Titanium alloy implant coating and preparation method thereof

Abstract

The invention belongs to the technical field of biomedical materials, and particularly relates to a titanium alloy implant coating and a preparation method thereof. The invention discloses a titanium alloy implant coating with pH responsiveness and osteogenic activity. The titanium alloy implant coating comprises a micro-arc oxidation bottom layer, a pH sensitive middle layer and an outer functional layer. The micro-arc oxidation bottom layer is prepared from calcium acetate and beta-sodium glycerophosphate electrolyte to form a porous structure; the middle layer is MAA / MMA copolymer loaded antibacterial peptide GL13K which is intelligently released in an acidic environment; and the outer layer is Sr-doped hydroxyapatite (Sr-nHA) or curcumin-osteogenic peptide OGP (10-14) sustained release microspheres, so that bone regeneration is promoted. The coating provided by the invention has the advantages of dynamic antibiosis, osteogenesis synergy, high bonding strength and long-term stability, is suitable for orthopedic implant surface modification, and can reduce the infection risk and accelerate osseointegration. The preparation method comprises the steps of titanium substrate pretreatment, MAO oxidation, polymer coating and functional loading, the process is controllable, and the method is suitable for industrial application.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biomedical materials, and particularly relates to a titanium alloy implant coating and a preparation method thereof. BACKGROUND

[0002] In the field of orthopedic surgery, implants play a crucial role in repairing damaged bones and restoring bone function. Among them, titanium alloy, with its excellent mechanical properties, good biocompatibility, and outstanding corrosion resistance, has become the mainstream material for orthopedic implants and is widely used in various orthopedic surgeries, such as joint replacement, fracture fixation, etc. However, titanium alloy implants face some core problems that need to be solved in clinical application. Postoperative implant-related infection (PJI) is a catastrophic complication, although its incidence is not high, but once it occurs, the consequences are extremely serious. PJI not only leads to implant failure, making patients have to endure the pain of multiple revision surgeries, and even in extreme cases, it may cause amputation and other serious consequences, causing patients great physical and psychological trauma and economic burden. At the same time, whether the implant and the host bone tissue can achieve good osseointegration is crucial for the long-term stability of the implant. Osseointegration refers to the formation of direct bone integration between the implant and the surrounding bone tissue, allowing the implant to be firmly fixed in the bone, thereby ensuring the normal functioning of the implant. If osseointegration is poor, the implant may become loose, dislocated, and other problems, affecting the treatment effect.

[0003] In view of the problem of postoperative implant-related infection in orthopedic surgery, the composite antibacterial coating on the surface of the implant can alleviate the postoperative implant-related infection to some extent. The current common antibacterial coatings mainly include antibiotic coatings and inorganic antibacterial agent coatings. Antibiotic coatings such as vancomycin, gentamicin sustained-release system, inhibit bacterial growth by slowly releasing antibiotics; inorganic antibacterial agent coatings such as doped hydroxyapatite (HA) play a role by utilizing the antibacterial properties of metal ions. However, these antibacterial coatings have many problems. Long-term use of antibiotic coatings can lead to bacterial resistance, making the originally effective antibiotics lose their effect and increasing the difficulty of treatment. Broad-spectrum antibiotics, while inhibiting bacteria, may also have negative effects on local cell activity, showing cytotoxicity and interfering with the physiological functions of normal cells. In addition, the sustained release of antibacterial components is not synchronized with the needs of the osseointegration process, and in the critical period of osseointegration, the release of antibacterial components may be too much or too little, failing to meet the actual needs. Some strong antibacterial agents such as high-concentration not only may have inhibitory effects on bacteria, but also may inhibit the function of osteoblasts, affecting the progress of osseointegration.

[0004] To achieve good bone integration between the implant and the host bone tissue, researchers have developed bone integration promoting coatings. Commonly used bone integration promoting coatings include bioactive coatings such as HA, bioactive glass (BGS), and coatings loaded with BMP-2, RGD peptide and other biomolecules. These coatings promote the adhesion, proliferation and differentiation of osteoblasts by providing a suitable surface microenvironment or releasing bioactive factors, thereby accelerating the bone integration process. However, there are obvious defects, namely the lack of antibacterial ability. During the implantation of the implant, it is inevitable to be exposed to a certain degree of contamination risk. Once infection occurs, the bone integration promoting coating cannot effectively respond, which may lead to implant failure. Moreover, the activity of biological factors may be impaired in the early postoperative period due to the infected microenvironment, which cannot fully play its role in promoting bone integration.

[0005] To solve the limitations of single-function coatings, some studies have attempted to simply mix or co-deposit antibacterial agents (such as Ag) and bioactive components (such as HA) to prepare dual-function coatings. However, this simple mixing or co-deposition method has many shortcomings. It is difficult to accurately balance and independently control the antibacterial activity and the bone-promoting activity, and often one function is too strong and the other function is too weak, which cannot meet the needs of antibacterial and bone integration. Antibacterial agents (especially heavy metal ions) often have toxicity to osteoblasts or interfere with their differentiation function, affecting the normal progress of bone integration. In addition, the release behavior of the coating lacks intelligence and cannot respond to infection signals such as inflammation, bacterial proliferation leading to a decrease in local pH. This leads to the over-release of antibacterial components in the absence of infection, causing waste and potential cytotoxicity; while in the presence of infection, sufficient antibacterial components cannot be released in time and effectively, resulting in "ineffective release" or "excessive release". At the same time, the long-term stability and bonding strength of the coating need to be improved, and the preparation process is relatively complex, which is not conducive to large-scale production. There is an urgent need to develop products that can enhance antibacterial activity under the trigger of an "infected microenvironment", effectively kill bacteria and prevent the spread of infection, while preferentially exerting a bone integration promoting effect under "normal physiological environment", promoting good combination of the implant with the host bone tissue, and improving the long-term stability of the implant, to meet the clinical needs. SUMMARY

[0006] The purpose of the present application is to provide a titanium alloy implant surface coating that can simultaneously meet the dual needs of effective antibacterial and high-efficiency bone integration, and realize the "intelligent response" of the coating function, i.e. "activate" antibacterial under infection and "protect" osteogenesis under normal conditions. Through the selection of specific molecular materials, the design of composite structures and controllable preparation processes, the problems of mutual interference of active components, inaccurate release behavior and potential toxicity in existing dual-function coatings are solved, and the stability and bonding strength of the coating with the titanium substrate are improved.

[0007] On one hand, the present invention provides a titanium alloy implant coating, which comprises a micro-arc oxidation underlayer, a pH-responsive intermediate layer, and an outer functional layer. The micro-arc oxidation substrate is formed by treating a titanium substrate with an electrolyte containing calcium acetate and sodium β-glycerophosphate. The pH-responsive intermediate layer comprises a copolymer of methacrylic acid and methyl methacrylate and an antimicrobial peptide GL13K loaded on the copolymer of methacrylic acid and methyl methacrylate; The outer functional layer comprises Sr-doped hydroxyapatite or sustained-release microspheres containing osteogenic peptide YGFGG.

[0008] Furthermore, in the titanium alloy implant coating, the electrolyte pH of the micro-arc oxidation underlayer is 8.5-10.5.

[0009] Furthermore, in the titanium alloy implant coating, the thickness of the micro-arc oxidation underlayer is 5-20 μm.

[0010] Furthermore, in the titanium alloy implant coating, in the pH-responsive intermediate layer, the mass ratio of methacrylic acid to methyl methacrylate copolymer is 60:40-70:30; and the loading of GL13K is 0.1-0.5 mg / cm².

[0011] Furthermore, in the titanium alloy implant coating, the outer functional layer is... Powdered or PLGA-encapsulated sustained-release microspheres containing osteogenic peptide YGFGG.

[0012] Furthermore, in the titanium alloy implant coating, the concentration of osteogenic peptide YGFGG in the PLGA-encapsulated sustained-release microspheres containing YGFGG is 2-5 mg / mL.

[0013] Furthermore, in the titanium alloy implant coating, the PLGA-encapsulated osteogenic peptide YGFGG sustained-release microspheres also contain curcumin.

[0014] Furthermore, in the titanium alloy implant coating, the mass ratio of osteogenic peptide YGFGG to curcumin in the PLGA-encapsulated osteogenic peptide YGFGG sustained-release microspheres is 0.1-0.5:2-5.

[0015] In addition, a method for preparing the titanium alloy implant coating of the present invention is provided, comprising the following steps: S1, Pretreated titanium alloy substrate; S2. The pretreated titanium alloy substrate is subjected to micro-arc oxidation treatment to form a porous micro-arc oxidation underlayer containing calcium and phosphate in an electrolyte containing calcium salt and phosphate at a voltage of 250~400V. S3. A MAA / MMA copolymer intermediate layer is coated on the micro-arc oxidation substrate obtained in S2 and GL13K is loaded to obtain an intermediate product containing a pH-responsive intermediate layer. S4. Load Sr-nHA or osteogenic peptide YGFGG sustained-release microspheres onto the intermediate containing the pH-responsive intermediate layer obtained in S3 to prepare a titanium alloy implant containing an outer functional layer.

[0016] S5. Sterilize the titanium alloy implant containing the outer functional layer obtained in S4 to obtain the titanium alloy implant.

[0017] Finally, the application of the titanium alloy implant coating described in this invention in bone implants is also provided.

[0018] Compared with the prior art, the present invention has at least the following advantages or beneficial effects: (1) Dynamic antibacterial response: MAA / MMA copolymer rapidly releases GL13K in the acidic environment of infection, while it is stable at physiological pH (7.4), thus achieving precise antibacterial effect.

[0019] (2) Synergistic osteogenic-antibacterial function: The calcium and phosphorus components in the bottom layer of MAO promote bone integration, and Sr-nHA or curcumin-OGP microspheres continuously release osteogenic factors, synergistically enhancing bone repair.

[0020] (3) For the first time, curcumin and OGP were combined and applied to promote osteogenesis. The two showed a synergistic effect and the combined application of the two promoted the expression of osteogenic genes and promoted osteogenesis.

[0021] (4) The coating preparation process is controllable and is suitable for surface modification of titanium implants, with broad application prospects. Attached Figure Description

[0022] Figure 1 The release rate of the antimicrobial peptide GL13K in the bone implant coating under different pH conditions.

[0023] Figure 2 The graph shows the antibacterial rate of different bone implant coatings at a pH of 5.5.

[0024] Figure 3 The graph shows the cell proliferation rate results for different bone implant coatings.

[0025] Figure 4 A graph showing the alkaline phosphatase activity of cells in different bone implant coatings.

[0026] Figure 5 The relative expression levels of Runx2 in different bone implant coating cells.

[0027] Figure 6 The relative expression levels of Alp in different bone implant coating cells.

[0028] Figure 7 The relative expression levels of COL1 in different bone implant coating cells. Detailed Implementation

[0029] The technical solution of the present invention will be described below with reference to the embodiments. However, the present invention is not limited to the following embodiments.

[0030] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments and accompanying drawings. However, the embodiments described are not intended to limit the present invention.

[0031] Unless otherwise specified, the experimental and detection methods described in the following embodiments are conventional methods; unless otherwise specified, the reagents and materials are commercially available.

[0032] Curcumin, purchased from Hubei Ruisentike Biotechnology Co., Ltd., with a purity of 99%.

[0033] Example 1

[0034] This embodiment describes the pretreatment of a titanium substrate.

[0035] Medical-grade Ti6Al4V (ASTM F136) was selected and ultrasonically cleaned with 5% NaOH at 60℃ for 15 min. After rinsing with deionized water 3 times, it was then soaked in an acid pickling solution of 10% HNO3 and 2% HF at room temperature for 30 s, rinsed with deionized water 3 times, ultrasonically cleaned with acetone for 10 min, ultrasonically cleaned with anhydrous ethanol for 10 min, and then dried with nitrogen.

[0036] Example 2

[0037] This example demonstrates the preparation of a micro-arc oxidation (MAO) underlayer.

[0038] Preparation of electrolyte: Weigh 5g of calcium acetate and slowly add it to 800 mL of deionized water. Stir magnetically until completely dissolved. Weigh 15g of sodium β-glycerophosphate and add it to the above solution. Continue stirring until completely dissolved. Adjust the pH to 8.5 with sodium hydroxide to obtain the electrolyte. Transfer the solution to a 1L volumetric flask and dilute to the mark with deionized water. Mix thoroughly and adjust the pH to 8.5 with sodium hydroxide to obtain the electrolyte.

[0039] Using the titanium sample (ASTM F136) pretreated in Example 1 as the anode and a stainless steel tank as the cathode, the above-prepared electrolyte was used. The electrolyte temperature was <35°C, constant voltage mode, voltage range 250V, frequency 50Hz, duty cycle 40%, and oxidation time was 1 min. The sample was removed, rinsed thoroughly with deionized water, and dried at 60°C. A 5 μm thick porous micro-arc oxidation titanium oxide layer containing calcium and phosphorus was formed, exhibiting a micro / nanopore structure. This micro-arc oxidation (MAO) underlayer was prepared and labeled as #1 micro-arc oxidation (MAO) underlayer for later use.

[0040] Example 3

[0041] This example demonstrates the preparation of a micro-arc oxidation (MAO) underlayer.

[0042] Preparation of electrolyte: Weigh 15g of calcium acetate and slowly add it to 800mL of deionized water. Stir magnetically until completely dissolved. Weigh 10g of sodium β-glycerophosphate and add it to the above solution. Continue stirring until completely dissolved. Adjust the pH to 9.5 with sodium hydroxide to obtain the electrolyte. Transfer the solution to a 1L volumetric flask and dilute to the mark with deionized water. Mix thoroughly and adjust the pH to 9 with sodium hydroxide to obtain the electrolyte.

[0043] Using the titanium sample (ASTM F136) pretreated in Example 1 as the anode and a stainless steel tank as the cathode, the above-prepared electrolyte was used. The electrolyte temperature was <35°C, constant voltage mode, voltage range 320V, frequency 200Hz, duty cycle 25%, and oxidation time was 5 min. The sample was removed, rinsed thoroughly with deionized water, and dried at 70°C. A 10 μm thick porous micro-arc oxidation titanium oxide layer containing calcium and phosphorus was formed, exhibiting a micro / nanopore structure. This micro-arc oxidation (MAO) underlayer was prepared and labeled as #2 micro-arc oxidation (MAO) underlayer for later use.

[0044] Example 4

[0045] This example demonstrates the preparation of a micro-arc oxidation (MAO) underlayer.

[0046] Preparation of electrolyte: Weigh 25g of calcium acetate and slowly add it to 800mL of deionized water. Stir magnetically until completely dissolved. Weigh 5g of sodium β-glycerophosphate and add it to the above solution. Continue stirring until completely dissolved. Adjust the pH to 10.5 with sodium hydroxide to obtain the electrolyte. Transfer the solution to a 1L volumetric flask and dilute to the mark with deionized water. Mix thoroughly and adjust the pH to 10.5 with sodium hydroxide to obtain the electrolyte.

[0047] Using the titanium sample (ASTM F136) pretreated in Example 1 as the anode and a stainless steel tank as the cathode, the above-prepared electrolyte was used. The electrolyte temperature was <35°C, constant voltage mode, voltage range 400V, frequency 500Hz, duty cycle 10%, and oxidation time was 10 min. The sample was removed, rinsed thoroughly with deionized water, and dried at 80°C. A 20 μm thick porous micro-arc oxidation titanium oxide layer containing calcium and phosphorus was formed, exhibiting a micro / nanopore structure. This micro-arc oxidation (MAO) underlayer was prepared and labeled as #3 micro-arc oxidation (MAO) underlayer for later use.

[0048] Example 5

[0049] This embodiment involves coating an intermediate response layer containing GL13K.

[0050] 5.1 Preparation of pH-sensitive polymer solutions Monomer mixing: Weigh 7.0g of methacrylic acid (MAA) and 3.0g of methyl methacrylate (MMA), and mix the MAA and MMA monomers.

[0051] Ammonium persulfate (APS) at 1% of the total monomer mass and N,N'-methylenebisacrylamide at 0.1% of the total monomer mass were added, and the mixture was stirred in a 60°C water bath for 6 hours under nitrogen protection. After the reaction, the solution was transferred to a dialysis bag (MWCO3500 Da) and dialyzed with deionized water for 72 hours, changing the water every 6 hours to remove unreacted monomers and small molecules. A hydrogel solution of the MAA / MMA copolymer was obtained, which is the pH-sensitive polymer solution.

[0052] 5.2 Loaded antimicrobial peptide GL13K Preparation of GL13K solution: Weigh 0.5 mg of GL13K peptide and dissolve it in sterile deionized water to prepare a 0.5 mg / mL GL13K solution.

[0053] The micro-arc oxidation (MAO) sample prepared in Example 2 (such as the MAO underlayer #1) was immersed in the hydrogel solution of the MAA / MMA copolymer prepared in 5.1, allowed to stand for 5 minutes, and then removed with nitrogen to blow away excess solution, forming a polymer film with a thickness of 1 μm. Before the film was fully cured, the sample was immersed in a GL13K solution and allowed to stand at room temperature for 1 hour, allowing GL13K to be physically adsorbed and loaded into the network of the MAA / MMA copolymer. The sample was then rinsed three times with sterile deionized water to remove unloaded GL13K from the surface and dried under vacuum at 60°C for 2 hours. A coating containing a GL13K intermediate responsive layer was obtained and labeled A1.

[0054] Example 6 This embodiment involves coating an intermediate response layer containing GL13K.

[0055] 6.1 Preparation of pH-sensitive polymer solution Weigh out 6.5g of methacrylic acid (MAA) and 3.5g of methyl methacrylate (MMA), and mix the MAA and MMA monomers.

[0056] Ammonium persulfate (APS) at 1% of the total monomer mass and N,N'-methylenebisacrylamide at 0.1% of the total monomer mass were added, and the mixture was stirred in a 65°C water bath for 4 hours under nitrogen protection. After the reaction, the solution was transferred to a dialysis bag (MWCO3500 Da) and dialyzed with deionized water for 72 hours, changing the water every 6 hours to remove unreacted monomers and small molecules. A hydrogel solution of the MAA / MMA copolymer was obtained, which is the pH-sensitive polymer solution.

[0057] 6.2 Loaded antimicrobial peptide GL13K Preparation of GL13K solution: Weigh 1.25 mg of GL13K peptide and dissolve it in sterile deionized water to prepare a 1.25 mg / mL GL13K solution for later use.

[0058] The micro-arc oxidation (MAO) sample prepared in Example 3 (such as the MAO underlayer #2) was immersed in the hydrogel solution of the MAA / MMA copolymer prepared in 6.1 and spin-coated (1000 rpm, 30 seconds) to form a uniform film with a thickness of 5 μm. Before the film cured, GL13K solution was dropped onto the sample surface and gently blown evenly with a pipette to load GL13K into the network of the MAA / MMA copolymer. The sample was then rinsed three times with sterile deionized water to remove unloaded GL13K from the surface and vacuum dried at 60°C for 2 hours. A coating containing a GL13K intermediate responsive layer was obtained and labeled A2.

[0059] Example 7 This embodiment involves coating an intermediate response layer containing GL13K.

[0060] 7.1 Preparation of pH-sensitive polymer solutions Weigh out 6.0g of methacrylic acid (MAA) and 4.0g of methyl methacrylate (MMA), and mix the MAA and MMA monomers.

[0061] Ammonium persulfate (APS) at 1% of the total monomer mass and N,N'-methylenebisacrylamide at 0.1% of the total monomer mass were added, and the mixture was stirred in a 65°C water bath for 4 hours under nitrogen protection. After the reaction, the solution was transferred to a dialysis bag (MWCO3500 Da) and dialyzed with deionized water for 72 hours, changing the water every 6 hours to remove unreacted monomers and small molecules. A hydrogel solution of the MAA / MMA copolymer was obtained, which is the pH-sensitive polymer solution.

[0062] 7.2 Loaded antimicrobial peptide GL13K Preparation of GL13K solution: Weigh 2.0 mg of GL13K peptide, dissolve it in sterile deionized water to prepare a 2.0 mg / mL GL13K solution for later use.

[0063] The micro-arc oxidation (MAO) sample prepared in Example 3 (such as the MAO underlayer #2) was immersed in the hydrogel solution of the MAA / MMA copolymer prepared in 6.1. 50 μL of the solution was drop-coated onto the sample surface, and a thin film was formed using a spin coater (2000 rpm, 60 seconds). The film thickness was 3 μm. GL13K solution was directly added to the MAA / MMA copolymer hydrogel solution (GL13K solution:MAA / MMA copolymer hydrogel solution mass ratio = 1:50), mixed thoroughly, and then drop-coated again onto the sample surface. The mixture was cured at 60°C for 1 hour. This allowed GL13K to be loaded into the MAA / MMA copolymer network. The sample was then rinsed three times with sterile deionized water to remove unloaded GL13K from the surface, and vacuum dried at 70°C for 1 hour. A coating containing a GL13K intermediate responsive layer was obtained, labeled A3.

[0064] Example 8 This embodiment describes the preparation of a bone implant coating containing an outer layer structure.

[0065]

[0066] Add solution B dropwise to solution A (drop rate 1 mL / min) and stir magnetically (500 rpm) for 30 minutes. Adjust the pH to 9.5 (range 9-10) with ammonia and continue stirring for 10 minutes. Transfer to an 80°C water bath and react for 4 hours. After the reaction is complete, centrifuge (8000 rpm, 10 minutes) to collect the precipitate, and wash three times with deionized water (to remove impurities). Wash once with ethanol (to accelerate drying). Vacuum dry at 60°C for 24 hours, grind, and pass through a 200-mesh sieve to obtain... powder.

[0067] 8.2 Preparation of 2wt% Sr-nHA aqueous dispersion Weigh Add the powder to 10 mL of deionized water. Sonicate the mixture (200 W, 40 kHz) for 30 minutes to form a uniform dispersion, thus obtaining a 2 wt% Sr-nHA aqueous dispersion.

[0068] 8.3. Load Sr-nHA onto a coating containing a GL13K intermediate response layer to prepare a bone implant coating with an outer layer structure.

[0069] The coating A1 containing the GL13K intermediate response layer prepared in Example 5 was immersed in a 2wt% Sr-nHA dispersion and allowed to stand at room temperature for 10 minutes. After removal, excess dispersion was blown off with nitrogen and baked in a 60°C oven for 30 minutes. The above immersion and baking steps were repeated once to form an outer layer load, followed by vacuum drying at 37°C for 2 hours and sterilization with ethylene oxide to obtain the No. 1 bone implant coating.

[0070] Example 9 This embodiment describes the preparation of a bone implant coating containing an outer layer structure.

[0071] 9.1 Preparation of curcumin-osteogenic peptide OGP(10-14) sustained-release microspheres Osteogenic peptide OGP(10-14) peptide: YGFGG, purity ≥95%.

[0072] PLGA: 50:50, molecular weight 10kDa, carboxyl-terminated.

[0073] Polyvinyl alcohol (PVA, molecular weight 30kDa, degree of hydrolysis 89%) Weigh 5 mg of OGP(10⁻¹⁴) (YGFGG) and dissolve it in 1 mL of deionized water to prepare a 5 mg / mL osteogenic peptide solution. Weigh 100 mg of PLGA and dissolve it in 2 mL of dichloromethane (DCM) to prepare a 50 mg / mL PLGA solution. Add 0.5 mg of curcumin to 2 mL of PLGA-DCM solution, and simultaneously add 1 mL of OGP peptide solution dropwise. Sonicate the solution under ice bath conditions (200 W power, 40 kHz frequency, 1 min) to form a colostrum. Quickly pour the colostrum into 20 mL of 1% PVA aqueous solution and magnetically stir (800 rpm, 5 min) to form a secondary emulsion. Transfer the secondary emulsion to 100 mL of 0.5% PVA aqueous solution and stir at room temperature (300 rpm) for 4 hours to allow the DCM to completely evaporate and the microspheres to solidify. Centrifuge (12,000 rpm, 10 min) to collect the microspheres and wash them three times with deionized water to remove residual PVA and peptides. The microsphere dispersion was freeze-dried (-80°C, 24 hours) to obtain dried microsphere powder, which is curcumin-osteoblastic peptide OGP(10-14) sustained-release microspheres. 9.2 The curcumin-osteoblast peptide OGP(10-14) sustained-release microspheres prepared in step 9.1 were ultrasonically dispersed in 0.1% PVA / PBS (1 mg / mL). The microspheres were ultrasonically dispersed with a probe (10% power, 10 s) to avoid microsphere rupture, thus obtaining a curcumin-osteoblast peptide OGP(10-14) sustained-release microsphere dispersion.

[0075] The coating A2 containing the GL13K intermediate responsive layer prepared in Example 6 was immersed in a curcumin-osteogenic peptide OGP (10-14) sustained-release microsphere dispersion at 25°C for 30 min. During this period, the coating A2 containing the GL13K intermediate responsive layer was pulled up at a pulling speed of 1 mm / s, followed by vacuum drying at 37°C for 2 h to allow the microspheres to adhere stably. After the reaction was completed, the loose adsorbed microspheres were removed by gentle ultrasonic cleaning (40 kHz, 10 s). The microspheres were then sterilized by γ-irradiation to obtain the #2 bone implant coating.

[0076] Example 10 This embodiment describes the preparation of a bone implant coating containing an outer layer structure.

[0077] Osteogenic peptide OGP(10-14) peptide: YGFGG, purity ≥95%.

[0078] PLGA: 50:50, molecular weight 30 kDa, carboxyl-terminated.

[0079] Polyvinyl alcohol (PVA): Molecular weight 70 kDa, degree of hydrolysis 87% Weigh 5 mg of OGP(10⁻¹⁴) (YGFGG) and dissolve it in 1 mL of deionized water to prepare a 2 mg / mL peptide solution. Weigh 100 mg of PLGA and dissolve it in 2 mL of dichloromethane (DCM) to prepare a 50 mg / mL PLGA solution. Add 0.5 mg of curcumin to 2 mL of PLGA-DCM solution, and simultaneously add 1 mL of OGP peptide solution dropwise. Sonicate the solution under ice bath conditions (200 W power, 40 kHz frequency, 1 min) to form a colostrum. Quickly pour the colostrum into 20 mL of 1% PVA aqueous solution and magnetically stir (800 rpm, 5 min) to form a secondary emulsion. Transfer the secondary emulsion to 100 mL of 0.5% PVA aqueous solution and stir at room temperature (300 rpm) for 4 hours to allow the DCM to completely evaporate and the microspheres to solidify. Centrifuge (12,000 rpm, 10 min) to collect the microspheres and wash them three times with deionized water to remove residual PVA and peptides. The microsphere dispersion was freeze-dried (-80°C, 24 hours) to obtain dried microsphere powder, which is curcumin-osteoblastic peptide OGP(10-14) sustained-release microspheres.

[0080] The coating A1 containing the GL13K intermediate responsive layer prepared in Example 7 was immersed in a curcumin-osteogenic peptide OGP (10-14) sustained-release microsphere dispersion at 25°C for 30 min. During this period, the coating A3 containing the GL13K intermediate responsive layer was pulled up at a pulling speed of 1 mm / s, followed by vacuum drying at 37°C for 2 h to stabilize the microspheres. After the reaction, the loose adsorbed microspheres were removed by gentle ultrasonic cleaning (40 kHz, 10 s). The microspheres were then sterilized by γ-irradiation to obtain the #3 bone implant coating.

[0081] Example 11 This embodiment describes the preparation of a bone implant coating containing an outer layer structure.

[0082] Osteogenic peptide OGP(10-14) peptide: YGFGG, purity ≥95%.

[0083] PLGA: 50:50, molecular weight 20 kDa, carboxyl-terminated.

[0084] Polyvinyl alcohol (PVA): Molecular weight 50 kDa, degree of hydrolysis 85% Weigh 5 mg of OGP(10⁻¹⁴) (YGFGG) and dissolve it in 1 mL of deionized water to prepare a 4 mg / mL peptide solution. Weigh 100 mg of PLGA and dissolve it in 2 mL of dichloromethane (DCM) to prepare a 50 mg / mL PLGA solution. Add 0.1 mg of curcumin to 2 mL of PLGA-DCM solution, and simultaneously add 1 mL of OGP peptide solution dropwise. Sonicate the solution under ice bath conditions (200 W power, 40 kHz frequency, 1 min) to form a proemulsion. Quickly pour the proemulsion into 20 mL of 1% PVA aqueous solution and magnetically stir (800 rpm, 5 min) to form a secondary emulsion. Transfer the secondary emulsion to 100 mL of 0.5% PVA aqueous solution and stir at room temperature (300 rpm) for 4 hours to allow the DCM to completely evaporate and the microspheres to solidify. Centrifuge (12,000 rpm, 10 min) to collect the microspheres and wash them three times with deionized water to remove residual PVA and peptides. The microsphere dispersion was freeze-dried (-80°C, 24 hours) to obtain dried microsphere powder, which is curcumin-osteoblastic peptide OGP(10-14) sustained-release microspheres.

[0085] The coating A3 containing the GL13K intermediate responsive layer prepared in Example 5 was immersed in a curcumin-osteogenic peptide OGP (10-14) sustained-release microsphere dispersion at 25°C for 30 min. During this time, the coating A3 containing the GL13K intermediate responsive layer was pulled up at a pulling speed of 1 mm / s, followed by vacuum drying at 37°C for 2 h to allow the microspheres to adhere stably. After the reaction was completed, the loose adsorbed microspheres were removed by gentle ultrasonic cleaning (40 kHz, 10 s). The microspheres were then sterilized by γ-irradiation to obtain the No. 4 bone implant coating.

[0086] Example 12 This embodiment describes the preparation of a bone implant coating containing an outer layer structure.

[0087] The only difference between this embodiment and Example 11 is that curcumin is not added, and 0.1 mg of OGP polypeptide YGFGG is used to replace curcumin to prepare the No. 5 bone implant coating.

[0088] Test Example 1 This test example is to test the release rate of antimicrobial peptides of the bone implant coating prepared by the method of the present invention at different pH values.

[0089] The bone implant coatings (1cm*1cm*0.2cm) prepared in Examples 8-10 were placed in PBS solution with a pH of 4.5 for 72 hours. The initial extract and the extract after 72 hours were diluted to 1 / 1000 with deionized water and analyzed using ICP-MS. The results are as follows: Figure 1 As shown; the bone implant coatings (1cm*1cm*0.2cm) prepared in Examples 8-10 were placed in PBS solution with a pH of 7.4 for 72 hours. The initial extract and the extract after 72 hours were diluted to 1 / 1000 with deionized water and the data were obtained using ICP-MS. The results are as follows. Figure 2 As shown; The results showed that the cumulative release rate of GL13K from the 1-3# bone implant coatings was 12.30%-13.5% over 72 hours in PBS at pH 7.4, and 76.35%-85.13% in PBS at pH 4.5. This indicates that the antimicrobial peptide is intelligently released in an acidic environment simulating an infection to exert its antimicrobial effect, while the release rate of the antimicrobial peptide GL13K is significantly reduced in an alkaline environment in the non-infection environment. This deep structure has the ability to intelligently release the antimicrobial peptide GL13K, which meets the clinical needs of bone implants.

[0090] Test Example 2 This test example is to test the in vitro antibacterial properties of the bone implant coating prepared by the method of the present invention.

[0091] The 1#-3# bone implant coatings prepared in Examples 8-10 were used as the experimental group, and the 1#-3# micro-arc oxidation (MAO) underlayers prepared in Examples 2-4 were used as the control. The antibacterial effects of each experimental group on common orthopedic pathogens such as Staphylococcus aureus (ATCC 25923), Staphylococcus epidermidis (clinical strain), and Escherichia coli (ATCC 25922) were tested.

[0092] In a pH 5.5 environment, Staphylococcus aureus (ATCC 25923), Staphylococcus epidermidis (clinical strain), and Escherichia coli (ATCC 25922) were cultured in contact with the bone implant coatings of test groups 1#-3# and the micro-arc oxidation (MAO) substrates of control groups 1#-3#. After 24 hours, the bactericidal effect of each treatment was statistically analyzed using the viable cell count method. The bactericidal rate results for each treatment are as follows: Figure 2 As shown in the figure. The results indicate that the micro-arc oxidation (MAO) underlayer of test group 1#-3# had no significant antibacterial effect under pH 5.5. Compared with the control 1#-3# micro-arc oxidation (MAO) underlayer, the bone implant coating of 1#-3# showed a significant bactericidal effect. The bactericidal rate of 1#-3# bone implant coating against Staphylococcus aureus, Staphylococcus epidermidis, and Escherichia coli was all greater than 99%, which met the requirements.

[0093] In a pH 7.4 environment, Staphylococcus aureus (ATCC 25923), Staphylococcus epidermidis (clinical strain), and Escherichia coli (ATCC 25922) were cultured in contact with the bone implant coatings of test group 1#-3# and the micro-arc oxidation (MAO) bottom layer of control group 1#-3#. The colony count of each treatment was counted, and the results are shown in Table 1.

[0094]

[0095] The results showed that, under pH 7.4 conditions, the 1#-3# bone implant coatings and the control group 1#-3# micro-arc oxidation (MAO) underlayers exhibited significantly better antibacterial effects against Staphylococcus aureus, Staphylococcus epidermidis, and Escherichia coli. No significant difference.

[0096] Test Example 3 This test case is a test of the osteogenic performance of bone implant coatings #1-#5.

[0097] The 1#-5# bone implant coatings prepared in Examples 7-11 were used as the test group, the 1#-3# micro-arc oxidation (MAO) underlayers prepared in Examples 2-4 were used as the control, and the blank titanium alloy was used as the negative control.

[0098] (a) Sample preparation All samples (coating groups 1#-5#, MAO control group 1#-3#, and blank titanium alloy) were disinfected by immersing in 75% ethanol for 30 minutes, then rinsed with sterile PBS 3 times for 5 minutes each time, and placed in a clean bench for UV irradiation for 30 minutes before use.

[0099] Place the samples into 24-well cell culture plates, one sample per well.

[0100] (ii) Cell inoculation MC3T3-E1 cells were revived and cultured in α-MEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin at 37°C. The cells were cultured in a cell culture incubator until they reached the logarithmic growth phase, then digested with 0.25% trypsin to prepare a single-cell suspension.

[0101] The cell suspension was seeded into 24-well cell culture plates containing the sample, with a cell density of [missing information - likely a specific value]. Cells per well, 1 mL of culture medium per well, and cultured in a cell culture incubator.

[0102] (III) Cell proliferation detection (CCK-8) After 7 days of cell culture, remove the culture plate, add 10 μL of CCK-8 reagent to each well, and continue incubation in the cell culture incubator for 2 hours.

[0103] The absorbance (OD value) of each well was measured at a wavelength of 450 nm using an ELISA reader.

[0104] Calculate cell proliferation rate: Cell proliferation rate (%) = (OD value of experimental group - OD value of blank group) / (OD value of control group - OD value of blank group) × 100%. Results are as follows: Figure 3 As shown.

[0105] (iv) Osteogenic differentiation detection Alkaline phosphatase activity (ALP) assay After 14 days of cell culture, the culture medium was aspirated, the cells were washed twice with sterile PBS, and 200 μL of cell lysis buffer was added to each well. The cells were then lysed on ice for 30 minutes, with shaking every 10 minutes during the lysing process.

[0106] Transfer the lysate to a centrifuge tube, centrifuge at 12,000 rpm for 10 minutes, and collect the supernatant.

[0107] Follow the instructions for the ALP detection kit to determine ALP activity. Results are as follows: Figure 4 As shown.

[0108] Osteogenic gene expression detection (qRT-PCR) After 14 days of cell culture, the culture medium was aspirated, the cells were washed twice with sterile PBS, 1 mL of Trizol reagent was added to each well, and the cells were lysed at room temperature for 5 minutes. The lysate was then transferred to centrifuge tubes, and total RNA was extracted according to the Trizol reagent instructions.

[0109] RNA was reverse transcribed into cDNA using a reverse transcription kit.

[0110] Using cDNA as a template, qRT-PCR reactions were performed using a qRT-PCR kit and primers for Runx2, Alp, COL1, and the internal reference gene GAPDH. The reaction conditions were set according to the kit instructions. The primers for Runx2 were Runx2-F (GCTTCATTCGCCTCACAAAC) and Runx2-R (GTAGTGACCTGCGGAGATTAAC); the primers for Alp were Alp-F (TTTATAAGGCGGCGGGGGT) and Alp-R (TTAACTGATGTTCCAATCCTGCG). The primers for COL1 are COL1-F (TGTTCAGCTTTGTGGACCTC) and COL1-R (GGTGATTGGTGGGATGTCTT); the primers for GAPDH are GAPDH-F (CAAGAGCACAAGAGGAAGAGAG) and GAPDH-R (CTACATGGCAACTGTGAGGAG). Using... The relative gene expression levels were calculated using this method. The results are as follows: Figures 5-7 As shown.

[0111] Depend on Figure 3 It can be seen that the external functional coatings containing curcumin-osteoblastic peptides, with Sr-nHA as the outer functional layer (coating #1), and coatings #2-#4, showed a much higher proliferation rate of MC3T3-E1 osteogenic cells than the control group (coatings #1-#3) micro-arc oxidation (MAO). Among them, the external functional coatings containing curcumin-osteoblastic peptides with coatings #2-#4 showed a slightly better proliferation rate of MC3T3-E1 cells than coating #1 with Sr-nHA as the outer functional layer. It is worth noting that the external functional coatings containing curcumin-osteoblastic peptides with coatings #2-#4 showed a significantly higher proliferation rate of MC3T3-E1 cells than coating #5, which only used external functional coatings containing osteoblastic peptides. This suggests that curcumin and osteoblastic peptides have a synergistic effect in promoting the proliferation of MC3T3-E1 cells.

[0112] Depend on Figure 4 It can be seen that the alkaline phosphatase activity in the curcumin-osteogenic peptide-containing coatings (coatings #1, #2, and #4, with Sr-nHA as the external functional layer) is much higher than that in the control group (coatings #1 and #3, micro-arc oxidation (MAO) bottom layer). Among them, the alkaline phosphatase activity in the curcumin-osteogenic peptide-containing coatings (coatings #2 and #4) is slightly better than that in coating #1, which uses Sr-nHA as the external functional layer. Compared with coating #5, which only uses osteogenic peptides, the alkaline phosphatase activity in the curcumin-osteogenic peptide-containing coatings (coatings #2 and #4) is significantly higher, suggesting that curcumin and osteogenic peptides have a synergistic effect.

[0113] Figure 5 , Figure 6 , Figure 7 The expression trends of osteogenic genes Runx2, Alp, and COL1 in each experimental group were consistent, indicating that Sr-nHA, as the No. 1 coating of the outer functional layer, and the curcumin-osteogenic peptide-containing outer functional coatings of No. 2 to No. 4, all have good bone-promoting functions.

Claims

1. A titanium alloy implant coating, characterized by, The titanium alloy implant coating is composed of a micro-arc oxidation base layer, a pH-responsive intermediate layer and an outer functional layer, The micro-arc oxidation base layer is formed by treating a titanium substrate with an electrolyte containing calcium acetate and sodium β-glycerophosphate; The pH-responsive intermediate layer contains a methyl methacrylate and methyl methacrylate copolymer and an antibacterial peptide GL13K loaded on the methyl methacrylate and methyl methacrylate copolymer; The outer functional layer contains Sr-doped hydroxyapatite or slow-release microspheres containing osteogenic peptide YGFGG.

2. The titanium alloy implant coating of claim 1, wherein, The pH of the electrolyte for the micro-arc oxidation base layer is 8.5-10.

5.

3. The titanium alloy implant coating of claim 2, wherein, The thickness of the micro-arc oxidation base layer is 5-20 μm.

4. The titanium alloy implant coating of claim 1, wherein, In the pH-responsive intermediate layer, the mass ratio of the methyl methacrylate and methyl methacrylate copolymer is 60:40-70:30; and the loading amount of GL13K is 0.1-0.5 mg / cm².

5. The titanium alloy implant coating of claim 1, wherein, The outer functional layer is Powder or PLGA encapsulated sustained release microspheres containing osteogenic peptide YGFGG.

6. The titanium alloy implant coating of claim 5, wherein, In the PLGA-coated slow-release microspheres containing osteogenic peptide YGFGG, the concentration of the osteogenic peptide YGFGG is 2-5 mg / mL.

7. The titanium alloy implant coating of claim 6, wherein, The PLGA-coated slow-release microspheres containing osteogenic peptide YGFGG further contain curcumin.

8. The titanium alloy implant coating of claim 7, wherein, In the PLGA-coated slow-release microspheres containing osteogenic peptide YGFGG, the mass ratio of the osteogenic peptide YGFGG to curcumin is 0.1-0.5:2-5.

9. A method of making a titanium alloy implant coating according to any one of claims 1-7, characterized in that, The method comprises the following steps: S1, pretreating a titanium alloy substrate; S2, performing micro-arc oxidation treatment on the pretreated titanium alloy substrate to form a calcium and phosphorus-containing porous micro-arc oxidation base layer in an electrolyte containing calcium and phosphate at a voltage of 250-400 V; S3, coating a MAA / MMA copolymer intermediate layer on the micro-arc oxidation base layer prepared in S2 and loading GL13K to prepare an intermediate product containing a pH-responsive intermediate layer; S4, loading Sr-nHA or slow-release microspheres containing osteogenic peptide YGFGG on the intermediate product containing a pH-responsive intermediate layer prepared in S3 to prepare a titanium alloy implant containing an outer functional layer; S5, sterilizing the titanium alloy implant containing an outer functional layer prepared in S4 to prepare a titanium alloy implant.

10. Use of the titanium alloy implant coating of claim 1 in bone implants.

Images