Molecular marker Cl_Chr08_5111232 associated with watermelon fruit weight and its application

Abstract

This invention belongs to the field of biotechnology and discloses a molecular marker Cl_Chr08_5111232 related to watermelon fruit weight and its applications. This invention measures the weight of watermelon fruits at maturity and, by constructing a high-density genetic linkage map, obtains a stable and reliable molecular marker Cl_Chr08_5111232 that is closely linked to watermelon fruit weight. This molecular marker is located at position 5111232 on chromosome 8 of the watermelon reference genome 97103V1, and a marker for SNP detection is developed based on this site. This invention also provides a method for rapidly identifying watermelon fruit weight using primer sets based on the aforementioned molecular marker. This method is simple, fast, and accurate, and has good prospects for widespread application.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker Cl_Chr08_5111232 related to the weight of watermelon fruit and its applications. Background Technology

[0002] watermelon( Citrullus lanatus(Thunb.)Matsum.&Nakai Watermelon is one of the most widely cultivated economic crops in the Cucurbitaceae family worldwide. Fruit weight, as a core agronomic trait, directly determines the yield, commercial value, and planting benefits of a variety, making it a key target for priority targeted improvement in breeding work. In traditional breeding, the selection of watermelon varieties related to fruit weight mainly relies on field phenotypic identification, requiring multiple generations of self-pollination and backcrossing. This has drawbacks such as a long breeding cycle and high labor requirements. Furthermore, phenotypic characteristics are easily affected by environmental factors such as light, temperature, water, and fertilizer, leading to low accuracy in phenotypic identification and selection, making it difficult to meet the current industry demand for rapid breeding of high-quality, high-yield watermelon varieties.

[0003] With the rapid development of molecular biology, molecular marker-assisted breeding has become a core technology for improving plant breeding traits due to its advantages such as being unaffected by the environment, allowing for early screening in the seedling stage, shortening the breeding cycle, and improving selection accuracy. Watermelon fruit weight is a quantitative trait controlled by multiple genes, and its genetic regulation mechanism is complex. Therefore, it is necessary to identify functional molecular markers closely linked to watermelon fruit weight in order to achieve efficient and targeted selection of this trait.

[0004] Currently, QTL loci associated with fruit weight have been located on chromosomes 2, 3, and 5 of watermelon. However, the watermelon genome is complex, and there are significant genetic differences among different germplasm resources. Existing molecular markers suffer from insufficient linkage, poor universality, and low detection efficiency, making it difficult to meet the breeding needs of different watermelon breeding materials and effectively support the industrial application of molecular breeding for watermelon fruit weight traits.

[0005] Therefore, this study combines QTL mapping results with SNP marker development to achieve a close link between markers and target traits, thereby improving the efficiency of molecular-assisted selection. This breakthrough overcomes the bottlenecks of traditional breeding techniques, enabling rapid and precise improvement of watermelon fruit weight traits and cultivating new high-quality watermelon varieties with different fruit weight specifications. This has significant practical implications and application value for improving watermelon breeding efficiency and optimizing the variety structure of the industry. Summary of the Invention

[0006] One of the objectives of this invention is to provide a molecular marker Cl_Chr08_5111232 related to the weight of watermelon fruit.

[0007] The second objective of this invention is to provide the application of the aforementioned molecular markers related to the weight of watermelon fruits.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] Firstly, the present invention discloses a molecular marker related to watermelon fruit weight. The inventors measured the weight of watermelon fruits at maturity and performed QTL mapping analysis by constructing a high-density genetic linkage map. A linkage region was located on chromosome 8 of the watermelon, containing a SNP locus named Cl_Chr08_5111232. This locus is located at position 5111232 on chromosome 8 of the watermelon reference genome 97103 V1. This locus has an A / T base mutation. The nucleotide sequence of this SNP locus is shown in SEQ ID NO.1. When the base at this locus is A, the watermelon fruit weight is large; when the base at this locus is T, the watermelon fruit weight is small.

[0010] Specifically, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein an A / T base mutation exists at position 48 of the sequence shown in SEQ ID NO.1, and the sequence is as follows:

[0011] ATGGGAATGGCAGTTATGTTGGATGTGATCATAAATTACATCCAATC A / T CTGCAGAATCAGATTGAGGTTAGTAATTATATCATACATAAAACTTGTGTTCAGTGGAATAAAATTAAAAAAAAAAAAATTAGAAAAGAATAAGAAGAAGTTGTACCATGTGGCAAATTATAATTGGATAATTTAATGAAATGCACAACGATGGATGTAAGTTAAGATGTACTCGAGTATTTTTTATAATTTTATTCCATGATGCAGGACAAGATAGT (as shown in SEQ ID NO.1, the bold and underlined part is the SNP site Chr08_5111232) A / T )).

[0012] Based on this SNP site, primer pairs for the SNP marker were designed, and primer pairs for amplifying molecular markers related to watermelon fruit weight were used. The primer pair sequence corresponding to the molecular marker Cl_Chr08_5111232 is as follows:

[0013] Cl_Chr08_5111232-F: ATGGGAATGGCAGTTATGTTGG (shown in SEQ ID NO.2);

[0014] Cl_Chr08_5111232-R:ACTATCTTGTCCTGCATCATGG (shown as SEQ ID NO.3).

[0015] Secondly, this invention also discloses the application of the primer pairs of the aforementioned molecular markers in marker-assisted breeding of watermelon fruit weight-related traits. In other words, the primer set of the molecular markers of this invention can be used in future marker-assisted breeding to identify the weight of watermelon fruits by extracting DNA from seedling leaves and detecting the presence of the molecular markers of this invention.

[0016] Thirdly, this invention also discloses the application of the aforementioned molecular marker primer pairs in identifying the weight and size of watermelon fruits. Specifically, the specific steps for identifying the weight and size of watermelon fruits are as follows:

[0017] Using watermelon germplasm DNA as a template for PCR amplification, and primers for the molecular marker Cl_Chr08_5111232 were used for PCR amplification. The PCR amplification reaction system was as follows: 1 μL genomic DNA, 4 μL 2×PCR Mix, 1 μL upstream primer F, 1 μL downstream primer R, 3 μL sterile distilled water, and a total volume of 10 μL.

[0018] PCR reaction conditions: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 25 cycles, followed by 72℃ extension for 7 min, and storage at 4℃.

[0019] Fourthly, this invention also protects a kit for identifying the weight of watermelon fruits, the kit containing primer pairs Cl_Chr08_5111232-F and Cl_Chr08_5111232-R. Other components of the kit are conventional reagents, specifically including 2×PCR Mix. This invention imposes specific restrictions on the concentration of the primer pairs, allowing the use of a 10 μM concentration. This invention does not impose specific restrictions on the source of the 2×PCR Mix.

[0020] Fifthly, the present invention also discloses the application of the kit in molecular marker-assisted breeding of watermelon fruit weight and its application in identifying or assisting in identifying the weight and size of watermelon fruits.

[0021] The kit of this invention can be used to quickly identify the weight of watermelon fruits. The specific method follows the steps for identifying watermelon fruit weight. By sequencing the PCR amplification product, if the SNP site in the PCR product of the tested variety is located at position 48 of the sequence shown in SEQ ID NO. 1 and the sequencing result is A, the watermelon fruit of that variety is determined to be large in weight; if the base at that site is T, the watermelon fruit of that variety is determined to be small in weight.

[0022] The present invention has the following advantages:

[0023] (1) The inventors of this invention screened out a molecular marker Cl_Chr08_5111232 that is related to the weight of watermelon fruit. This molecular marker is located on chromosome 8. The molecular marker Cl_Chr08_5111232 of this invention can be used to quickly identify the weight of watermelon fruit.

[0024] (2) Screening using markers linked to watermelon fruit weight is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.

[0025] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity. They can be easily, quickly and with high throughput applied to molecular marker-assisted breeding practices and material identification of watermelon fruit weight. Attached Figure Description

[0026] Figure 1 The results of QTL localization analysis for watermelon fruit weight.

[0027] Figure 2 This is a box plot showing the distribution of fruit weight corresponding to the genotype at the Cl_Chr08_5111232 locus in the watermelon population of Example 1 of this invention. A represents the genotype of large fruit weight that is homozygous at the Cl_Chr08_5111232 locus, and T represents the genotype of small fruit weight that is homozygous at the Cl_Chr08_5111232 locus.

[0028] Figure 3 This is an analysis diagram showing the sequence alignment results of the Cl_Chr08_5111232 site in 20 natural watermelon materials from this invention. Detailed Implementation

[0029] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0030] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0032] Example 1: Development of molecular markers related to watermelon fruit weight

[0033] This embodiment provides an SNP molecular marker that is co-separated from the weight of watermelon fruit, named molecular marker Cl_Chr08_5111232, whose nucleotide sequence is shown in SEQ ID NO.1.

[0034] The molecular marker Cl_Chr08_5111232 provided in this embodiment is closely linked to the weight of watermelon fruits. The parental sequences are located at nucleotides 5111185 to 5111450 on chromosome 8 of the watermelon genome 97103 V1, with a size of 266 bp, as shown in SEQ ID NO.1. Sequence alignment of the parents confirmed the presence of an SNP mutation at position 5111232. Specifically, the nucleotide sequence of the molecular marker Cl_Chr08_5111232, as shown in SEQ ID NO.1, is an SNP site at position 48, where an A / T mutation occurs. Specifically, at this SNP site, the base for larger fruits is A, with a fruit weight ≥ 1.8 kg; the base for smaller fruits is T, with a fruit weight < 1.8 kg.

[0035] The method for obtaining the molecular marker Cl_Chr08_5111232 provided in this embodiment is as follows:

[0036] Using the large-fruit-weight watermelon cultivar K2 (1.8±0.6 kg, unified number 00000838 in the China Crop Germplasm Information Network (National Science and Technology Resource Sharing Service Platform), cultivar name Hutubi Early-1) and the small-fruit-weight watermelon cultivar L1 (1.4±0.7 kg, unified number 00000185 in the China Crop Germplasm Information Network (National Science and Technology Resource Sharing Service Platform), cultivar name Huang Xiaoyu) as parents, F2 segregating populations were obtained. High-density genetic maps were constructed using whole-genome resequencing of both parents combined with GBS-seq technology. Using the phenotypic data of watermelon fruit weight obtained from the survey of the F3 population, QTL loci associated with fruit weight were located on chromosome 8 of the watermelon genome, such as... Figure 1As shown, the candidate region is located within the segment 3647523~9441624 of chromosome 8. Through parental sequence alignment and validation in a natural population, an SNP site with an A / T mutation was found at position 5111232. A molecular marker was developed based on this mutation, named Cl_Chr08_5111232, with upstream primer Cl_Chr08_5111232-F and downstream primer Cl_Chr08_5111232-R.

[0037] Cl_Chr08_5111232-F: ATGGGAATGGCAGTTATGTTGG (shown in SEQ ID NO.2);

[0038] Cl_Chr08_5111232-R:ACTATCTTGTCCTGCATCATGG (shown as SEQ ID NO.3).

[0039] The aforementioned maternal and paternal parent materials, as well as the 83 watermelon materials used for verification in Example 2, were all watermelon materials disclosed in the article "Liang XX, Gao ML*, Amanullah S, GuoY, Xu HG, Liu XS, Liu XJ, Liu JX, GaoY, Yuan CZ, Wang XZ, Luan FS (2022) Molecular mapping of candidate generegulating fruit stripe trait in watermelon. Euphytica 218, 174". The maternal and paternal parents were donated by the Zhengzhou Fruit Research Institute of the Chinese Academy of Agricultural Sciences, while the remaining 83 watermelon materials were obtained from the Zhengzhou Fruit Research Institute of the Chinese Academy of Agricultural Sciences through purchase or donation. All of the above materials could be obtained through purchase or donation.

[0040] Example 2: Accuracy verification of the molecular markers described in this invention

[0041] The molecular markers were validated in natural populations using fruit weights and resequencing data from 83 watermelon germplasm resources. The specific fruit weights of the watermelon germplasm materials used and the genotypes corresponding to the Cl_Chr08_5111232 locus are shown in Table 1.

[0042] Table 1. Fruit weights and genotypes corresponding to the Chr08_5111232 locus in 83 germplasm materials.

[0043]

[0044]

[0045] The weight of the large-fruited watermelon variety K2 is used as the standard for classifying fruit size: large-fruited watermelon, fruit weight ≥ 1.8 kg; small-fruited watermelon, fruit weight < 1.8 kg.

[0046] As shown in Table 1, large watermelons weighing >1.8 kg exhibit an A base at the aforementioned SNP sites, while small watermelons weighing <1.8 kg exhibit a T base at the same SNP sites. This demonstrates that the SNP sites provided in this embodiment can accurately distinguish watermelon fruit weight. Therefore, the SNP molecular markers of this invention can effectively identify the size of watermelon fruits and can be used for the breeding of large-fruited watermelon materials.

[0047] Example 3: A method for determining the weight of a watermelon fruit

[0048] This embodiment provides a method for identifying the weight of watermelon fruits using the molecular marker Cl_Chr08_5111232 or specific detection primer pairs or kits. The specific method is as follows:

[0049] Step 1: Extract DNA from seedling-grown watermelons for testing using a modified CTAB method.

[0050] (1) 20 materials were randomly selected from the watermelon germplasm materials shown in Table 1 and planted under the same conditions. When the plants had three leaves and one heart, they were used as test samples. The young leaves were taken into 2 mL centrifuge tubes, brought back with ice packs, frozen and dried, and then ground into powder by a grinder. Among them, the 20 materials in this step consisted of 10 watermelon materials with a fruit weight greater than 1.8 kg and 10 watermelon materials with a fruit weight less than 1.8 kg.

[0051] (2) Add 1000 μL of 2% CTAB that has been preheated in a 65℃ water bath for 1 h to the centrifuge tube, shake to ensure that the powder and liquid are in full contact, and place in a 65℃ water bath for 1 h, mixing once every 10 min during the process.

[0052] (3) After water bath, air dry to room temperature, then centrifuge at 13000 r / min for 15 min at 4℃;

[0053] (4) After centrifugation, aspirate the supernatant and transfer it to a new 2 mL centrifuge tube. Add 900 μL of chloroform / isoamyl alcohol (volume ratio 24:1) solution, shake well, and centrifuge at 13000 r / min for 15 min at 4℃. Repeat this step twice.

[0054] (5) Aspirate 600-700 μL of supernatant and place it in a 1.5 mL centrifuge tube. Add 700 μL of anhydrous ethanol pre-cooled at 4℃, shake well, and precipitate at 4℃ for 1 h.

[0055] (6) Remove the centrifuge tube and centrifuge at 13000 r / min for 15 min at 4℃. After centrifugation, aspirate the supernatant and retain the precipitate.

[0056] (7) Wash with 75% ethanol 2 to 3 times, air dry at room temperature, add distilled water to make up to 50 μL, and obtain the watermelon DNA sample to be tested. The watermelon DNA sample to be tested can be permanently stored in a -80℃ refrigerator.

[0057] Step 2: Using the watermelon DNA sample obtained in Step 1 as a template, perform PCR amplification with the detection primer pair or kit to obtain the PCR amplification product.

[0058] The PCR amplification reaction system is a 10 μL reaction volume, consisting of the following components: 1 μL DNA template, 4 μL 2×Es TaqMasterMix, 1 μL forward primer F, 1 μL reverse primer R, and 3 μL distilled water. The Es TaqMasterMix contains Es Taq DNA Polymerase and Mg... 2＋ and dNTPs;

[0059] PCR reaction conditions: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 25 cycles, followed by 72℃ extension for 7 min, and storage at 4℃.

[0060] Step 3: The PCR amplification products obtained in Step 2 were analyzed using 1.5% agarose gel electrophoresis to confirm the presence of the target band. The PCR amplification products showing the target band were purified, and the purified PCR amplification products were subjected to Sanger sequencing by Shanghai Sangon Biotech Co., Ltd. (Changchun). Figure 3 As can be seen from the nucleotide sequence comparison, the selected 20 watermelon varieties have an SNP site at position 5111232 on chromosome 8, which is the 48th position of the nucleotide sequence shown in SEQ ID NO. 1. Furthermore, the SNP site of the 10 selected watermelon fruits weighing more than 1.8 kg has an A base, while the SNP site of the 10 selected watermelon fruits weighing less than 1.8 kg has a T base. This detection result is consistent with the watermelon fruit weight trait results shown in Table 1, thus proving that the method provided in this embodiment of the invention can accurately identify the weight of watermelon fruits.

[0061] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. The application of the molecular marker Cl_Chr08_5111232, associated with watermelon fruit weight, in marker-assisted breeding or identification of watermelon fruit weight, characterized in that... The nucleotide sequence of the molecular marker Cl_Chr08_5111232 is shown in SEQ ID NO.

1. There is an A / T base mutation at position 48 of the sequence shown in SEQ ID NO.

1. When the base at this position is A, the watermelon fruit is heavy and is a large-fruited watermelon with a weight ≥1.8 kg. When the base at this position is T, the watermelon fruit is light and is a small-fruited watermelon with a weight <1.8 kg.

2. The application according to claim 1, characterized in that, The primer pair used to amplify the molecular marker Cl_Chr08_5111232 is: Cl_Chr08_5111232-F: ATGGGAATGGCAGTTATGTTGG; Cl_Chr08_5111232-R:ACTATCTTGTCCTGCATCATGG.

3. The application of a kit for detecting the molecular marker Cl_Chr08_5111232 as described in claim 1 or 2 in marker-assisted breeding of watermelon fruit weight or in identifying the weight and size of watermelon fruit.

4. A method for determining the weight of a watermelon fruit, comprising the following steps: (1) Extract genomic DNA from the watermelon sample to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair described in claim 2; (3) Purify the PCR amplification products and perform gene sequencing to detect the genotype; (4) The detected genotype is compared with the molecular marker Cl_Chr08_5111232 described in claim 1 or 2. If the base at position 48 of the sequence shown in SEQ ID NO.1 is A, the watermelon fruit is heavy and is a large-fruited watermelon with a weight ≥1.8 kg. If the base at position 48 of the sequence shown in SEQ ID NO.1 is T, it is a small-fruited watermelon with a weight <1.8 kg.

Images