136.”

[0052] Some of the reagents used in the following examples:

[0053] KASP 2× Master mix 96 / 384, purchased from LGC Genomics, UK.

[0054] Example 1. Development of molecular markers associated with soybean cyst nematode resistance

[0055] 1. Screening of SNP sites

[0056] Molecular markers were developed based on the soybean cyst nematode resistance genes GmSNAP18 (Gene ID: 100814639), GmSHMT08 (Gene ID: 100305380), and GmSNAP11 (Gene ID: 100812517), where Gene ID is the gene number in the NCBI (www.ncbi.nlm.nih.gov) gene-specific database. Three functional SNP loci closely related to cyst nematode resistance were ultimately screened and named Gm18, Gm08, and Gm11, respectively. Information on the SNP loci is shown in Table 2. The physical location of the SNPs was determined based on the whole genome sequence of soybean genome version Gmax_ZH13_v2.0 (https: / / ngdc.cncb.ac.cn / gwh / Assembly / 652 / show), where "Chr" indicates chromosome.

[0057]

[0058] The alleles at the Gm18 locus are G / T, where G confers resistance to soybean cyst nematode and is the resistance allele; T does not confer resistance and is the susceptibility allele.

[0059] The alleles at the Gm08 locus are G / C, where G confers resistance to soybean cyst nematode and is the resistance allele; C does not confer resistance and is the susceptibility allele.

[0060] The alleles at the Gm11 locus are A / C, where A confers resistance to soybean cyst nematode and is the resistance allele; C does not confer resistance and is the susceptibility allele.

[0061] 2. PCR primer design

[0062] Specific primers for detecting the three functional SNP sites were designed, resulting in three PCR primer sets, each named after its corresponding SNP site. As shown in Table 3, each PCR primer set contains three primers: primers ending in RF are forward primers for amplifying the resistance allele, primers ending in SF are forward primers for amplifying the susceptibility allele, and primers ending in R are universal reverse primers. In each PCR primer set, the last base of the two forward primers represents the allele of the corresponding SNP site or a complementary base to the allele.

[0063]

[0064] The primers shown in Table 3 were artificially synthesized. The method for detecting the above three SNP sites in soybeans using conventional PCR is as follows: Genomic DNA was extracted from soybean materials; using the genomic DNA as a template, PCR was performed using the Gm18 primer set, the Gm08 primer set, and the Gm11 primer set, respectively; the PCR products were sequenced to determine the genotype of the SNP sites amplified by each primer set in the soybean materials.

[0065] 3. KASP tag development

[0066] KASP markers were developed for the three functional SNP sites mentioned above, and named SCN-R01, SCN-R02, and SCN-R03 respectively. Three KASP primer sets were designed. The SCN-R01 primer set detected the SNP site Gm18, with a disease-resistant genotype of GG and a disease-susceptible genotype of TT. The SCN-R02 primer set detected the SNP site Gm08, with a disease-resistant genotype of GG and a disease-susceptible genotype of CC. The SCN-R03 primer set detected the SNP site Gm11, with a disease-resistant genotype of AA and a disease-susceptible genotype of CC.

[0067] As shown in Table 4, each KASP primer set contains three primers. The primer with the suffix "FAM" is a forward primer containing the FAM tag sequence (GAAGGTGACCAAGTTCATGCT) (SEQ ID NO:16) at its 5' end; the primer with the suffix "HEX" is a forward primer containing the HEX tag sequence (GAAGGTCGGAGTCAACGGATT) (SEQ ID NO:17) at its 5' end; and the primer with the suffix "common_R" is a universal reverse primer. In each KASP primer set, the last base of the two forward primers is the allele of the corresponding SNP site or a complementary base. The FAM and HEX tag sequences are compatible with commercially available universal KASP FRET fluorophores (such as the universal FRET fluorophore contained in the KASP premix from LGC Genomics).

[0068]

[0069] The primers shown in Table 4 were artificially synthesized. The method for detecting the three SNP sites in soybean using KASP is as follows: Genomic DNA was extracted from soybean material; KASP premix was added to the genomic DNA, and KASP was performed using the SCN-R01 primer set, SCN-R02 primer set, and SCN-R03 primer set, respectively; the KASP premix contained a first fluorescent probe, a first quenching probe, a second fluorescent probe, and a second quenching probe; the nucleotide sequence of the first fluorescent probe is shown in SEQ ID NO:16, with a first fluorescent group (FAM) attached to its 5' end; the nucleotide sequence of the first quenching probe is reverse complementary to the nucleotide sequence of the first fluorescent probe, with a quenching group attached to its 3' end; the nucleotide sequence of the second fluorescent probe is shown in SEQ ID NO:16. As shown in NO:17, its 5' end is connected to a second fluorescent group (HEX); the nucleotide sequence of the second quencher probe is inversely complementary to the nucleotide sequence of the second fluorescent probe, and its 3' end is connected to a quencher group; the FAM and HEX fluorescence values ​​in the KASP product are read using a fluorescence detector, and genotyping is performed using the accompanying software (if the product shows fluorescence emitted by the FAM fluorescent group, the genomic DNA contains the allele corresponding to the FAM tag sequence; if the product shows fluorescence emitted by the HEX fluorescent group, the genomic DNA contains the allele corresponding to the HEX tag sequence), thereby determining the genotype of the SNP site amplified by each primer set of the soybean material.

[0070] Example 2. Validation of the effectiveness of KASP markers linked to the anti-cysticercosis gene.

[0071] Genotyping of 142 soybean recombinant inbred lines (RILs) was performed using the three KASP primer sets (SCN-R01, SCN-R02, and SCN-R03) developed in Example 1. These 142 RILs were genetic populations obtained by crossing the soybean varieties “Huipizhiheidou” and “Jindou 23” and selecting them through single-seed selection up to the F8 generation. The effectiveness of these three KASP markers in predicting soybean cyst nematode resistance was verified by combining KASP genotyping technology with cyst nematode resistance identification.

[0072] 1. Genotyping

[0073] Genomic DNA was extracted from the leaves of the 142 soybean recombinant inbred lines using the CTAB method. The steps are as follows: Prepare CTAB extraction solution (containing 2% CTAB, 2% PVP40, 1.4 M NaCl, 20 mM EDTA pH 8.0, 100 mM Tris-HCl pH 8.0) and preheat it to 65℃; take about 1 g of young leaves and grind them into a fine powder in liquid nitrogen, add 700 μL of preheated CTAB extraction solution, and incubate in a water bath at 65℃ for 1 hour; add an equal volume of chloroform-isoamyl alcohol mixture (chloroform to isoamyl alcohol volume ratio of 24:1), shake on a shaker for 10-20 minutes, and centrifuge at 12000 rpm for 10 minutes; transfer the supernatant to a new tube, add 0.7 times the volume of pre-cooled isopropanol and 100 μL of sodium acetate (pH 5.2), mix well, and let stand at -20℃ for 30 minutes; centrifuge at 12000 rpm for 10 minutes, discard the supernatant, wash the precipitate once with 70% ethanol, air dry, and dissolve in sterile water.

[0074] The reaction system was prepared according to the standard procedure of LGC Genomics (www.lgcgroup.com). The three primers that make up each KASP primer set in Table 4 were mixed to prepare a primer mixture, ensuring a final concentration of 20 µM for each primer. The PCR reaction system consisted of: 2.5 μL of KASP 2×Master mix 96 / 384 (KASP premix), 0.06 μL of primer mixture, 2.2 μL of genomic DNA (10 ng / μL), and 0.24 μL of double-distilled water. The PCR amplification program was set as follows: 95℃ pre-denaturation for 15 minutes; 10 touchdown cycles (94℃ for 20 seconds, 65-57℃ for 60 seconds, with an annealing temperature decrease of 0.8℃ per cycle); followed by 30 standard cycles (94℃ for 20 seconds, 57℃ for 60 seconds). The endpoint fluorescence signal was detected using a PHERAstar Plus SNP microplate reader (BMG Labtech, Germany), and data was acquired using Kraken software. Genotyping was performed using KLUSTERCALLER software (v3.4.1.36).

[0075] 2. Identification of resistance to race 4 of *Cytozoon cystis*

[0076] The resistance of 142 soybean recombinant inbred lines to race 4 of the soybean cyst nematode was identified using the plastic pot column inoculation method. Race 4 of the soybean cyst nematode was a highly virulent species. Analysis of diseased soil containing mature cysts of race 4 of the soybean cyst nematode showed an average of 85 cysts per 100 grams of soil. Five plants were sown as replicates for each soybean material, and each plant was cultured in a plastic pot column containing soil infected with the cyst nematode. After 38 days, the plant roots were systematically flushed and the number of cysts formed on the roots was counted to evaluate the resistance level. The criteria for determining resistance and susceptibility were based on the average number of cysts per root of each soybean material. An average number of cysts of 0-30 was considered resistant, and >30 was considered susceptible. Analysis of variance was used to calculate the significance of differences in the number of cysts per root of soybean materials with different genotype combinations at three SNP loci.

[0077] Experimental results:

[0078] like Figure 1 As shown, all three KASP markers (SCN-R01, SCN-R02, and SCN-R03) can produce clear and accurate genotyping results for the corresponding disease resistance genes. Figure 2 As shown, different genotype combinations of KASP markers have a significant effect on resistance to physiological race 4 of Cystic Nematode. Among them, the average number of cysts (23.94) of the lines that simultaneously aggregated three disease-resistant genotypes (SCN-R01-R / SCN-R02-R / SCN-R03-R) was significantly lower than the average number of cysts (65.06-81.25) of the lines with other genotype combinations, showing disease resistance characteristics.

[0079] The phenotypic prediction accuracy of the three KASP markers, used individually and in combination, was evaluated. Of the 58 materials with the SCN-R01 resistance genotype, 14 showed resistance to *C. cysticercosis* race 4 (referred to as resistance), with a resistance prediction accuracy of 24.1%. The remaining 84 materials with the SCN-R01 susceptibility genotype were all susceptible to *C. cysticercosis* race 4 (referred to as susceptibility), with a susceptibility prediction accuracy of 100%. Of the 48 materials with the SCN-R02 resistance genotype, 12 showed resistance, with a resistance prediction accuracy of 25%. Of the remaining 94 materials with the SCN-R02 susceptibility genotype, 92 showed susceptibility, with a susceptibility prediction accuracy of 97.9%. Of the 107 materials with the SCN-R03 disease-resistant genotype, 14 showed disease resistance, with a disease resistance prediction accuracy of 13.1%; the remaining 35 materials with the SCN-R03 disease-susceptible genotype all showed disease susceptibility, with a disease susceptibility prediction accuracy of 100%.

[0080] Combining the SCN-R01 and SCN-R02 KASP markers for cyst nematode resistance prediction yielded significant improvements. Of the 26 samples with both SCN-R01 and SCN-R02 genotypes showing resistance, 13 exhibited resistance, demonstrating a 50% increase in prediction accuracy compared to using a single KASP marker. All 62 samples with both SCN-R01 and SCN-R02 genotypes showed susceptibility, achieving a 100% susceptibility prediction accuracy. Combining the SCN-R01, SCN-R02, and SCN-R03 KASP markers for cyst nematode resistance prediction further significantly improved the accuracy of predicting resistance phenotypes. Of the 19 samples with all three KASP markers showing resistance, 12 exhibited resistance, increasing the prediction accuracy to 63.2%. All 21 samples with all three KASP markers showing susceptibility showed susceptibility, achieving a 100% susceptibility prediction accuracy.

[0081] Example 3. Predicting cyst nematode resistance in natural soybean populations using KASP markers

[0082] Genotyping was performed on 1025 Chinese soybean germplasm resources with broad genetic backgrounds using the three KASP primer sets (SCN-R01, SCN-R02, and SCN-R03) developed in Example 1. Soybean germplasm with disease-resistant genotypes at all three SNP loci (Gm18, Gm08, and Gm11) was screened, and the selected soybean germplasm was then subjected to resistance identification for race 4 of *Strombus cystis*. The methods for genotyping and resistance identification for race 4 of *Strombus cystis* were the same as those in Example 2.

[0083] The results are shown in Table 5. Among the 1025 soybean germplasms, 84 germplasms possessed disease-resistant genotypes at all three SNP loci (Gm18, Gm08, and Gm11). Of these, 61 germplasms exhibited resistance to cyst nematode race 4 (referred to as disease resistance), with a disease resistance prediction accuracy of 72.6%. Therefore, the three KASP markers have better predictive performance in a polygenic context.

[0084] Table 5. Germplasm with disease-resistant genotypes at all three SNP loci and their cyst nematode resistance identification results

[0085] Serial Number Germplasm name Inventory Number Marker predicted resistance Actual resistance 1 Local black beans ZDD10251 anti- anti- 2 Wuzhai Black Beans - anti- anti- 3 PI437654 - anti- anti- 4 Forrest - anti- anti- 5 Black beans ZDD02255 anti- anti- 6 S01-9391 WDD03084 anti- anti- 7 rat skin ZDD03683 anti- anti- 8 Black beans ZDD08494 anti- anti- 9 Datun Black Beans ZDD08251 anti- anti- 10 Three-strand black beans ZDD10254 anti- anti- 11 Suning Black Beans ZDD01861 anti- anti- 12 Small black ZDD02450 anti- anti- 13 Black beans ZDD02370 anti- anti- 14 Red and black beans ZDD02258 anti- anti- 15 Sauce colored beans ZDD08537 anti- anti- 16 M045 WDD03003 anti- anti- 17 PI43848913 PI43848913 anti- anti- 18 Yellow navel ZDD01060 anti- anti- 19 Weifang 8640-112 (Lu Dou 11) ZDD19379 anti- anti- 20 Small black beans ZDD01412 anti- anti- 21 Hartwig WDD01623 anti- anti- 22 Rhodes WDD01614 anti- anti- 23 Black beans ZDD01858 anti- anti- 24 Black beans ZDD01922 anti- anti- 25 Yingxian Black Beans - anti- anti- 26 Original black beans ZDD08502 anti- anti- 27 Black beans ZDD08510 anti- anti- 28 Epps WDD01622 anti- anti- 29 Pharaoh WDD01613 anti- anti- 30 S99-3181 WDD03052 anti- anti- 31 Black beans ZDD02252 anti- anti- 32 Xuzhuang Black Beans ZDD08257 anti- anti- 33 Four corners of black beans ZDD08505 anti- anti- 34 Black beans ZDD08487 anti- anti- 35 Black beans ZDD01892 anti- anti- 36 Suzuhime WDD02998 anti- anti- 37 G1656 - anti- anti- 38 Tousan kei NA75 WDD03008 anti- anti- 39 Newton WDD01583 anti- anti- 40 Four-six black beans ZDD03056 anti- anti- 41 Large black beans ZDD07948 anti- anti- 42 Howard WDD01659 anti- anti- 43 - ZDD02315 anti- anti- 44 Pin-din-guan WDD02989 anti- anti- 45 Thin-skinned black beans ZDD01818 anti- anti- 46 tea beans ZDD10060 anti- anti- 47 Busy in August ZDD08511 anti- anti- 48 tea beans ZDD10057 anti- anti- 49 Black beans ZDD08488 anti- anti- 50 Pyramid WDD00640 anti- anti- 51 Black beans ZDD08483 anti- anti- 52 Black beans ZDD01857 anti- anti- 53 Red soybeans ZDD10801 anti- anti- 54 Meng 8206 ZDD11436 anti- anti- 55 Black beans ZDD08493 anti- anti- 56 Green fodder for eating beans ZDD18018 anti- anti- 57 Qi Huang 38 Qi Huang 38 anti- anti- 58 Peking WDD00467 anti- anti- 59 Leting Black Beans ZDD01855 anti- anti- 60 Weifang J127 ZDD23221 anti- anti- 61 Black beans ZDD08489 anti- anti- 62 Small black grains ZDD01399 anti- feel 63 Black beans ZDD02967 anti- feel 64 9234 WDD02019 anti- feel 65 Black beans ZDD01898 anti- feel 66 Full of small black beans ZDD18512 anti- feel 67 Gordon WDD01655 anti- feel 68 Black beans ZDD01909 anti- feel 69 Black beans ZDD08460 anti- feel 70 Meng 81104 ZDD11461 anti- feel 71 Flat-topped yellow and black soybeans ZDD01890 anti- feel 72 LS94-3207 WDD03116 anti- feel 73 Small white black beans ZDD01884 anti- feel 74 Ox tail black beans ZDD10293 anti- feel 75 A-66A WDD00661 anti- feel 76 Black beans ZDD08472 anti- feel 77 Sharkey WDD01645 anti- feel 78 Datun Black Beans ZDD08250 anti- feel 79 Kofeng 1 ZDD18394 anti- feel 80 Rabbit eyes ZDD10076 anti- feel 81 Qi Huang 40 Qi Huang 40 anti- feel 82 PI90763 - anti- feel 83 Manokin NO.27 anti- feel 84 PI84751 - anti- feel

[0086] Example 4. Selection of new soybean lines resistant to cyst nematodes using KASP markers

[0087] Using the F2 population, derived from the cross between the susceptible but high-yielding high-quality soybean variety “Zhonghuang 13” (National Approval No.: Guoshendou 2001008) and the disease-resistant soybean germplasm “R37”, genomic DNA was extracted from the leaves of individual soybean plants. Genotyping was performed using the three KASP primer sets (SCN-R01, SCN-R02, and SCN-R03) developed in Example 1. Individuals possessing disease-resistant alleles (homozygous or heterozygous genotypes) at all three SNP loci (Gm18, Gm08, and Gm11) were selected and subcultured to the F5 generation through superior single-plant selection. In the F5 generation, soybean plants with excellent agronomic traits were selected, and each plant was propagated to form an F6 line. F6 lines with excellent uniformity and agronomic traits, and homozygous disease-resistant genotypes for all three KASP markers, were selected and subcultured to the F7 generation. The process of using the above KASP marker-assisted selection breeding is described in [link to documentation]. Figure 3 Resistance to race 4 of *Cytozoon cystis* was identified in the superior F7 generation lines. The methods for genotyping and resistance identification of race 4 of *Cytozoon cystis* were the same as those in Example 2.

[0088] The results showed that among the 14 F7 generation lines with excellent comprehensive traits selected using KASP marker-assisted selection, 9 lines showed resistance to cyst nematode race 4, with a disease-resistant line acquisition rate of 64.3%.

Claims

1. A PCR primer combination for screening soybean varieties resistant to Heterodera glycines race 4, comprising a first PCR primer set, a second PCR primer set and a third PCR primer set; the first PCR primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO: 1-3, for amplifying a SNP site with physical position Chr18: 1705688 and allele G / T, wherein GG is a resistant genotype and TT is a susceptible genotype; the second PCR primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO: 4-6, for amplifying a SNP site with physical position Chr08: 8451018 and allele G / C, wherein GG is a resistant genotype and CC is a susceptible genotype; the third PCR primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO: 7-9, for amplifying a SNP site with physical position Chr11: 38918778 and allele A / C, wherein AA is a resistant genotype and CC is a susceptible genotype; the physical positions are determined based on the whole genome sequence of soybean genome version Gmax_ZH13_v2.

0. 2.A kit comprising the PCR primer combination for screening soybean varieties resistant to Heterodera glycines race 4 according to claim 1. 3.A KASP primer combination for screening soybean varieties resistant to Heterodera glycines race 4, comprising a first KASP primer set, a second KASP primer set and a third KASP primer set; the first KASP primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 3, for amplifying a SNP site with physical position Chr18: 1705688 and allele G / T, wherein GG is a resistant genotype and TT is a susceptible genotype; the second KASP primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 6, for amplifying a SNP site with physical position Chr08: 8451018 and allele G / C, wherein GG is a resistant genotype and CC is a susceptible genotype; the third KASP primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 9, for amplifying a SNP site with physical position Chr11: 38918778 and allele A / C, wherein AA is a resistant genotype and CC is a susceptible genotype; the physical positions are determined based on the whole genome sequence of soybean genome version Gmax_ZH13_v2.

0. 4.A kit comprising the KASP primer combination for screening soybean varieties resistant to Heterodera glycines race 4 according to claim 3.

5. The kit of claim 4, wherein The kit further comprises a KASP premix; the KASP premix comprises a first fluorescent probe, a first quencher probe, a second fluorescent probe and a second quencher probe; the nucleotide sequence of the first fluorescent probe is shown as SEQ ID NO: 16, and a first fluorescent group is connected to the 5' end thereof; the nucleotide sequence of the first quencher probe is reverse complementary to the nucleotide sequence of the first fluorescent probe, and a quencher group is connected to the 3' end thereof; the nucleotide sequence of the second fluorescent probe is shown as SEQ ID NO: 17, and a second fluorescent group is connected to the 5' end thereof; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second fluorescent probe, and a quencher group is connected to the 3' end thereof.

6. The kit of claim 5, wherein The first fluorescent group is FAM, and the second fluorescent group is HEX.

7. Use of the PCR primer combination of claim 1 or the kit of claim 2 or the KASP primer combination of claim 3 or the kit of any one of claims 4-6 in breeding a soybean variety resistant to cyst nematode race 4.

8. A method for breeding a soybean variety resistant to cyst nematode race 4, comprising the following steps: a) extracting genomic DNA from a soybean material; b) using the first PCR primer group, the second PCR primer group and the third PCR primer group described in claim 1 to perform PCR respectively with the genomic DNA as a template; c) detecting the PCR products to determine the genotype of the soybean material at each SNP site amplified by the PCR primer group, and screening a first soybean variety resistant to cyst nematode race 4.

9. A method for breeding a soybean variety resistant to cyst nematode race 4, comprising the following steps: a) extracting genomic DNA from a soybean material; b) adding a KASP premix to the genomic DNA, and using the first KASP primer group, the second KASP primer group and the third KASP primer group described in claim 3 to perform KASP amplification respectively; the KASP premix comprises a first fluorescent probe, a first quencher probe, a second fluorescent probe and a second quencher probe; the nucleotide sequence of the first fluorescent probe is shown as SEQ ID NO: 16, and a first fluorescent group is connected to the 5' end thereof; the nucleotide sequence of the first quencher probe is reverse complementary to the nucleotide sequence of the first fluorescent probe, and a quencher group is connected to the 3' end thereof; the nucleotide sequence of the second fluorescent probe is shown as SEQ ID NO: 17, and a second fluorescent group is connected to the 5' end thereof; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second fluorescent probe, and a quencher group is connected to the 3' end thereof. c) detecting the fluorescent signal to determine the genotype of the soybean material at each SNP site amplified by the KASP primer group, and screening a first soybean variety resistant to cyst nematode race 4.

10. The method according to claim 8 or 9, characterized in that, Further comprising the following step: crossing the screened first soybean variety with a second soybean variety with excellent traits to obtain a third soybean variety resistant to cyst nematode race 4 and with excellent traits.

Images