Transaminase mutant and application thereof

By modifying the key sites of ω-transaminase, a transaminase mutant was constructed, which solved the problem of low catalytic activity of ω-transaminase and realized the efficient biocatalytic synthesis of chiral (S)-3-amino-3-(4-bromophenyl)propionate ethyl ester, which meets the high purity requirements of pharmaceutical intermediates and has significant industrial application value.

CN121628871APending Publication Date: 2026-03-10HEFEI HUANA BIOMEDICAL TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-16
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

In the existing technology, ω-transaminase has low catalytic activity in the synthesis of chiral (S)-3-amino-3-(4-bromophenyl)propionate ethyl ester, and the chemical synthesis method is complicated and polluting, lacking an effective biocatalytic synthesis method.

Method used

By performing site-directed mutagenesis on ω-transaminase from Roseobacterium, particularly modifying the P18, Y59, S86, W149, F188, T231, L297, and R420 sites, transaminase mutants were constructed and expressed in Escherichia coli BL21 cells. The transamination reaction was carried out using L-alanine and pyridoxal-5'-phosphate as catalysts.

Benefits of technology

The mutant enzyme achieved a raw material conversion rate of over 90% within 60 hours and 97.8% within 48 hours under a reaction system of 1 wt enzyme and 30 V. The product ee values ​​were all greater than 99%. The reaction conditions were mild and environmentally friendly, replacing traditional chemical synthesis and possessing industrial application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure QLYQS_1
    Figure QLYQS_1
Patent Text Reader

Abstract

The invention provides a transaminase mutant and application thereof, relates to the technical field of enzyme catalysis, and solves the technical problem of low catalytic activity of a wild enzyme on ethyl (4-bromobenzoyl) acetate by performing mutation modification on a key site of omega-transaminase from rose bacter. The raw material conversion rate of the mutant in a reaction system of 1wt of enzyme and 30v is more than 90% within 60h, the conversion rate of the optimal quintuple mutant in 48h reaches 97.8%, the enzyme dosage and the reaction volume are reduced, and the reaction period is shortened. The ee value of the product is greater than 99%, additional chiral resolution is not needed, and the high-purity requirement of a drug intermediate is met. The reaction conditions are mild and environment-friendly, and a chemical synthesis method which is complex in process and serious in pollution is replaced. The mutant can be efficiently expressed in Escherichia coli BL21, the screening and amplification process is simple, the technical blank of biocatalytic synthesis of the intermediate is filled, and the mutant has remarkable industrial application value and environmental protection benefit.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of enzyme catalysis technology, specifically to a transaminase mutation and its application. Background Technology

[0002] Chiral amines are a class of compounds with an amino group attached to their chiral center. They are widely found in various living organisms in nature and play important roles in genetics, metabolism, and physiological processes. Chiral amines are also important components of active pharmaceutical ingredients, such as rivastigmine (an Alzheimer's disease drug), dirivalol (an adrenaline antagonist), and lopinavir (an antiretroviral drug).

[0003] There are three main methods for synthesizing chiral amines: chemical synthesis, kinetic resolution, and asymmetric biocatalytic synthesis. Compared to chemical synthesis, asymmetric biocatalytic synthesis offers advantages such as environmental friendliness, low cost, and good stereoselectivity. Biocatalysis utilizes enzymes or whole microbial cells as catalysts, enabling highly efficient reactions at ambient temperature and pressure, thus avoiding the problems of expensive metal catalysts, high-pressure equipment, and complex protection and deprotection steps required in traditional chemical synthesis.

[0004] Currently, ω-transaminase (ω-TA) is widely used in the one-step synthesis of asymmetric chiral amines. ω-TA is a pyridoxal-5'-phosphate (PLP)-dependent enzyme that catalyzes the asymmetric synthesis of chiral amines via the reductive amination of ketones. D- or L-alanine (D-, L-ALA) or isopropylamine are commonly used amine donors. Generally, ω-TA using D-ALA as an amine donor has the following folding pattern: The type has (R) selectivity, while the folding type utilizing L-ALA is The type exhibits (S) selectivity. All known wild-type ω-transaminases form their active sites via monomeric dimers, consisting of two binding pouches of different sizes. Normally, the smaller binding pouch limits the size of the substrate it can accommodate; therefore, altering the substrate binding site of ω-transaminases to accept larger substituents is of great significance for the synthesis of chiral amine compounds.

[0005] Ethyl (S)-3-amino-3-(4-bromophenyl)propionate, as a pharmaceutical intermediate, has been increasingly used in the synthesis and development of new drugs in recent years. However, the chemical synthesis of ethyl (S)-3-amino-3-(4-bromophenyl)propionate faces challenges such as complex synthesis processes, high costs, and severe environmental pollution. Although ω-transaminases are widely used in the synthesis of some asymmetric chiral compounds, such as (S)-4-chloro-diphenylmethylamine, (S)-1,3-diphenylprop-1-amine, and (S)-1-phenylprop-1-amine, there are currently no reports on the biocatalytic asymmetric synthesis of chiral (S)-3-amino-3-(4-bromophenyl)propionate. Summary of the Invention

[0006] Therefore, this invention explores an enzymatic synthetic route for ethyl (S)-3-amino-3-(4-bromophenyl)propionate using ω-transaminase, and mutates the enzyme to improve its conversion rate.

[0007] This invention provides a transaminase mutant based on the amino acid sequence of the transaminase of *Roseobacterium* sp. shown in SEQ ID NO:1, by performing site-directed or saturation mutations at one or more sites among P18, Y59, S86, W149, F188, T231, L297, and R420.

[0008] Mutations at each site include any one or more of the following: P18E, Y59F / G / C / S / R / D, S86R / Q / H / P / A / E, W149R / Q / E / D, F188R / D / C / S / G, T231A / D / V / G, L297S / D, and R420E / A / F; where the letter before the number represents the original amino acid, the letter after the number represents the mutated amino acid, and " / " indicates "or".

[0009] Furthermore, transaminase mutants include any of the following combinations of amino acid mutations:

[0010] P18E; Y59F / G / C / S / R / D; S86R / Q / H / P / A / E; W149R / Q / E / D; F188R / D / C / S / G; S86R / Q / H / P / A / E; P18E+ W149R / Q / E / D; P18E+ F188R / D / C / S / G; P18E+ T231A / D / V / G; P18E+ L297S / D; P18E+ R420E / A / F; P18E+Y59F / G / C / S / R / D+S86R / Q / H / P / A / E; P18E+Y59F / G / C / S / R / D+W149R / Q / E / D; P18E+Y59F / G / C / S / R / D+F188R / D / C / S / G; P18E+Y59F / G / C / S / R / D+T231A / D / V / G; P18E+Y59F / G / C / S / R / D+L297S / D; P18E+Y59F / G / C / S / R / D+R420E / A / F; P18E+ S86R / Q / H / P / A / E +W149R / Q / E / D;

[0011] P18E+ S86R / Q / H / P / A / E +F188R / D / C / S / G; P18E+ S86R / Q / H / P / A / E +T231A / D / V / G;

[0012] P18E+ S86R / Q / H / P / A / E +L297S / D; P18E+ S86R / Q / H / P / A / E +R420E / A / F; P18E+Y59F / G / C / S / R / D+S86R / Q / H / P / A / E+ W149R / Q / E / D; P18E+Y59F / G / C / S / R / D+S86R / Q / H / P / A / E+F188R / D / C / S / G ;P18E+Y59F / G / C / S / R / D+S86R / Q / H / P / A / E+T231A / D / V / G; P18E+Y59F / G / C / S / R / D+S86R / Q / H / P / A / E+L297S / D; P18E+Y59F / G / C / S / R / D+S86R / Q / H / P / A / E+R420E / A / F; P18E+Y59F / G / C / S / R / D+S86R / Q / H / P / A / E+T231A / D / V / G +R420E / A / F.

[0013] Furthermore, the transaminase mutant is a quintuple mutant with the mutation combination P18E+Y59S+S86R+T231D+R420E.

[0014] To achieve the above objectives, the present invention provides a DNA molecule that encodes the aforementioned transaminase mutant.

[0015] To achieve the above objectives, the present invention provides a recombinant plasmid comprising the DNA molecule described above.

[0016] Furthermore, the recombinant plasmid includes one or more of the following: pET-21b(+), pET-22b(+), pET-28a(+), pET-28b(+), pET-32a(+), pET-32b(+), or pUC-19.

[0017] To achieve the above objectives, the present invention provides a host cell in which the recombinant plasmid described above is transformed.

[0018] Furthermore, the host cell was Escherichia coli BL21 cell.

[0019] Based on the application of the transaminase mutant described above in the catalytic synthesis of ethyl (S)-3-amino-3-(4-bromophenyl)propionate, using ethyl (4-bromobenzoyl)acetate as the amino acceptor and L-alanine as the amino donor, the transamination reaction is carried out in the presence of pyridoxal-5'-phosphate (PLP). The reaction route is as follows:

[0020] .

[0021] Furthermore, the reaction system for synthesizing ethyl (S)-3-amino-3-(4-bromophenyl)propionate included 50 mM MEPES-NaOH buffer (pH=8.0), 1 mM PLP, 200 mM L-alanine, and 10% v / v DMSO, and the reaction conditions were 30 °C and 250 rpm shaking incubation.

[0022] Beneficial effects of this invention:

[0023] This invention solves the technical problem of low catalytic activity of wild-type ω-transaminase for (4-bromobenzoyl)ethyl acetate by mutating key sites of ω-transaminase derived from *Roseobacterium*. The mutant achieves a raw material conversion rate exceeding 90% within 60 hours at 1 wt enzyme concentration and a 30 V reaction system, with the optimal quintuple mutant reaching a conversion rate of 97.8% after 48 hours, reducing enzyme usage and reaction volume, and shortening the reaction cycle. The product ee values ​​are all >99%, requiring no additional chiral resolution and meeting the high purity requirements of pharmaceutical intermediates. The reaction conditions are mild and environmentally friendly, replacing complex and highly polluting chemical synthesis methods. The mutant can be efficiently expressed in *Escherichia coli* BL21, and the screening and scale-up process is simple, filling the technical gap in the biocatalytic synthesis of this intermediate and possessing significant industrial application value and environmental benefits. Detailed Implementation

[0024] The present invention will now be described in further detail with reference to specific embodiments. The embodiments of the present invention are given for illustrative and descriptive purposes only, and are not intended to be exhaustive or to limit the invention to the disclosed forms. Many modifications and variations will be apparent to those skilled in the art. The embodiments were chosen and described to better illustrate the principles and practical applications of the invention, and to enable those skilled in the art to understand the invention and design various embodiments with various modifications suitable for a particular purpose.

[0025] To facilitate the subsequent case analysis, the relevant terms are defined here:

[0026] 1. Catalytic activity: refers to the amount of raw material that each unit mass of enzyme converts per unit time. The catalytic activity of this transaminase is positively correlated with the conversion rate of the reaction raw materials described in this article.

[0027] 2. Wild-type enzyme: refers to an enzyme synthesized by exogenous expression after the DNA sequence has not been mutated and recombinant expression plasmid is used. The wild-type enzyme mentioned in this article refers to the enzyme produced by expressing the recombinant expression plasmid constructed from the DNA sequence of ω-transaminase from Roseobacterium without mutation into Escherichia coli BL21 cells.

[0028] 3. Mutant enzyme: refers to an enzyme produced by expressing an expression plasmid constructed from a DNA sequence through site-directed mutagenesis and / or site-directed saturation mutagenesis in exogenous cells. The mutant enzyme described in this article refers to an enzyme produced by expressing a recombinant expression plasmid constructed from the DNA sequence of ω-transaminase from Roseobacterium through site-directed mutagenesis and / or site-directed saturation mutagenesis in Escherichia coli BL21 cells.

[0029] 4. The 1wt mentioned in this article refers to 1g of wet cells of recombinant Escherichia coli BL with ω-transaminase required to transform 1g of main raw material.

[0030] 5. The 1v mentioned in this article refers to the mass ratio of the reaction volume to the main reaction substrate.

[0031] Experimental materials and reagents

[0032] Host cell: Escherichia coli BL21 (DE3).

[0033] Vectors: pET-21b(+), pET-22b(+), pET-28a(+), pET-28b(+), pET-32a(+), pET-32b(+) or pUC-19, all of which are commercially available conventional vectors.

[0034] Primers: Primers shown in SEQ ID NO:3-SEQ ID NO:18, the specific sequences are shown in Table 1.

[0035] Reagents: L-alanine, pyridoxal-5'-phosphate (PLP), ethyl (4-bromobenzoyl)acetate, HEPES buffer, DMSO, kanamycin sulfate, IPTG, LB medium, LA medium, PBS buffer, cell lysis buffer (containing 50mM Tris-HCl pH=8.0, 150mM NaCl, 1mg / mL lysozyme), etc., are all conventional molecular biology reagents.

[0036] Instruments: PCR instrument, high-throughput microplate reader, high-performance liquid chromatograph (HPLC), ultrasonic disruptor, high-speed refrigerated centrifuge, constant temperature shaking incubator.

[0037] Table 1: List of mutant primer sequences:

[0038] SEQ ID NO: Primer name Primer sequence 3 P18E-F cgacaacttttttcacgaaagcacccatctggcc 4 P18E-R ggccagatgggtgctttcgtgaaaaaagttgtcg 5 Y59-F gatgcgttcgcaggcctgNNKtgcgtaaacgtgggttatg 6 Y59-R cataacccacgtttacgcaMNNcaggcctgcgaacgcatc 7 S86-F ctggcgtactatcatNNKtacgtaggtcacg 8 S86-R cgtgacctacgtaMNNatgatagtacgccag 9 W149-F atcatttcccgcNNKcgcggttaccacggtagcg 10 W149-R cgctaccgtggtaaccgcgMNNgcgggaaatgat 11 F188-F cccatactatNNKcgccgtgaagacctg 12 F188-R caggtcttcacggcgMNNatagtatggg 13 T231-F gaaccaatcctgggtNNKggtggtatcgtc 14 T231-R gacgataccaccMNNacccaggattggttc 15 L297-F gcgcctacgccccgNNKtccggttccatcgt 16 L297-R acgatggaaccggaMNNcggggcgtaggcgc 17 R420-F caaaatcatcgcgNNKgccatgcctcagggc 18 R420-R gccctgaggcatggcMNNcgcgatgattttg

[0039] Note: In the primers, NNK (N for A / G / C / T, K for G / T) and MNN (M for A / C) are degenerate codons that can cover all possible amino acid mutations at the target site.

[0040] Therefore, based on the wild-type enzyme, we performed site-directed mutagenesis at one amino site and saturation mutagenesis at seven sites, screening for 900 mutant strains. We successfully screened a mutant enzyme that, within 60 hours, converted over 90% of the raw materials into the target product using a 1 wt% mutant enzyme and a 30 V reaction system.

[0041] Example 1: Construction of transaminase mutants

[0042] SEQ ID NO:1 is the amino acid sequence of the transaminase from *Ruegeria sp.*, and SEQ ID NO:2 is the original DNA sequence encoding SEQ ID NO:1 (the amino acid sequence of the transaminase from *Ruegeria sp.*). Based on the amino acid sequence of the transaminase from *Ruegeria sp.* shown in SEQ ID NO:1, a transaminase mutant was constructed. The specific steps are as follows:

[0043] 1. Using the recombinant plasmid containing the gene encoding SEQ ID NO:1 as a template, site-directed mutagenesis was performed at the P18 site using primers shown in SEQ ID NO:3-4; saturation mutagenesis was performed at the Y59, S86, W149, F188, T231, L297, and R420 sites using primers shown in SEQ ID NO:5-18. Complete linear fragments were obtained by whole-plasmid PCR.

[0044] 2. The PCR product was digested with DpnI to remove the methylated template plasmid, transformed into E. coli BL21 cells, plated in LA culture dishes containing 50 mg / L kanamycin sulfate, and incubated overnight at 37°C.

[0045] 3. For the combined mutant, the coding gene containing multiple mutation sites was amplified by overlap extension PCR, digested at both ends with restriction endonucleases, ligated into the corresponding expression vector, transformed into E. coli BL21 cells, plated in LA culture dishes containing 50 mg / L kanamycin sulfate, and cultured overnight at 37°C to obtain the combined mutant.

[0046] 4. Select a single colony for sequencing identification. Once the mutation site is confirmed to be correct, set it aside for later use.

[0047] Example 2: Expression of transaminase mutants

[0048] 1. After the site-directed mutation mutant is correctly sequenced, it is streaked with LA medium containing 50 mg / L kanamycin sulfate and the above-spread saturated mutant plate and cultured together overnight at 37°C.

[0049] 2. Pick a single colony and place it in a 96-well plate of LB medium containing 50 mg / L kanamycin sulfate. Incubate at 37°C with shaking at 200 rpm until the OD600 is between 0.6 and 0.8. Then add IPTG to a final concentration of 1 mM and incubate at 22°C with shaking at 180 rpm for 16 hours to induce mutant enzyme expression.

[0050] 3. For mutants used in secondary screening, take 5 ml of mutant enzyme culture with OD600 = 0.6-0.8 and inoculate it into 500 ml of LB medium containing 50 mg / L kanamycin sulfate. Incubate at 37°C and 200 rpm with shaking until OD600 = 0.6-0.8. Then add IPTG to a final concentration of 1 mM and incubate at 22°C and 180 rpm for 16 hours to amplify the induced expression.

[0051] Example 3: Screening for transaminase mutants

[0052] 1. High-throughput primary screening:

[0053] (1) Centrifuge the 96-well plate at 4000 rpm for 10 min at 4℃ and discard the supernatant. Add 200 L of cell lysis buffer to each well, incubate at 37℃ for 2 hours, centrifuge at 4000 rpm for 10 min at 4℃, and the resulting supernatant is the crude enzyme solution of the mutant enzyme.

[0054] (2) Add 150 L of reaction base solution to a 96-well plate. The reaction base solution includes: 50 mM HEPES-NaOH pH: 8.0, 1 mM MPL, 200 mM L-alanine, 100 mM (4-Br benzoyl) ethyl acetate, 10% v / v DMSO, and 100 L of crude mutant enzyme solution. After mixing thoroughly, measure the absorbance at 254 nm.

[0055] (3) Incubate the reaction at 30℃ and 250rpm with shaking. Measure the absorbance at 254nm every 24 hours until the reaction has been incubated for 60 hours. Record the change in absorbance as ΔA.

[0056] (4) By comparing the size of ΔA, the enzyme activity change can be preliminarily judged, and mutant enzymes with higher activity than wild-type enzymes can be screened for secondary screening and sequencing.

[0057] 2. Secondary screening:

[0058] (1) After the bacterial culture was expanded, the culture was centrifuged at 4℃ and 5000g for 10min, the supernatant was discarded, and 10v of PBS buffer (pH=8.0) was added and vortexed to mix.

[0059] (2) Sonicate for 30 min. The sonication conditions are: 800 W, working time 5 s, and interval 3 s. After sonication, centrifuge at 8000 g for 20 min. The supernatant is the crude enzyme solution.

[0060] (3) Mix 0.2g of (4-Br benzoyl) ethyl acetate and 0.16g of L-alanine with 10% v / v DMSO aqueous solution, add 0.25ml of 10mg / ml PLP, add 1-3wt of crude enzyme solution, and make up the volume to 30v with 50mM HEPES-NaOH pH:8.0 buffer, adjust the pH to 8.0, and incubate the reaction at 30℃ and 250rpm with shaking.

[0061] (4) Take a 100 μL sample every 24 hours, add 1 ml of methanol, mix well, filter and send the sample for HPLC detection to confirm the mutant enzyme with improved catalytic reaction efficiency. Some detection results are shown in Table 2.

[0062] Table 2; Partial Detection Results

[0063] Transaminase type Feeding amount Enzyme amount reaction volume Conversion rate ee value reaction time wild type 0.2g 1wt 30v 15.2% >99% 24h P18E 0.2g 1wt 30v 28.8% >99% 24h Y59F 0.2g 1wt 30v 18.1% >99% 24h Y59C 0.2g 1wt 30v 15.5% >99% 24h Y59S 0.2g 1wt 30v 25% >99% 24h Y59R 0.2g 1wt 30v 20.4% >99% 24h S86R 0.2g 1wt 30v 33% >99% 24h S86Q 0.2g 1wt 30v 18.8% >99% 24h S86H 0.2g 1wt 30v 20.6% >99% 24h S86P 0.2g 1wt 30v 19.7% >99% 24h W149R 0.2g 1wt 30v 21.3% >99% 24h W149Q 0.2g 1wt 30v 29.3% >99% 24h W149D 0.2g 1wt 30v 24.1% >99% 24h F188R 0.2g 1wt 30v 22.1% >99% 24h F188D 0.2g 1wt 30v 12.5% >99% 24h F188S 0.2g 1wt 30v 18.1% >99% 24h T231D 0.2g 1wt 30v 41% >99% 24h T231V 0.2g 1wt 30v 15.1% >99% 24h T231G 0.2g 1wt 30v 36.3% >99% 24h L297S 0.2g 1wt 30v 16.2% >99% 24h L297D 0.2g 1wt 30v 21.4% >99% 24h R420E 0.2g 1wt 30v 30.5% >99% 24h R420A 0.2g 1wt 30v 23.5% >99% 24h R420F 0.2g 1wt 30v 19.8% >99% 24h P18E+ Y59S 0.2g 1wt 30v 36.2% >99% 24h P18E+ Y59R 0.2g 1wt 30v 30.5% >99% 24h P18E+ Y59S+ S86R 0.2g 1wt 30v 45.5% >99% 24h P18E+ Y59S+ S86Q 0.2g 1wt 30v 39.2% >99% 24h P18E+ Y59S+ S86R+ T231D 0.2g 1wt 30v 50.5% >99% 24h P18E+ Y59S+ S86R+ T231V 0.2g 1wt 30v 38.2% >99% 24h P18E+ Y59S+ S86R+ T231G 0.2g 1wt 30v 40.2% >99% 24h P18E+ Y59S+ S86R+ R420E 0.2g 1wt 30v 56.2% >99% 24h P18E+ Y59S+ S86R+ R420A 0.2g 1wt 30v 42.1% >99% 24h P18E+ Y59S+ S86R+ R420F 0.2g 1wt 30v 29.9% >99% 24h P18E+ Y59S+ S86R+ T231D+ R420E 0.2g 1wt 30v 76.6% >99% 24h P18E+ Y59S+ S86R+ T231V+ R420E 0.2g 1wt 30v 58.9% >99% 24h P18E+ Y59S+ S86R+ T231G+ R420E 0.2g 1wt 30v 60.2% >99% 24h P18E+ Y59S+ S86R+ T231D+ R420V 0.2g 1wt 30v 69.8% >99% 24h

[0064] As can be seen from Table 2, the mutant P18E+ Y59S+ S86R+ T231D+ R420E had the highest catalytic efficiency of 76.6% after 24 hours.

[0065] Example 4: Optimization of catalytic reaction time for the optimal mutant

[0066] The catalytic performance of the mutant P18E+Y59S+S86R+T231D+R420E, which had the highest activity in the secondary screening, was tested at different reaction times. The reaction system and conditions were the same as in the secondary screening. Samples were taken at 48 hours, 60 hours and 72 hours, respectively. The results are shown in Table 3.

[0067] Table 3: Catalytic activity of mutant P18E+Y59S+S86R+T231D+R420E at different reaction times

[0068] Transaminase type Feeding amount Enzyme amount reaction volume Conversion rate ee value reaction time P18E+ Y59S+ S86R+ T231D+ R420E 0.2g 1wt 30v 97.8% >99% 48h P18E+ Y59S+ S86R+ T231D+ R420E 0.2g 1wt 30v 98.3% >99% 60h P18E+ Y59S+ S86R+ T231D+ R420E 0.2g 1wt 30v 98.8% >99% 72h

[0069] As can be seen from Table 3, the optimal time point for the catalytic reaction of the mutant P18E+ Y59S+ S86R+ T231D+ R420E is around 48 hours, which has high guiding significance for scale-up production.

[0070] Example 5: Application of transaminase mutants

[0071] Using the aforementioned transaminase mutant, with ethyl (4-bromobenzoyl)acetate as the amino acceptor and L-alanine as the amino donor, a transamination reaction was carried out in the presence of pyridoxal-5'-phosphate (PLP) to synthesize ethyl (S)-3-amino-3-(4-bromophenyl)propionate. The reaction route is as follows:

[0072] .

[0073] The reaction system consisted of 50 mM HEPES-NaOH buffer (pH=8.0), 1 mM PLP, 200 mM L-alanine, and 10% v / v DMSO. The reaction conditions were 30°C and incubation with shaking at 250 rpm, with an optimal reaction time of approximately 48 hours.

[0074] This invention solves the technical problem of low catalytic activity of wild-type transaminase for (4-bromobenzoyl)ethyl acetate by mutating key sites of transaminase derived from *Ruegeria sp.*. With 4 wt of bacterial sludge, a 60V reaction system, and a reaction time of 100 hours, the wild-type enzyme achieves only 16% conversion of the substrate to the target product. In contrast, the mutant of this invention, with 1 wt of enzyme and a 30V reaction system, achieves a maximum conversion rate of 76.6% after 24 hours and a conversion rate as high as 97.8% after 48 hours, reducing enzyme dosage and reaction volume, and shortening reaction time.

[0075] When synthesizing ethyl (S)-3-amino-3-(4-bromophenyl)propionate using all mutants of this invention, the ee value remains >99%, eliminating the need for additional chiral resolution steps and directly meeting the high purity requirements of pharmaceutical intermediates, thus reducing subsequent separation and purification costs.

[0076] The catalytic reaction of this invention is carried out at room temperature and near-neutral pH conditions, without the need for expensive metal catalysts and high-pressure equipment. It replaces the complex and polluting chemical synthesis method, reduces industrial waste emissions, and conforms to the trend of green chemical development.

[0077] The mutant of this invention can be expressed heterologously and efficiently in Escherichia coli BL21 cells. The expression and screening process is simple and easy to operate. The crude enzyme solution can meet the catalytic requirements. The reaction system is easy to scale up and can effectively reduce the cost and difficulty of industrial production. It provides a feasible path for the large-scale preparation of ethyl (S)-3-amino-3-(4-bromophenyl)propionate.

[0078] Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art and related fields based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

Claims

1. A transaminase mutant, characterized in that, one or more of P18, Y59, S86, W149, F188, T231, L297, and R420 are mutated based on the amino acid sequence of the transaminase of Ruegeria sp. shown in SEQ ID NO: 1; each of the mutations at the sites includes any one or more of P18E, Y59F / G / C / S / R / D, S86R / Q / H / P / A / E, W149R / Q / E / D, F188R / D / C / S / G, T231A / D / V / G, L297S / D, and R420E / A / F; wherein the letter before the number represents the original amino acid and the letter after the number represents the mutated amino acid, and " / " means "or".

2. The transaminase mutant of claim 1, wherein, the transaminase mutants include any one of the following combinations of amino acid mutations: P18E; Y59F / G / C / S / R / D; S86R / Q / H / P / A / E; W149R / Q / E / D; F188R / D / C / S / G; T231A / D / V / G; L297S / D; R420E / A / F; P18E+Y59F / G / C / S / R / D; P18E+ S86R / Q / H / P / A / E; P18E+ W149R / Q / E / D; P18E+ F188R / D / C / S / G; P18E+ T231A / D / V / G; P18E+ L297S / D; P18E+ R420E / A / F; P18E+Y59F / G / C / S / R / D+S86R / Q / H / P / A / E; P18E+Y59F / G / C / S / R / D+W149R / Q / E / D; P18E+Y59F / G / C / S / R / D+F188R / D / C / S / G; P18E+Y59F / G / C / S / R / D+T231A / D / V / G; P18E+Y59F / G / C / S / R / D+L297S / D; P18E+Y59F / G / C / S / R / D+R420E / A / F; P18E+ S86R / Q / H / P / A / E +W149R / Q / E / D; P18E+ S86R / Q / H / P / A / E +F188R / D / C / S / G; P18E+ S86R / Q / H / P / A / E +T231A / D / V / G; P18E+ S86R / Q / H / P / A / E +F188R / D / C / S / G; P18E+ S86R / Q / H / P / A / E +T231A / D / V / G; P18E+ Y59F / G / C / S / R / D + S86R / Q / H / P / A / E + W149R / Q / E / D; P18E+ Y59F / G / C / S / R / D + S86R / Q / H / P / A / E + F188R / D / C / S / G; P18E+ Y59F / G / C / S / R / D + S86R / Q / H / P / A / E + T231A / D / V / G; P18E+ Y59F / G / C / S / R / D + S86R / Q / H / P / A / E + L297S / D; P18E+ Y59F / G / C / S / R / D + S86R / Q / H / P / A / E + R420E / A / F; P18E+ Y59F / G / C / S / R / D + S86R / Q / H / P / A / E + T231A / D / V / G + R420E / A / F.

3. The transaminase mutant of claim 2, wherein, The transaminase mutant is a quintuple mutant, and the mutation combination is P18E+Y59S+S86R+T231D+R420E.

4. A DNA molecule, characterized in that, The DNA molecule encodes the transaminase mutant of any one of claims 1-3.

5. A recombinant plasmid, characterized in that, The recombinant plasmid comprises the DNA molecule of claim 4.

6. The recombinant plasmid of claim 5, wherein, The recombinant plasmid comprises the DNA molecule of claim 4.

7. A host cell, characterized in that, The recombinant plasmid comprises the DNA molecule of claim 4.

8. The host cell of claim 7, wherein, The recombinant plasmid comprises the DNA molecule of claim 4.

9. Use of a transaminase mutant according to any one of claims 1 to 3 for catalysing the synthesis of (S)-ethyl 3-amino-3-(4-bromophenyl)propanoate, characterized in that, The host cell is Escherichia coli BL21 cell. 。 10. Use according to claim 8, characterized in that, The transamination reaction was carried out with ethyl (4-bromobenzoyl) acetate as an amino acceptor and L-alanine as an amino donor in the presence of pyridoxal-5'-phosphate (PLP), and the reaction route is as follows: The reaction system comprises 50mM HEPES-NaOH buffer (pH=8.0), 1mM PLP, 200mM L-alanine, 10% v / v DMSO, and the reaction condition is 30℃, 250rpm shaking incubation.